Literature DB >> 30403914

The ATG5-binding and coiled coil domains of ATG16L1 maintain autophagy and tissue homeostasis in mice independently of the WD domain required for LC3-associated phagocytosis.

Shashank Rai1, Maryam Arasteh1, Matthew Jefferson1, Timothy Pearson1, Yingxue Wang1, Weijiao Zhang1, Bertalan Bicsak1, Devina Divekar1, Penny P Powell1, Ronald Naumann2, Naiara Beraza3, Simon R Carding3, Oliver Florey4, Ulrike Mayer5, Thomas Wileman1,3.   

Abstract

Macroautophagy/autophagy delivers damaged proteins and organelles to lysosomes for degradation, and plays important roles in maintaining tissue homeostasis by reducing tissue damage. The translocation of LC3 to the limiting membrane of the phagophore, the precursor to the autophagosome, during autophagy provides a binding site for autophagy cargoes, and facilitates fusion with lysosomes. An autophagy-related pathway called LC3-associated phagocytosis (LAP) targets LC3 to phagosome and endosome membranes during uptake of bacterial and fungal pathogens, and targets LC3 to swollen endosomes containing particulate material or apoptotic cells. We have investigated the roles played by autophagy and LAP in vivo by exploiting the observation that the WD domain of ATG16L1 is required for LAP, but not autophagy. Mice lacking the linker and WD domains, activate autophagy, but are deficient in LAP. The LAP-/- mice survive postnatal starvation, grow at the same rate as littermate controls, and are fertile. The liver, kidney, brain and muscle of these mice maintain levels of autophagy cargoes such as LC3 and SQSTM1/p62 similar to littermate controls, and prevent accumulation of SQSTM1 inclusions and tissue damage associated with loss of autophagy. The results suggest that autophagy maintains tissue homeostasis in mice independently of LC3-associated phagocytosis. Further deletion of glutamate E230 in the coiled-coil domain required for WIPI2 binding produced mice with defective autophagy that survived neonatal starvation. Analysis of brain lysates suggested that interactions between WIPI2 and ATG16L1 were less critical for autophagy in the brain, which may allow a low level of autophagy to overcome neonatal lethality. Abbreviations: CCD: coiled-coil domain; CYBB/NOX2: cytochrome b-245: beta polypeptide; GPT/ALT: glutamic pyruvic transaminase: soluble; LAP: LC3-associated phagocytosis; LC3: microtubule-associated protein 1 light chain 3; MEF: mouse embryonic fibroblast; NOD: nucleotide-binding oligomerization domain; NADPH: nicotinamide adenine dinucleotide phosphate; RUBCN/Rubicon: RUN domain and cysteine-rich domain containing Beclin 1-interacting protein; SLE: systemic lupus erythematosus; SQSTM1/p62: sequestosome 1; TLR: toll-like receptor; TMEM: transmembrane protein; TRIM: tripartite motif-containing protein; UVRAG: UV radiation resistance associated gene; WD: tryptophan-aspartic acid; WIPI: WD 40 repeat domain: phosphoinositide interacting.

Entities:  

Keywords:  ATG16L1; LC3-associated phagocytosis; WD domain; WIPI2; brain; sequestosome 1/p62 inclusions; tissue homeostasis

Mesh:

Substances:

Year:  2018        PMID: 30403914      PMCID: PMC6526875          DOI: 10.1080/15548627.2018.1534507

Source DB:  PubMed          Journal:  Autophagy        ISSN: 1554-8627            Impact factor:   16.016


