Literature DB >> 30458768

Development and evaluation of serotype-specific recombinase polymerase amplification combined with lateral flow dipstick assays for the diagnosis of foot-and-mouth disease virus serotype A, O and Asia1.

Hongmei Wang1, Peili Hou1, Guimin Zhao1, Li Yu2, Yu-Wei Gao3, Hongbin He4.   

Abstract

BACKGROUND: Foot-and-mouth disease (FMD) caused by foot-and-mouth disease virus (FMDV) is one of the most highly infectious diseases in livestock, and leads to huge economic losses. Early diagnosis and rapid differentiation of FMDV serotype is therefore integral to the prevention and control of FMD. In this study, a series of serotype-specific reverse transcription recombinase polymerase amplification assays combined with lateral flow dipstick (RPA-LFD) were establish to differentiate FMDV serotypes A, O or Asia 1, respectively.
RESULTS: The serotype-specific primers and probes of RPA-LFD were designed to target conserved regions of the FMDV VP1 gene sequence, and three primer and probe sets of serotype-specific RPA-LFD were selected for amplification of FMDV serotypes A, O or Asia 1, respectively. Following incubation at 38 °C for 20 min, the RPA amplification products could be visualized by LFD. Analytical sensitivity of the RPA assay was then determined with ten-fold serial dilutions of RNA of VP1 gene and the recombinant vector respectively containing VP1 gene from FMDV serotypes A, O or Asia1, the detection limits of these assays were 3 copies of plasmid DNA or 50 copies of viral RNA per reaction. Moreover, the specificity of the assay was assessed, and there was no cross reactions with other viruses leading to bovine vesicular lesions. Furthermore, 126 clinical samples were respectively detected with RPA-LFD and real-time PCR (rPCR), there was 98.41% concordance between the two assays, and two samples were positive by RPA-LFD but negative in rPCR, these were confirmed as FMDV-positive through viral isolation in BHK-21 cells. It showed that RPA-LFD assay was more sensitive than the rPCR method in this study.
CONCLUSION: The development of serotype-specific RPA-LFD assay provides a rapid, sensitive, and specific method for differentiation of FMDV serotype A, O or Asia1, respectively. It is possible that the serotype-specific RPA-LFD assay may be used as a integral protocol for field detection of FMDV.

Entities:  

Keywords:  FMDV; Lateral flow dipstick; Recombinase polymerase amplification; Serotype-specific

Mesh:

Year:  2018        PMID: 30458768      PMCID: PMC6245561          DOI: 10.1186/s12917-018-1644-4

Source DB:  PubMed          Journal:  BMC Vet Res        ISSN: 1746-6148            Impact factor:   2.741


Background

Foot-and-mouth disease (FMD) is an acute, highly contagious disease that affects cloven-hoofed animals, often resulting in huge economical losses in terms of trade and animal productivity. Recent outbreaks of FMD in Taiwan, Japan, South Korea and the United Kingdom have directly caused the culling of millions of animals, compensated heavily by the government [1, 2]. The responsible virus, FMD virus (FMDV), was a single-stranded positive-sense RNA virus belonging to the Aphthovirus genus in the family Picornaviridae. There were seven serotypes including O, A, C, Asia 1, and South African Territories (SAT) 1, 2 and 3, which together manifest a distinct geographical distribution [3]. FMDV serotype A, C and O are widely distributed across the world while Asia 1 and SAT 1–3 mainly occur in Asia and Africa, respectively. Several outbreaks of FMD serotype Asia 1, O and A have been recorded in mainland provinces of Southern China during 1999–2013 [4-6]. Early diagnosis of FMDV is therefore essential to providing valuable epidemiological information, and initiating the appropriate prevention and control strategies. FMDV can be detected from blood, esophageal-pharyngeal fluid, nasal fluid, saliva, and other excretions of FMDV infected animals before clinical symptoms [7, 8] start to show. Currently, there are three typical assays for FMDV diagnosis including virus isolation, antigen enzyme-linked immunosorbent assay (Ag-ELISA) and real-time RT-PCR (rRT-PCR) used in FMDV reference laboratories [9]. However, these diagnostic tests require special equipment and professionally trained personnel. Another alternative propose is to use isothermal assays for diagnosis of FMDV. To date, there are four isothermal assays to detect FMDV: reverse transcription loop-mediated isothermal amplification (RT-LAMP) [10, 11], reverse transcription recombinase polymerase amplification (RT-RPA) [12], and nucleic acid sequence based amplification [13, 14]. RT-LAMP and RT-RPA have also been used to distinguish various serotypes in clinical samples [11, 12]. However, LAMP assay needs more primers than PRA, leading to longer amplicons and difficult designs in cases of highly variable viruses. The RPA method is probably the one promising direction capable of rapid diagnosis of many different pathogens [12, 15–18]. The amplification relies on recombinase, single stranded binding protein, and strand displacing DNA polymerase at a constant temperature. The RPA products could be analyzed with gel electrophoresis, fluorescence monitoring based on probes, or simple visualization with a lateral flow dipstick (LFD) [19-22]. In the present study, a reverse transcription serotype-specific RPA-LFD assay was established, and evaluated as a field method for diagnosis and typing of FMDV serotypes A, Asia 1 or O, respectively.