Introduction

Autophagy generates autophagosomes that deliver cytoplasmic material to lysosomes for degradation. Macroautophagy, hereafter referred to as autophagy, is activated during starvation and provides a short-term supply of amino acids to sustain protein synthesis and energy production. At the same time, basal autophagy helps to prevent tissue damage during development and ageing by reducing the accumulation of damaged proteins and organelles [1,2]. Autophagosome formation involves the recruitment of LC3 from the cytosol to the limiting membrane of the phagophore where it provides a binding site for autophagy cargoes, and facilitates fusion with lysosomes. Recent studies [3] show that LC3 is also recruited to membranes by an autophagy-related pathway called LC3-associated phagocytosis (LAP). LAP is activated by TLR signalling and NADPH oxidase during phagocytosis of fungal and bacterial pathogens, and results in attachment of LC3 to the cytosolic side of the phagosome membrane where it facilitates phagosome maturation [4]. A similar LAP-like noncanonical autophagy pathway also operates in nonphagocytic cells resulting in recruitment of LC3 to single-membraned endolysosomal compartments during entosis, micropinocytosis [5] and following lysosomotropic drug treatment [6,7], and may occur during the uptake of particulate material or apoptotic cells [8-11]. Autophagy and LAP provide 2 different pathways for removing unwanted material from cells, but the relative roles played by each pathway in reducing tissue damage and maintaining homeostasis in vivo are not clear. Autophagy-null mice die shortly after birth because they are unable to adapt to the starvation that follows loss of placental nutrition [12]. Mice with tissue-specific loss of autophagy survive, but the tissues lacking autophagy invariably accumulate ubiquitin-positive inclusions containing protein aggregates and show signs of inflammation and tissue damage. These studies have inactivated autophagy genes such as Atg3, Atg5, Atg7, Atg12 and Atg16L1 [12-16] that are essential for both autophagy and LAP, making it impossible to determine if tissue damage results from loss of autophagy, or LAP, or both. Studies on LAP in vivo have focused on inactivation of RUBCN/Rubicon in myeloid cells [3,4]. rubcn−/- myeloid cells are LAP-deficient and show defects in clearance of bacterial and fungal pathogens and dying and apoptotic cells. These mice also have elevated levels of inflammatory cytokines, and eventually develop an autoimmune disease that resembles systemic lupus erythematosus (SLE) [4,17]. While suggestive of a role for LAP in preventing inflammation and autoimmunity, the targeted loss of RUBCN from myeloid cells does not inform on the role played by LAP in non-myeloid cell types in vivo. The recruitment of LC3 to membranes during both autophagy and LAP requires the E3 ligase-like activity of the ATG12–ATG5-ATG16L1 complex, which covalently binds LC3 to membranes. ATG16L1 contains an N-terminal domain that binds the ATG12–ATG5 conjugate (Figure 1), followed by a coiled-coil domain (CCD) that binds WIPI2 [18]. WIPI2 brings the ATG12–ATG5-ATG16L1 complex to phagophore membranes allowing conjugation of LC3 to phosphatidylethanolamine [19]. In higher eukaryotes, a linker region attaches the CCD to a large C-terminal WD (tryptophan-aspartic acid) domain containing 7 WD repeats folded into a circular β-propeller [20,21]. Recent studies show that the WD domain of ATG16L1 is required for LAP [22]. This allowed us to generate LAP-deficient mice by inserting 2 stop codons in frame at the end of the CCD of the Atg16L1 gene (Figure 1). This mutation, called atg16l1, allowed translation of the glutamate E226 and E230 residues in the CCD required for WIPI2 binding and autophagy [18], but prevented translation of the linker region and WD domain required for LAP. In a second mouse, called atg16l1, an unexpected recombination removed the E230 glutamate residue required for WIPI2 binding. This mouse survived post-natal starvation but was defective in autophagy and LAP in all tissues. We have used these 2 mouse strains to determine the roles played by autophagy and LAP in reducing tissue damage and maintaining tissue homeostasis in vivo.
Figure 1.

Generation of mice lacking the WD and linker domains of ATG16L1. (A) Domain structure of ATG16L1. The N-terminal ATG5 binding domain (ATG5 b) binds the ATG12–ATG5 conjugate. The coiled-coil domain (CCD) binds WIPI2 through glutamates E226 and E230. A linker domain separates the CCD from the 7 WD repeats of the WD domain. (B) Sites of stop codons. atg16l1; 2 stop codons were inserted into exon 6 immediately after glutamate E230 to preserve binding sites for WIPI2, but prevent translation of the linker and WD domain. atg16l1; an unexpected recombination inserted a glycine residue at position 228. (C) Tissue lysates were separated by SDS-PAGE and transferred to nitrocellulose membranes. Separate membranes sections were analyzed by western blot using antibody specific for ATG16L1.

Generation of mice lacking the WD and linker domains of ATG16L1. (A) Domain structure of ATG16L1. The N-terminal ATG5 binding domain (ATG5 b) binds the ATG12–ATG5 conjugate. The coiled-coil domain (CCD) binds WIPI2 through glutamates E226 and E230. A linker domain separates the CCD from the 7 WD repeats of the WD domain. (B) Sites of stop codons. atg16l1; 2 stop codons were inserted into exon 6 immediately after glutamate E230 to preserve binding sites for WIPI2, but prevent translation of the linker and WD domain. atg16l1; an unexpected recombination inserted a glycine residue at position 228. (C) Tissue lysates were separated by SDS-PAGE and transferred to nitrocellulose membranes. Separate membranes sections were analyzed by western blot using antibody specific for ATG16L1.

Results

Mice lacking the WD and linker domain of ATG16L1 were generated by homologous recombination in embryonic stem cells. The targeting vector was designed to insert 2 stop codons after glutamate residue E230 in the CCD, followed by the bovine growth hormone polyadenylation site and a frt-flanked neomycin cassette. Homologous recombination was verified by Southern blotting. RNA analysis of the F1 generation established from independent chimeras showed that most mice carried the correct sequence and expressed the E230 residue required for autophagy. Surprisingly, some mice had a 14 base pair (bp) deletion at the end of the CCD, which deleted glutamate E230 and its preceding amino acid, followed by a stop codon (Figure 1 A and B). These mouse strains were termed atg16l1 and atg16l1. Expression of the truncated ATG16L1E230 CCD was verified by comparing western blots of tissue lysates from the atg16l1 mice with littermate controls (Figure 1C). The ATG5 binding and CCD of ATG16L1 migrated at ~ 27 kDa compared to the ~ 70 kDa for full-length ATG16L1. As described by Mizushima et al [21], lysates from liver showed the α and β isoforms of ATG16L1 while the slower migrating β isoform predominated in muscle and brain. Full-length ATG16L1 was present in lysates obtained from littermate controls, but absent from tissues of atg16l1 mice. It was not possible to detect the truncated CCD of the atg16l1 mice, in whole tissue lysates. This may be because the epitope is lost, or the protein is highly unstable. The size of the ATG16L1 complex generated in the mice was determined by gel filtration of cytoplasmic fractions isolated from homogenized liver (Figure 2). In control mice the α and β isoforms of ATG16L1 eluted in high molecular-mass fractions suggesting formation of a 300–600 kDa complex. Previous work has shown that elution of ATG16L1 in high molecular-weight fractions is dependent on ATG5 [21]. The presence of the ATG12–ATG5 conjugate in the same high molecular weight fractions as ATG16L1 suggested binding of ATG5 to the N-terminal ATG5-binding domain present in the CCD of ATG16L1. Full-length ATG16L1 contains the E226 and E230 glutamate residues required for WIPI2 binding, and indirect evidence for binding to WIPI2 was provided by the elution of the 49-kDa WIPI2 protein in high molecular-mass factions ranging between 150 and 600 kDa. Analysis of the atg16l1 and atg16l1 mice was complex because the preparation of liver lysates appeared to result in limited proteolysis of CCDs, and the possible formation of dimers and trimers resistant to dissociation during SDS polyacrylamide electrophoresis (Fig. S1). The blots in Figure 2 show the elution profile of the 27-kDa CCD and the 25-kDa proteolytic products, which co-elute with multimers at 50 and 75 kDa (Fig. S1). The bulk of the CCD in the liver of atg16l1 mice eluted over a broad range from 50–400 kDa in fractions which also contained the ATG12–ATG5 conjugate and ATG5. As seen for control mice, WIPI2 was detected in high molecular-mass fractions eluting between 400–600 kDa; however, levels of WIPI2 were less than seen for control, and a low molecular-mass fraction was also detected between 50 and 100 kDa. The CCD of atg16l1 mice retained binding sites for ATG5 and WIPI2, and the elution profiles were consistent with assembly of complexes containing the CCD, ATG12–ATG5 and WIPI2. Unlike whole tissue lysates, it was possible to detect the CCD of the atg16l1 mouse in fractions eluting from the gel filtration column. The CCD eluted over a broad 30–400 kDa range in fractions that also contained ATG12–ATG5. The CCD of atg16l1 mice lacks the E230 glutamate residue required for WIPI2. The blots show that unlike control mice and atg16l1 mice, it was not possible to detect WIPI2 in high molecular-mass fractions, and WIPI2 eluted between 50 and 100 kDa. The results from this indirect assay based on the size of ATG16L1 complexes suggest that the CCD of atg16l1 assembles with ATG12–ATG5 through the ATG5 binding domain, but does not bind strongly to WIPI2.
Figure 2.