Results

Design and optimization of serotype-specific RPA primers and probe

The TwistAmp nfo reactions were performed to screen the candidate primer/probes for the RPA-LFD assay, the products were analyzed on 2% agarose gel. A6, As9, O6 sets of the primer/probes were respectively screened as serotype-specific RPA primers and probe for FMDV serotypes A, Asia-1, or O. They respectively produced 346 bp and 334 bp, 286 bp and 182 bp, 231 bp and 190 bp amplification products and their RPA-LFD test line appeared faster and darker than other sets within 5 min (Table 1 and Fig. 1).
Table 1

The sequences of primers and probes designed for screening in the study

Primer/probe set NameSequence(5′ → 3′)The location on accession numberProduct sizes (bp)
F2ATGGAGCACCTGAGGCAGCACTGGACAACA3452–3481221
A1P1[FAM]CACTGGACAACACGAGCAACCCCACTGCTTA[dSpacer] TATAAAGCACCGTTCACA[C3-spacer]3470–3519203
R1[Biotin]CGTTGAGAAGGGCACAGTCGTATTGAAACA3643–3672
F2ATGGAGCACCTGAGGCAGCACTGGACAACA3452–3481258
A2P1[FAM]CACTGGACAACACGAGCAACCCCACTGCTTA[dSpacer] TATAAAGCACCGTTCACA[C3-spacer]3470–3519250
R2[Biotin]GCACGAGGAGTTCTTGGATCTCCGTGGCTC3680–3709
F2ATGGAGCACCTGAGGCAGCACTGGACAACA3452–3481352
A3P1[FAM]CACTGGACAACACGAGCAACCCCACTGCTTA[dSpacer] TATAAAGCACCGTTCACA[C3-spacer]3470–3519229
R3[Biotin]GCAGGGGCAATAATTTTCTGCTTGTGTCTG3774–3803
F1CACCTGAGGCAGCACTGGACAACACGAGCAA3458–3488215
A4P1[FAM]CACTGGACAACACGAGCAACCCCACTGCTTA[dSpacer] TATAAAGCACCGTTCACA[C3-spacer]3470–3519203
R1[Biotin]GCCGTAGTTGAAGGAGGCAGGAAGCTGTGC3643–3672
F1CACCTGAGGCAGCACTGGACAACACGAGCAA3458–3488252
A5P1[FAM] CACTGGACAACACGAGCAACCCCACTGCTTA[dSpacer] TATAAAGCACCGTTCACA[C3-spacer]3470–3519240
R2[Biotin]GCACGAGGAGTTCTTGGATCTCCGTGGCTC3680–3709
A6 (Optimal set)F1CACCTGAGGCAGCACTGGACAACACGAGCAA3458–3488346
P1[FAM]CACTGGACAACACGAGCAACCCCACTGCTTA[dSpacer] TATAAAGCACCGTTCACA[C3-spacer]3470–3519334
R3[Biotin]GCAGGGGCAATAATTTTCTGCTTGTGTCTG3774–3803
F3TGAGGCAGCACTGGACAACACGAGCAACCC3462–3461211
A7P1[FAM]CACTGGACAACACGAGCAACCCCACTGCTTA[dSpacer] TATAAAGCACCGTTCACA[C3-spacer]3470–3519203
R1[Biotin]GCCGTAGTTGAAGGAGGCAGGAAGCTGTGC3643–3672
F3TGAGGCAGCACTGGACAACACGAGCAACCC3462–3461248
A8P1[FAM]CACTGGACAACACGAGCAACCCCACTGCTTA[dSpacer] TATAAAGCACCGTTCACA[C3-spacer]3470–3519240
R2[Biotin]GCACGAGGAGTTCTTGGATCTCCGTGGCTC3680–3709
F3TGAGGCAGCACTGGACAACACGAGCAACCC3462–3461342
A9P1[FAM]CACTGGACAACACGAGCAACCCCACTGCTTA[dSpacer] TATAAAGCACCGTTCACA[C3-spacer]3470–3519334
R3[Biotin]GCAGGGGCAATAATTTTCTGCTTGTGTCTG3774–3803
F1AAAAGCAACCCATTACCCGCCTGGCACTCC3582–3611285
As1P1[FAM]ACCCGCCTGGCACTCCCTTACACCGCTCCC[dSpacer]ACCGTGTGCTTGCAACAGT[C3-spacer]3596–3645271
R2[Biotin]GACTCTTCCCCGTAGGTTGTCTTCCCGTTG3837–3866
As2F1AAAAGCAACCCATTACCCGCCTGGCACTCC3582–3611145
P1[FAM]ACCCGCCTGGCACTCCCTTACACCGCTCCC[dSpacer]ACCGTGTGCTTGCAACAGT[C3-spacer]3596–3645131
R3[Biotin]GGGAGTGCCAGGCGGGTAATGGGTTGCTTT3697–3726
F2AACCCAACCGCCTACCAAAAGCAACCCATT3566–3595153
As3P1[FAM]ACCCGCCTGGCACTCCCTTACACCGCTCCC[dSpacer]ACCGTGTGCTTGCAACAGT[C3-spacer]3596–3645123
R1[Biotin]CGGTGTAAGGGAGTGCCAGGCGGGTAATGG3689–3718
F2AACCCAACCGCCTACCAAAAGCAACCCATT3566–3595301
As4P1[FAM]ACCCGCCTGGCACTCCCTTACACCGCTCCC[dSpacer]ACCGTGTGCTTGCAACAGT[C3-spacer]3596–3645271
R2[Biotin]GACTCTTCCCCGTAGGTTGTCTTCCCGTTG3837–3866
F2AACCCAACCGCCTACCAAAAGCAACCCATT3566–3595161
As5P1[FAM]ACCCGCCTGGCACTCCCTTACACCGCTCCC[dSpacer]ACCGTGTGCTTGCAACAGT[C3-spacer]3596–3645131
R1[Biotin]CGGTGTAAGGGAGTGCCAGGCGGGTAATGG3689–3718
F3CGAATCAGCAGACCCAGTTACCACCACAGT3274–3303445
As6P2[FAM]TGAAACTCACACAGCTCAAGAACACCCAAACT[dSpacer] TTGATCTTATGCAAATC[C3-spacer]3378–3427341
R1[Biotin]CGGTGTAAGGGAGTGCCAGGCGGGTAATGG3689–3718
F3CGAATCAGCAGACCCAGTTACCACCACAGT3274–3303593
As7P2[FAM]TGAAACTCACACAGCTCAAGAACACCCAAACT[dSpacer] TTGATCTTATGCAAATC[C3-spacer]3378–3427489
R2[Biotin]GACTCTTCCCCGTAGGTTGTCTTCCCGTTG3837–3866
F3CGAATCAGCAGACCCAGTTACCACCACAGT3274–3303453
As8P2[FAM]TGAAACTCACACAGCTCAAGAACACCCAAACT[dSpacer] TTGATCTTATGCAAATC[C3-spacer]3378–3427349
R3[Biotin]GGGAGTGCCAGGCGGGTAATGGGTTGCTTT3697–3726
As9 (Optimal set)F3CGAATCAGCAGACCCAGTTACCACCACAGT3274–3303286
P2[FAM]TGAAACTCACACAGCTCAAGAACACCCAAACT[dSpacer] TTGATCTTATGCAAATC[C3-spacer]3378–3427182
R4[Biotin]GAGAAGTAGTACGTCGCAGACCGAAGTAGCG3530–3559
F3CGAATCAGCAGACCCAGTTACCACCACAGT3274–3303445
As10P1[FAM]ACCCGCCTGGCACTCCCTTACACCGCTCCC[dSpacer]ACCGTGTGCTTGCAACAGT[C3-spacer]3378–3427341
R1[Biotin]CGGTGTAAGGGAGTGCCAGGCGGGTAATGG3689–3718
F3CGAATCAGCAGACCCAGTTACCACCACAGT3274–3303593
As11P1[FAM]ACCCGCCTGGCACTCCCTTACACCGCTCCC[dSpacer]ACCGTGTGCTTGCAACAGT[C3-spacer]3596–3645271
R2[Biotin]GACTCTTCCCCGTAGGTTGTCTTCCCGTTG3837–3866
F1CAACACCACCAACCCAACGGCGTACCATAA3570–3599161
O1P1[FAM]CGTACCATAAGGCGCCGCTTACCCGGCTTA[dSpacer] ATTGCCCTACACGGCACCA[C3-spacer]3590–3639141
R1[Biotin]GAGCCAGCACTTGGAGATCGCCTCTCACGT3701–3730
F1CAACACCACCAACCCAACGGCGTACCATAA3570–3599343
O2P1[FAM]CGTACCATAAGGCGCCGCTTACCCGGCTTA[dSpacer] ATTGCCCTACACGGCACCA[C3-spacer]3590–3639323
R2[Biotin]CAAGGACTGCTTTACAGGTGCCACTATTTT3883–3912
F1CAACACCACCAACCCAACGGCGTACCATAA3570–3599210
O3P1[FAM]CGTACCATAAGGCGCCGCTTACCCGGCTTA[dSpacer] ATTGCCCTACACGGCACCA[C3-spacer]3590–3639190
R3[Biotin]TTGATGGCACCGTAGTTGAAAGAAGTAGGC3751–3779
F2GGAGCACCTGAAGCAGCCTTGGACAACACC3549–3578182
O4P1[FAM]CGTACCATAAGGCGCCGCTTACCCGGCTTA[dSpacer] ATTGCCCTACACGGCACCA[C3-spacer]3590–3639141
R1[Biotin]GAGCCAGCACTTGGAGATCGCCTCTCACGT3701–3730
F2GGAGCACCTGAAGCAGCCTTGGACAACACC3549–3578364
O5P1[FAM]CGTACCATAAGGCGCCGCTTACCCGGCTTA[dSpacer] ATTGCCCTACACGGCACCA[C3-spacer]3590–3639323
R2[Biotin]CAAGGACTGCTTTACAGGTGCCACTATTTT3883–3912
O6 (Optimal set)F2GGAGCACCTGAAGCAGCCTTGGACAACACC3549–3578231
P1[FAM]CGTACCATAAGGCGCCGCTTACCCGGCTTA[dSpacer] ATTGCCCTACACGGCACCA[C3-spacer]3590–3639190
R3[Biotin]TTGATGGCACCGTAGTTGAAAGAAGTAGGC3751–3779
F3GGGGACCTTACCTGGGTGCCAAATGGAGCA3524–3553217
O7P2[FAM]CAAATGGAGCACCTGAAGCAGCCTTGGACAA[dSpacer]ACCACCAACCCAACGGCGTAC[C3-spacer]3542–3596189
R1[Biotin]GAGCCAGCACTTGGAGATCGCCTCTCACGT3701–3730
F3GGGGACCTTACCTGGGTGCCAAATGGAGCA3524–3553389
O8P2[FAM]CAAATGGAGCACCTGAAGCAGCCTTGGACAA[dSpacer]ACCACCAACCCAACGGCGTAC[C3-spacer]3542–3596371
R2[Biotin]CAAGGACTGCTTTACAGGTGCCACTATTTT3883–3912
F3GGGGACCTTACCTGGGTGCCAAATGGAGCA3524–3553256
O9P2[FAM]CAAATGGAGCACCTGAAGCAGCCTTGGACAA[dSpacer]ACCACCAACCCAACGGCGTAC[C3-spacer]3542–3596238
R3[Biotin]TTGATGGCACCGTAGTTGAAAGAAGTAGGC3751–3779