Analysis of ATG16L1 complexes in liver by gel filtration. The cytosolic fraction of liver homogenates was separated by size-exclusion chromatography on an ENrichTMSEC 650 column. Fraction (0.5 ml) were analyzed by immunoblot for ATG16L1, ATG5 and WIPI2 as indicated. Void volume 10 ml. Migration and elution of molecular mass standards are shown (kDa).

Analysis of ATG16L1 complexes in liver by gel filtration. The cytosolic fraction of liver homogenates was separated by size-exclusion chromatography on an ENrichTMSEC 650 column. Fraction (0.5 ml) were analyzed by immunoblot for ATG16L1, ATG5 and WIPI2 as indicated. Void volume 10 ml. Migration and elution of molecular mass standards are shown (kDa). The ability of cells isolated from the mice to activate autophagy was tested by western blot of autophagy substrates SQSTM1/p62 (sequestosome 1) and LC3, and by following formation of LC3 puncta after starvation in Hanks balanced salt solution (HBSS) (Figure 3A-C). Mouse embryonic fibroblasts (MEFs) from mice lacking ATG16L1 (atg16l1) were used as an autophagy-negative control. MEFs from control mice expressed the α and β isoforms of ATG16L1 which were absent from atg16l1MEFs, whereas atg16l1 MEFs showed the smaller band expected at 27 kDa (data not shown). atg16l1 MEFs showed defects in autophagy indicated by the expression of high levels of the autophagy substrate SQSTM1, and an inability to generate lipidated LC3-II (Figure 3A) after starvation. MEFs expressing ATG16L1E226 also expressed high levels of SQSTM1 and were unable to generate lipidated LC3-II showing that loss of E230 resulted in defects in autophagy. This supported the observation that MEFs (Figure 3B) and skin fibroblasts (Figure 3C) from atg16l1 mice were unable to generate LC3 puncta following starvation. In contrast, cells expressing full-length ATG16L1, or expressing the CCD but lacking the WD domain (ATG16L1E230) were able to activate autophagy, indicated by low basal levels of SQSTM1 and generation of LC3 puncta in response to HBSS (Figure 3B,C). Taken together, these results showed that autophagy requires the E226 and E230 glutamate residues in the CCD needed for WIPI2 binding, but, as reported previously [19], autophagy did not require the WD domain. The role played by the WD domain during LAP was analyzed by incubating bone marrow-derived macrophages (BMDMs) from the mouse strains with Pam3CSK4 (a mimic of bacterial lipopeptides)-coupled polystyrene beads to follow LC3 translocation to phagosomes (Figure 3D). LC3 was recruited to phagosomes in macrophages from control mice, but not in macrophages from autophagy-defective atg16l1 mice that lack the WD domain and linker region of ATG16L1. As reported previously [22,23] these observations indicate that the WD domain is required for LAP in myeloid cells, and confirmed that the atg16l1 mouse would provide a LAP-deficient mouse model to study the role played by LAP in maintaining tissue homeostasis in vivo.
Figure 3.