Note: F:forward primer, R reverse primer, P probe, FAM Carboxyfluorescein, dSpacer A tetrahydrofuran residue, C3-spacer 3’-block

Fig. 1

Screening of the primers/probes for the FMDV serotype-specific RPA-LFD assay. a Agarose gel electrophoresis and LFD detection of RT-RPA products amplified with different primer and probe sets of FMDV serotype A. Lane M was DNA Marker DL1000. A1 to A9 were different primer and probe sets. A6: the optimal primer and probe set, and the estimated size of the RPA amplified fragment were 346 bp and 334 bp. A10: negative control, (DNase-free water). A11: positive control (supplied by Twist Amp nfo kit). b Agarose gel electrophoresis and LFD detection of RT-RPA products amplified with different primers/probe sets of FMDV serotype Asia 1. As2 to As10 were different primer and probe sets. As9: the optimal primer/probe set, and the estimated size of the RPA amplified fragment were 286 bp and 182 bp. As1: negative control (DNase-free water). As10: positive control (supplied by Twist Amp nfo kit). c Agarose gel electrophoresis and LFD detection of RT-RPA products amplified with different primers/probe sets of FMDV serotype O. O1 to O9 were different primer and probe sets. O6: the optimal primer/probe set, and the estimated size of the RPA amplified fragment were 231 bp and 190 bp. O10: negative control (DNase-free water). O11: positive control (supplied by Twist Amp nfo kit)

The sequences of primers and probes designed for screening in the study Note: F:forward primer, R reverse primer, P probe, FAM Carboxyfluorescein, dSpacer A tetrahydrofuran residue, C3-spacer 3’-block Screening of the primers/probes for the FMDV serotype-specific RPA-LFD assay. a Agarose gel electrophoresis and LFD detection of RT-RPA products amplified with different primer and probe sets of FMDV serotype A. Lane M was DNA Marker DL1000. A1 to A9 were different primer and probe sets. A6: the optimal primer and probe set, and the estimated size of the RPA amplified fragment were 346 bp and 334 bp. A10: negative control, (DNase-free water). A11: positive control (supplied by Twist Amp nfo kit). b Agarose gel electrophoresis and LFD detection of RT-RPA products amplified with different primers/probe sets of FMDV serotype Asia 1. As2 to As10 were different primer and probe sets. As9: the optimal primer/probe set, and the estimated size of the RPA amplified fragment were 286 bp and 182 bp. As1: negative control (DNase-free water). As10: positive control (supplied by Twist Amp nfo kit). c Agarose gel electrophoresis and LFD detection of RT-RPA products amplified with different primers/probe sets of FMDV serotype O. O1 to O9 were different primer and probe sets. O6: the optimal primer/probe set, and the estimated size of the RPA amplified fragment were 231 bp and 190 bp. O10: negative control (DNase-free water). O11: positive control (supplied by Twist Amp nfo kit) Besides that, different reaction conditions were optimized for the serotype-specific RPA assay. Results showed that a reaction temperature at 38 °C (Fig. 2a) and a incubation time of 20 min or longer (Fig. 2b) can best promote the amplification efficiency. Thus, the amplification reaction for the serotype-specific RPA assay should be carried out at 38 °C for 20 min.
Fig. 2

Optimization of reaction temperature and time for FMDV serotype-specific RPA-LFD assays. a The RPA-LFD performs effectively in a wide range of constant reaction temperatures. b The amplified products can be visible on the LFD at 5 min or longer

Optimization of reaction temperature and time for FMDV serotype-specific RPA-LFD assays. a The RPA-LFD performs effectively in a wide range of constant reaction temperatures. b The amplified products can be visible on the LFD at 5 min or longer

Sensitivity and specificity of the FMDV serotype-specific RPA reaction

To determine the sensitivity of RPA assay, positive vector and RNA standard of three FMDV serotypes were diluted from 3 × 106 to 3 × 100 copies/μL and 5 × 107 to 5 × 101 molecules/μL, respectively. RNA was reversely transcribed to cDNA. All reverse transcriptional cDNA and positive vectors of each dilution were respectively used as templates in the RPA reactions. All RPA reaction products were than respectively tested on LFD, and the limit of detection with the RPA-LFD was 3 × 100 dilution for positive vector (Fig. 3a) and 5 × 101 dilution for RNA standard (Fig. 3b).
Fig. 3

The sensitivity of FMDV serotype-specific RPA-LFD assays. a Sensitivity of the standard plasmids. Molecular sensitivity of RPA-LFD was determined using 10-fold serially diluted 3 × 106 to 3 × 100 copies and 100 copy of FMDV DNA standard plasmids per reaction as template. The minimum limits for virus detection of RPA-LFD were 3 × 100 copies. b Sensitivity of the RNA standard. The cDNA of reverse transcription using 10-fold serially diluted 5 × 106 to 5 × 100 RNA molecular was used in molecular sensitivity of RPA-LFD. The minimum limits detection of RPA-LFD were 5 × 100 RNA. A: primers/probe set of FMDV serotype A. AS: primers/probe sets of FMDV serotype Asia 1. O: primers/probe sets of FMDV serotype O. Samples were tested in triplicate with one reaction and independently repeated 3 times

The sensitivity of FMDV serotype-specific RPA-LFD assays. a Sensitivity of the standard plasmids. Molecular sensitivity of RPA-LFD was determined using 10-fold serially diluted 3 × 106 to 3 × 100 copies and 100 copy of FMDV DNA standard plasmids per reaction as template. The minimum limits for virus detection of RPA-LFD were 3 × 100 copies. b Sensitivity of the RNA standard. The cDNA of reverse transcription using 10-fold serially diluted 5 × 106 to 5 × 100 RNA molecular was used in molecular sensitivity of RPA-LFD. The minimum limits detection of RPA-LFD were 5 × 100 RNA. A: primers/probe set of FMDV serotype A. AS: primers/probe sets of FMDV serotype Asia 1. O: primers/probe sets of FMDV serotype O. Samples were tested in triplicate with one reaction and independently repeated 3 times The other viral pathogens with similar clinical signs, including BEV, BVDV, BEFV, VSV, IBRV, and SVDV, were used to assess the specificity of the assay. IBRV DNA and other viral cDNA were respectively detected with the RPA-LFD. There was no cross reaction with the other bovine viral pathogens with similar clinical signs (Fig. 4). The cDNA of other FMDV epidemic virus strains in China were used for detection of serotype-specific RPA-LFD. There was no cross-reactivity with different serotype strains of FMDV, so the specific primer and probe sets could differentiate the corresponding serotype virus.
Fig. 4

The specificity of the FMDV RPA-LFD assays. Other bovine viral pathogens with similar clinic and etiologies were used to assess the specificity of the assays. There was no cross-reaction with BVDV, IBRV, BEV, BEFV, BVSV and SVDV. NC: negative control. A: primers/probe set of FMDV serotype A. AS: primers/probe set of FMDV serotype Asia 1. O: primers/probe set of FMDV serotype O. Samples were tested in triplicate with one reaction and three separate assays

The specificity of the FMDV RPA-LFD assays. Other bovine viral pathogens with similar clinic and etiologies were used to assess the specificity of the assays. There was no cross-reaction with BVDV, IBRV, BEV, BEFV, BVSV and SVDV. NC: negative control. A: primers/probe set of FMDV serotype A. AS: primers/probe set of FMDV serotype Asia 1. O: primers/probe set of FMDV serotype O. Samples were tested in triplicate with one reaction and three separate assays

Performance of FMDV serotype-specific RPA-LFD assay on clinical samples

To evaluate the diagnostic sensitivity of the FMDV RPA-LFD assay, cDNA obtained from each specimen of 126 clinical samples were detected with RPA-LFD and rPCR, respectively. RPA-LFD identified 41 negative and 85 positive samples (25 vesicular material, 14 saliva, 10 aerosol, 14 oesophageal-pharyngeal fluid, 9 blood and 13 nasal swabs) (Table 2). Of the 85 positive samples, 32 were serotyped as serotype A, 17 as serotype Asia 1, and 36 as serotype O. The concordance between FMDV RPA-LFD and rPCR was 98.41% (124/126).
Table 2

Comparative performance of serotype-specific RT-LFD-RPA and rRT-PCR assays for detection of suspected clinical specimens and serotyping of FMDV

LFD-RPAReal-time(qPCR)
Samples nameAAsia 1OFMDV positiveFMDV NegativeAAsia 1OFMDV positiveFMDV Negative
vesicular material73152557315255
nasal swab625137625137
saliva53614155361415
oesophageal pharyngeal fluid644143644143
blood4239742397
aerosol43310433286
Total32173685413117358343
Comparative performance of serotype-specific RT-LFD-RPA and rRT-PCR assays for detection of suspected clinical specimens and serotyping of FMDV It is worth noting that 4 aerosol specimens of FMDV serotype A were designated as positive by the RPA-LFD assay, but only 3 of them were FMDV serotype A positive detected by the rPCR, and 3 aerosol specimens of FMDV serotype O were differentiated with the RPA-LFD assay, whereas 2 of them were FMDV serotype O positive using the rPCR. BHK-21 cells were used to isolate viruses and identify the two inconsistent aerosol specimens, and CPE of cells inoculated with two inconsistent samples appeared untill the third passage. CPE-positive cell and control cell culture were respectively harvested and detected for FMDV using rPCR and RPA-LFD. As expected, CPE-positive cells were respectively identified for FMDV serotype O and A, and the control cells were FMDV negative, it showed that the sensitivity of RPA-LFD assay was higher than the rPCR in this study.