Role played by WD and linker domains of ATG16L1 during autophagy and LC3-associated phagocytosis. (A) MEFs from mice lacking ATG16L (FL KO), atg16l1 (E226) and atg16l1 (E230) and appropriate littermate controls were incubated in complete media or HBSS for 2 h to induce autophagy. Cell lysates were analyzed by western blot using antibodies specific for the indicated proteins. (B) MEFs or skin fibroblasts (C) from atg16l1 (E226) and atg16l1 (E230) mice and littermate controls were incubated in complete media or HBSS for 2 h to induce autophagy. Cells were immunostained for endogenous LC3. (D) BMDMs from atg16l1 (E226) and atg16l1 (E230) and appropriate littermate controls were incubated with Pam3CSK4-coupled polystyrene beads for 1.5 h in complete medium to induce LAP, and immunostained for endogenous LC3 (green). Boxed regions highlighting internalized beads are enlarged and shown in the lower panel. Magnification 63X, scale bars: 10 µm.

Role played by WD and linker domains of ATG16L1 during autophagy and LC3-associated phagocytosis. (A) MEFs from mice lacking ATG16L (FL KO), atg16l1 (E226) and atg16l1 (E230) and appropriate littermate controls were incubated in complete media or HBSS for 2 h to induce autophagy. Cell lysates were analyzed by western blot using antibodies specific for the indicated proteins. (B) MEFs or skin fibroblasts (C) from atg16l1 (E226) and atg16l1 (E230) mice and littermate controls were incubated in complete media or HBSS for 2 h to induce autophagy. Cells were immunostained for endogenous LC3. (D) BMDMs from atg16l1 (E226) and atg16l1 (E230) and appropriate littermate controls were incubated with Pam3CSK4-coupled polystyrene beads for 1.5 h in complete medium to induce LAP, and immunostained for endogenous LC3 (green). Boxed regions highlighting internalized beads are enlarged and shown in the lower panel. Magnification 63X, scale bars: 10 µm.

Mouse growth and survival

The LAP-deficient atg16l1 mice survived the postnatal lethality seen in atg16l1 mice [15], and were similar in size and weight to littermate controls and grew at comparable rates (Figure 4A, B). atg16l1 mice were born with Mendelian frequency with reproductive organs of normal size, and were fertile with a reproductive capacity comparable to controls (data not shown). The survival rate and litter sizes of atg16l1 mice were similar to wild-type mice with life spans of at least 24 months (data not shown). The majority of atg16l1 mice also survived postnatal lethality, but most grew slowly (Figure 4A, B) and died within 5–7 months of age.
Figure 4.

Phenotype of atg16l1 and atg16l1 mice. (A) Representative pictures of mice at ~2 months of age (scale bar: 1 cm). (B) Body weight of mice and littermate controls fed on chow diet. Mice were weighed at the indicted times and each point is generated from at least 6 individuals (n = 11 and 6 for E230 (atg16l1) and control, respectively; n = 11 and 8 for E226 (atg16l1) and control, respectively. Statistical analysis was done by unpaired t test. Error bars represents ±SEM. ****-P < 0.0001.

Phenotype of atg16l1 and atg16l1 mice. (A) Representative pictures of mice at ~2 months of age (scale bar: 1 cm). (B) Body weight of mice and littermate controls fed on chow diet. Mice were weighed at the indicted times and each point is generated from at least 6 individuals (n = 11 and 6 for E230 (atg16l1) and control, respectively; n = 11 and 8 for E226 (atg16l1) and control, respectively. Statistical analysis was done by unpaired t test. Error bars represents ±SEM. ****-P < 0.0001.

Inflammatory cytokines

LAP-deficient mice generated by Lyz2/LysM-cre-driven loss of Rubcn from macrophages, monocytes and neutrophils (3) develop a SLE-like syndrome characterized by an age-dependent increase in serum cytokines and eventual generation of antibodies against nuclear antigens. Serum levels of IL1B, IL12 (p70), IL13, TNF, IL6 and CCL2/MCP1 reported to be elevated in rubcn mice were measured in control, atg16l1 and atg16l1 mice. Serum levels of IL1B, IL12 (p70), IL13, and TNF/TNF-α in atg16l1 and atg16l1 mice were the same as littermate controls at 8–12 and 20–24 wk. Elevated levels of IL6 and CCL2/MCP1 were detected in the autophagy-defective atg16l1 mice, but these were not seen in control or atg16l1 mice (Fig. S2). It was not possible to detect antinuclear antibodies able to stain the nuclei of cells in culture. The LAP−/- atg16l1 mice do not therefore appear to develop the pro-inflammatory phenotype seen for rubcn mice lacking LAP in phagocytic cells.

Liver

A preliminary survey of the internal organs of the mouse strains showed that defects were most obvious in the liver of the autophagy-defective atg16l1 mice. The livers (Figure 5A) showed pronounced hepatomegaly with average liver weights of 2.6 g, compared to 1.6 g of control mice, and when liver weight was expressed as percentage of body weight (Figure 5B) to compensate for the smaller size of the atg16l1 mouse, livers were more than twice the size (11%) of littermate controls (5%). These results are in line with studies of mice with targeted loss of Atg7 in liver [13], or the hepatomegaly observed in atg5 mice where Atg5 is restored in neuronal tissue [24]. Liver damage was evident from elevated levels of serum GPT/ALT (glutamic pyruvic transaminase, soluble), a liver function marker enzyme (Figure 5C). In contrast, there was little evidence for hepatomegaly in atg16l1 LAP-deficient mice with mean weights of 1.8 g being the comparable to littermate controls, and these mice did not show the raised serum GPT/ALT levels seen in autophagy-defective mice. Autophagy function in liver tissue was assessed by western blot of SQSTM1 and LC3, which are substrates for autophagy and are degraded in lysosomes. The signals for full-length ATG16L1 were present in blots of 3 representative livers taken from control mice. Two bands were seen, consistent with the expression of α and β isoforms of ATG16L1 in liver [21], but absent from blots of atg16l1 and atg16l1 (Figure 5D). Liver lysates from the atg16l1 mouse showed raised levels of LC3-I and SQSTM1 compared to control mice, suggesting impaired clearance of autophagy substrates ‘in vivo’ (Figure 5D). Immunohistological analysis showed SQSTM1 inclusions in hepatocytes, indicative of accumulation of damaged proteins and organelles in atg16l1 mice (Figure 5E). In contrast livers from the LAP-deficient atg16l1 mice were similar in size to littermate controls (Figure 5A), and lysates did not reveal raised levels of LC3-I and SQSTM1 (Figure 5D). Moreover, SQSTM1 inclusions were absent from hepatocytes (Figure 5E), suggesting that autophagy is active in the liver. Further analysis confirmed that hepatomegaly in atg16l1 mice correlated with hepatocellular hypertrophy as evidenced by the enlarged circumference of hepatocytes (Figure 6A) and increased hepatocyte proliferation indicated by a 4-fold increase in MKI67/Ki67 immunostaining (Figure 6B). Liver inflammation was also evident from increased infiltration of ITGAM/CD11b-positive leukocytes (Figure 6C). In contrast, livers from the atg16l1 mice showed little sign of damage. A comparison of the mice suggested that LAP was not required to suppress tissue damage because the liver parenchyma damage, hepatocellular hypertrophy (Figure 6A) and raised serum GPT/ALT levels (Figure 5C) seen in the atg16l1 mice, were absent from atg16l1 mice. Furthermore, hepatocyte proliferation (Figure 6B) was comparable to that found in littermate controls. There was evidence of low level inflammatory cell infiltration in the livers from atg16l1 mice (Figure 6C), possibly indicating a role for LAP in reducing inflammation, but levels of ITGAM/Cd11b-positive cells were much lower than seen in livers of autophagy-defective atg16l1 mice.
Figure 5.

Analysis of autophagy substrates in liver. Panel (A) Representative livers at ~2 months (scale bar: 1 cm). (B) Liver weight expressed as a percentage of body weight at 2–3 months of age. E230 (atg16l1) n = 9, control n = 8; E226 (atg16l1) n = 9, control n = 7. (C) GPT/ALT in serum from mice aged between 2–3 months. E230 (atg16l1) n = 7, control n = 5; E226 (atg16l1) n = 5, v control n = 5. (D) Western blot of liver lysates from 3 representative mice. Membranes strips taken from the appropriate molecular weight range were analyzed separately using the indicted antibodies. (E) Representative histochemical sections of livers immunostained for SQSTM1. Enlarged regions of interest are shown in the lower panel. Arrows: SQSTM1 inclusions. In all figures data from littermate controls for E230 and E226 were pooled. Statistical analysis was done by unpaired t test. Error bars represents ±SEM. ****-P < 0.0001, ***-P < 0.001; ns, non-significant. Image magnification 40X, scale bars: 50 µm.