Discussion

There are a series of methods used as detection of FMDV, such as Ag-ELISA, virus separation, and rRT-PCR. However, the above methods have been either too time-consuming or require high-precision instruments to meet practical needs [19, 20]. RPA isothermal amplification techniques can amplify nucleic acids and detect the products without a requirement of special instrument or complex operations [21-24]. It is worth mentioning that human body heat can indeed incubate RPA reactions under certain limit resources [25]. Moreover, it is not required to store the lyophilized RPA reagents with a cooling chain because they can actually be stably stored at room temperature for a longer time [26]. Although it has been proved that the pan-specific real-time RT-RPA (rRT-RPA) and RPA-LFD technique can provide rapid and accurate diagnosis of FMDV [12, 18], they are difficult to distinguish the serotypes of FMDV for the rRT-RPA assay. The VP1, a surface exposed-capsid protein, take a pivotal role in the antigenicity as a major viral antigen, and plays an important role in pathogenicity of FMDV as its binding to viral receptors of host cells. Because of heterogeneity, the nucleotide sequence encoding VP1 is widely used to determine genetic relationships between different strains and to trace the provenance and transmission route of epidemic FMDV strains [27-30]. In this study, primer and probe sets specific for serotypes O, A, or Asia-1 FMDV were designed based on the alignment of the nucleotide sequences of viral VP1 gene of the above serotypes strains circulating in Asia, respectively. The primer and probe sets A6, As9, and O6 screened for RPA in this study could perform effective and accurate detection of different FMDV serotype of A/China/5/99, Asia1/AF/72, and O/HNK/CHA/05 (see Fig. 1) as intended. Furthermore, the serotype-specific RPA-LFD assay successfully detected the epidemic strains of FMDV in China (Table 2), and provided a more robust assessment method regarding the serotype specificity. FMDV is mainly transmitted by aerosol. Viral RNA was detected in aerosol samples from FMDV suspected farm at 1–3 days before infected cattle appeared clinical signs [31]. Based on the aerogenous characteristics of the FMDV, it’s proven to be a valuable technique that aerosol samples were used to detect viral RNA in infected farms [31, 32]. In our study, viruses in aerosol were also detected and their serotypes were respectively differentiated by the FMDV RPA-LFD assay. Therefore, it may be the potential integral monitoring strategies for prevention, control and eradication of FMD using this technique. It is a crucial step for clinical detection with any molecular diagnostic assay that the nucleic acids are extracted from tissue and cell samples, the Punch-it™ kit can easily isolate nucleic acid from different samples via paper chromatography, and becomes one of the ideal tools for the extraction of DNA/RNA. Recent study showed that the DNA isolated with the Punch-it™ kit could be used in molecular assays [33]. In our study, nucleic acids of different samples, including vesicular material, blood, oesophageal-pharyngeal fluid, saliva, aerosol, and nasal swabs, were successfully extracted using the Punch-it™ kit. The method only takes 10 min to extract the nucleic acid without centrifugation, so it is relatively simple and rapid, and it is even more important that the extracted nucleic acids can directly serve as templates in RPA-LFD assays. In the present study, the extracted total RNA needed to be reverse transcribed into cDNA in the two-step RPA-LFD assay, whereas reverse transcription and RPA were performed in one reaction using the TwistAmp™ exo kit (TwistDx Limited, UK) and with the addition of reverse transcriptase in previously studied RT-RPA assays [12]. We would like to further simplify the test to make it more suitable for field use in future. Moreover, sophisticated instrumentations were required in RT-RPA [12, 15, 16], whereas RPA-LFD assay in this study only needs a thermos metal bath for incubation at 38 °C and amplified products can be direct visible on the LFD without requirements of instruments. Therefore, it may be an effective way to detect clinical samples in the field.

Conclusions

In the present study, the serotype-specific FMDV RPA-LFD assay was successfully developed, and will be helpful for detection of FMDV infection during FMD outbreaks. Because RPA-LFD assay is a simple, specific, rapid, and serotype-specific method, it is possible to be a general differentiated protocol for diagnostics of FMDV, especially for detection of clinical samples in the field.

Methods

Virus and clinical specimens

In this study, cDNA of three serotypes of FMDV reference strains including type O strain China/5/99, type A strain AF/72, and type Asia 1 strain HNK/CHA/05, which were provided by Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, were positive controls of various serotypes used to optimize primer and probe sets of RPA. The cDNA of other epidemic FMDV strains in China including type A (HuBWH/2009, Mya98, GSLX/2010, GDMM/2013), type Asia1 (ZB/58, HeB/05, YS/05, HN/06, BR/Myanmar/06, WHN/06), and type O (LY/2000, CC/03, GZ/2010, BY/2010, HKN/2011, GD/2013, GD/2015), were used to provide a more robust assessment of serotype-specific RPA. Other viral pathogens causing similar clinical vesicular signs, including bovine ephemeral fever virus (BEFV), vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), bovine enterovirus (BEV), infectious bovine rhinotracheitis virus (IBRV),and swine vesicular disease virus (SVDV), were stored by the Ruminant Diseases Research Center, Shandong Normal University, and used for cross-reactivity testing. To compare the detection sensitivity between RPA-LFD reactions and rPCR, 126 clinical specimens (30 vesicular materials, 29 salivas, 14 aerosols, 16 bloods, 17 oesophageal-pharyngeal fluids, and 20 nasal swabs) were collected from suspected cases of FMD in the Chinese endemic region from 2013 to 2017.

Isolation of viral RNA/DNA and synthesis of cDNA

Viral RNA and DNA were isolated using the MiniBEST Viral RNA/DNA Extraction Kit (TaKaRa, Dalian, China) following respective instructions. The amounts of viral RNA was measured using a Biophotometer plus (Eppendorf, USA). The extracted RNA was template used to synthesized cDNA with reverse transcription using random primers in a total volume of 10 μL according to the instructions of the PrimeScript™ RT Master Mix (Takara, Dalian, China). All viral DNA and cDNA were stored at − 70 °C for further employment.

Generation of DNA/RNA molecular standard

The viral VP1 gene recombinant vectors respectively containing RPA amplified region of FMDV serotype O, A, or Asia 1 (named pET32a-A-FMDV-VP1, pET32a-AS1-FMDV-VP1 and pET32a-O-FMDV-VP1) were constructed and used for the analytical sensitivity. The Positive plasmids were measured using a Biophotometer plus (Eppendorf, USA), respectively. The quantity of copies was calculated by the formula: DNA copy number (copies/μL) = (M × 6.02 × 1023 × 10− 9)/(n × 660), M: molecular weight, n:plasmid concentration (g/μL) measured at 260 nm. RNA molecular standards were prepared as described in previous study [17] with certain modifications. The linearized recombinant vectors with SgrA I (New England Biolabs, USA) were purified with the MiniBEST DNA Fragment Purification Kit (Takara, Dalian, China), and then used as template for RNA transcription with the RiboMAX Large Scale RNA Production System-T7 (Promega, USA). Furthermore, the RNA was measured using the Quant-iTTM RiboGreen RNA Assay Kit (Thermo Fisher Scientific, Germany) according to the manufacturer’s instructions. The quantity of copies was calculated by the equation: Amount (copies/μL) = [RNA concentration (g/μL)/(transcript length in nucleotides× 340)] × 6.02 × 1023.

Design of serotype-specific RPA primers and probe

A multiple sequence alignment of FMDV strains of serotype A, Asia 1, or O was respectively performed to find highly conserved region of the FMDV VP1 gene. The following reference sequences of three serotypes found in GenBank database were respectively used: KT968663(A/HY/CHA/2013), FJ755082 (A/PAK/1/2006), KY322679 (A/TAI/4/2014), FJ755052 (A/IRN/51/2005), KY404935 (A/A01NL), EF149010 (Asia 1/HNK/CHA/05), EF614458 (Asia1/MOG/05), AY687334 (Asia1/IND 491/97), GU931682 (Asia1/YS/CHA/05), AY687333 (Asia1/IND 321/01), HQ009509 (O/China/5/99), LC149720 (O/JPN/2010–362/3), JN998086 (O/GZ/CHA/2010), AF095876(O/Taipei-150). RT-RPA primers and probes specific for serotypes O, A or Asia-1 of FMDV were designed against the consensus sequence for this region and were synthesized by Sangon Biotech, respectively. RPA primers/probes were synthesized and labeled as described in previous study [18]. Oligonucleotide sequences of RPA primers and probes of specific serotype A, Asia-1, or O of FMDV are listed in Table 1 (accession numbers KT968663, EF149010 and HQ009509, respectively).

FMDV serotype-specific RPA assays

Serotype-specific primers and probes were screened as described in previous study [25] with some modifications. In brief, RPA was performed using a TwistAmp™ nfo kit (TwistDx Limited, UK). The freeze-dried enzyme pellet was dissolved with 47.5 μLof solution containing 29.5 μL rehydration buffers, 2.1 μL forward and reverse primers (10 μM), 0.6 μL probe (10 μM), 11.2 μL of sterile water, 2 μL of cDNA of FMDV reference strains, and then 2.5 μL magnesium acetate (280 mM) was added. Assays were completed in a thermos metal bath at 38 °C for 20 min. The amplified products were then put through a 2% (w/v) agarose gel electrophoresis to screen the optimal and serotype-specific primer and probe sets. The optimal reaction conditions were determined by testing various reaction temperatures and incubation times. LFD double label with anti-FAM gold conjugates and anti-Biotin antibodies (Milenia Biotec GmbH, Germany) were used to visualize the RPA amplified products. 1 μL of RPA products were diluted with 99 μL Dipstick Assay Buffer (Milenia Biotec GmbH, Germany), and then tested by LFD. FMDV serotype-specific positives are indicated by the visualization of both a test line and control line simultaneously perceptible on the LFDs after 5 min, while the negative reactions only generate a control line. The cDNA of other FMDV epidemic virus strains in China were used for evaluation of serotype-specific RPA-LFD.

Sensitivity and specificity of the RPA-LFD assay

To determine the DNA analytical sensitivity of the RPA-LFD assay, the recombinant plasmids pET32a-A-FMDV-VP1, pET32a-As1-FMDV-VP1, and pET32a-O-FMDV-VP1 were respectively the standard DNA template of FMDV serotype A, Asia 1 and O. The RPA-LFD assays were performed with ten-fold serial dilutions of the recombinant vector ranging from 3 × 106 to 3 × 100 copies per microliter for respective serotypes. To detect the RNA analytical sensitivity, RNA standards of three FMDV serotypes were diluted from 5 × 107 to 5 × 101 molecules/μL. 10 μL RNA was used as template to synthesize cDNA in 20 μL reverse transcription reaction system using PrimeScript™ RT Master Mix (Takara, Dalian, China) in accordance with the manufacturer’s instructions. 2 μL cDNA of each dilution was used as a template in the RPA reactions. DNA plasmid/RNA samples were detected with three separate assays, respectively. The specificity of the method was assessed using other viral pathogens with similar clinical symptoms, including BEFV, VSV, BVDV, BEV, IBRV, and SVDV. The IBRV DNA was extracted and viral cDNA were reverse transcribed from isolated other viral RNA. Positive controls and negative controls for RPA were constructed using recombinant vectors and RNase free water.

Diagnosis of clinical specimens with FMDV serotype-specific RPA-LFD assays

To compare the diagnostic sensitivity between RPA-LFD and rPCR, 126 clinical specimens were collected from bovine farms suspected with infection of FMDV in China from 2013 to 2017 (details listed in Table 2). RNAs were isolated from the clinical samples using a Punch-it™ Kit (Nanohelix, Daejeon, South Korea) following manufacturers’ instructions. A 1 mm punched disk, containing the nucleic acids, was added with 10 μL of reverse transcript reaction system using PrimeScript™ RT Master Mix (Takara, Dalian, China), which contained 2 μL 5 × PrimeScript RT Master Mix and 8 μL RNase Free dH2O. Reverse transcription for each sample was completed in two tubes using a thermos metal bath at 37 °C for 15 min. 2 μL of cDNA was then used in both RPA-LFD and rPCR reactions. For the rPCR, serotype-specific primers and probes for serotypes O, A or Asia-1 FMDV were employed as previously described [23]. Reactions were performed with Premix Ex Taq™ Kit (Takara, Dalian, China) for respective serotypes. Samples were positive in RPA-LFD, but negative in rPCR, were further tested for presence of FMDV. The virus was isolated using BHK-21 cells (provided by China Center for Type Culture Collection) as described in the previous study [18]. The cytopathic effect (CPE) was examined at 24 h, 48 h, and 72 h, respectively. If there was no CPE after 72 h, Cell cultures were passaged. CPE-positive, CPE-negative and control cell cultures were respectively harvested and examined again for FMDV using RPA-LFD and rPCR.
  33 in total

1.  Evaluation of the Punch-it™ NA-Sample kit for detecting microbial DNA in blood culture bottles using PCR-reverse blot hybridization assay.

Authors:  Jungho Kim; Hye-Young Wang; Seoyong Kim; Soon Deok Park; Kwangmin Yu; Hyo Youl Kim; Young Uh; Hyeyoung Lee
Journal:  J Microbiol Methods       Date:  2016-06-02       Impact factor: 2.363

Review 2.  Global Foot-and-Mouth Disease Research Update and Gap Analysis: 4 - Diagnostics.

Authors:  T J D Knight-Jones; L Robinson; B Charleston; L L Rodriguez; C G Gay; K J Sumption; W Vosloo
Journal:  Transbound Emerg Dis       Date:  2016-06       Impact factor: 5.005

3.  Development and laboratory validation of a lateral flow device for the detection of foot-and-mouth disease virus in clinical samples.

Authors:  Nigel P Ferris; Ann Nordengrahn; Geoffrey H Hutchings; Scott M Reid; Donald P King; Katja Ebert; David J Paton; Therese Kristersson; Emiliana Brocchi; Santina Grazioli; Malik Merza
Journal:  J Virol Methods       Date:  2008-11-05       Impact factor: 2.014

4.  Pseudomonas reactans, a bacterial strain isolated from the intestinal flora of Blattella germanica with anti-Beauveria bassiana activity.

Authors:  Fan Zhang; Yan Hong Huang; Shu Zhen Liu; Lei Zhang; Bo Tai Li; Xiao Xu Zhao; Ying Fu; Jian Jun Liu; Xue Xia Zhang
Journal:  Environ Entomol       Date:  2013-06       Impact factor: 2.377

5.  Isolation, identification and complete genome sequence analysis of a strain of foot-and-mouth disease virus serotype Asia1 from pigs in southwest of China.

Authors:  Xin Yang; Ying-Shun Zhou; Hong-Ning Wang; Yi Zhang; Kun Wei; Ting Wang
Journal:  Virol J       Date:  2011-04-16       Impact factor: 4.099

6.  Biopanning of polypeptides binding to bovine ephemeral fever virus G1 protein from phage display peptide library.

Authors:  Peili Hou; Guimin Zhao; Chengqiang He; Hongmei Wang; Hongbin He
Journal:  BMC Vet Res       Date:  2018-01-04       Impact factor: 2.741

7.  Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

Authors:  Jianchang Wang; Jinfeng Wang; Ruiwen Li; Libing Liu; Wanzhe Yuan
Journal:  BMC Vet Res       Date:  2017-08-15       Impact factor: 2.741

8.  Predicting the Ability of Preclinical Diagnosis To Improve Control of Farm-to-Farm Foot-and-Mouth Disease Transmission in Cattle.

Authors:  Noel Nelson; David J Paton; Simon Gubbins; Claire Colenutt; Emma Brown; Sophia Hodgson; Jose L Gonzales
Journal:  J Clin Microbiol       Date:  2017-03-22       Impact factor: 5.948

9.  The occurrence of porcine circovirus 3 without clinical infection signs in Shandong Province.

Authors:  S Zheng; X Wu; L Zhang; C Xin; Y Liu; J Shi; Z Peng; S Xu; F Fu; J Yu; W Sun; S Xu; J Li; J Wang
Journal:  Transbound Emerg Dis       Date:  2017-06-26       Impact factor: 5.005

10.  Development of real-time recombinase polymerase amplification assay for rapid and sensitive detection of canine parvovirus 2.

Authors:  Yunyun Geng; Jianchang Wang; Libing Liu; Yan Lu; Ke Tan; Yan-Zhong Chang
Journal:  BMC Vet Res       Date:  2017-11-06       Impact factor: 2.741

View more
  3 in total

Review 1.  Alteration of cell junctions during viral infection.

Authors:  Dan Dong; Wei Xie; Min Liu
Journal:  Thorac Cancer       Date:  2020-02-04       Impact factor: 3.500

2.  Nucleic acid visualization assay for Middle East Respiratory Syndrome Coronavirus (MERS-CoV) by targeting the UpE and N gene.

Authors:  Pei Huang; Hongli Jin; Yongkun Zhao; Entao Li; Feihu Yan; Hang Chi; Qi Wang; Qiuxue Han; Ruo Mo; Yumeng Song; Jinhao Bi; Cuicui Jiao; Wujian Li; Hongbin He; Hongmei Wang; Aimin Ma; Na Feng; Jianzhong Wang; Tiecheng Wang; Songtao Yang; Yuwei Gao; Xianzhu Xia; Hualei Wang
Journal:  PLoS Negl Trop Dis       Date:  2021-03-01

3.  Detection of bovine viral diarrhea virus genotype 1 in aerosol by a real time RT-PCR assay.

Authors:  Peili Hou; Yaru Xu; Hongmei Wang; Hongbin He
Journal:  BMC Vet Res       Date:  2020-04-15       Impact factor: 2.741

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.