Figure 6.

Analysis of liver homeostasis. (A) Representative images of H&E-stained sections of livers. Boxed regions of interest are enlarged in lower panels. The bar graph represents comparative circumferences of hepatocytes (n = 10) across the indicated strains (n = 3 for all the strains). (B and C) Representative histochemical sections of liver immunostained with antibodies against MKI67/Ki67 (B) or ITGAM/Cd11b (C). Regions of interest are enlarged and shown in lower panels. Arrows indicate positive staining. Bar graphs show number of positive cells (C) or percent positive cells (B). Five different zones for each liver section were analyzed (n = 3 for all the strains). Data across littermate control mice for E230 and E226 were pooled. Statistical analysis was done by unpaired t test. Error bars represents ±SEM. ****-P < 0.0001, *-P < 0.1. Magnification 20X, scale bars: 50 µm.

Analysis of autophagy substrates in liver. Panel (A) Representative livers at ~2 months (scale bar: 1 cm). (B) Liver weight expressed as a percentage of body weight at 2–3 months of age. E230 (atg16l1) n = 9, control n = 8; E226 (atg16l1) n = 9, control n = 7. (C) GPT/ALT in serum from mice aged between 2–3 months. E230 (atg16l1) n = 7, control n = 5; E226 (atg16l1) n = 5, v control n = 5. (D) Western blot of liver lysates from 3 representative mice. Membranes strips taken from the appropriate molecular weight range were analyzed separately using the indicted antibodies. (E) Representative histochemical sections of livers immunostained for SQSTM1. Enlarged regions of interest are shown in the lower panel. Arrows: SQSTM1 inclusions. In all figures data from littermate controls for E230 and E226 were pooled. Statistical analysis was done by unpaired t test. Error bars represents ±SEM. ****-P < 0.0001, ***-P < 0.001; ns, non-significant. Image magnification 40X, scale bars: 50 µm. Analysis of liver homeostasis. (A) Representative images of H&E-stained sections of livers. Boxed regions of interest are enlarged in lower panels. The bar graph represents comparative circumferences of hepatocytes (n = 10) across the indicated strains (n = 3 for all the strains). (B and C) Representative histochemical sections of liver immunostained with antibodies against MKI67/Ki67 (B) or ITGAM/Cd11b (C). Regions of interest are enlarged and shown in lower panels. Arrows indicate positive staining. Bar graphs show number of positive cells (C) or percent positive cells (B). Five different zones for each liver section were analyzed (n = 3 for all the strains). Data across littermate control mice for E230 and E226 were pooled. Statistical analysis was done by unpaired t test. Error bars represents ±SEM. ****-P < 0.0001, *-P < 0.1. Magnification 20X, scale bars: 50 µm.

Muscle and kidney

The atg16l1 mice showed evidence of muscle wasting because the gastrocnemius muscle was significantly smaller in atg16l1 mice when muscle weight was expressed as a percentage of body weight (Figure 7A). Lysates from muscle had high levels of SQSTM1 and LC3 (Figure 7B), and when normalized for GAPDH expression, muscle lysates from the atg16l1 mice showed 2–3 fold increases in LC3-I, and nearly 6-fold increases in SQSTM1 compared to control mice (Figure 7C), suggesting impaired clearance of autophagy substrates ‘in vivo’. This was consistent with histological sections of muscle showing multiple SQSTM1 inclusions (Figure 7D). Morphological analysis of muscle did not, however, reveal the degenerative changes observed in mice lacking ATG7 in muscle tissue [25], such as vacuolated and centrally nucleated myofibers.
Figure 7.

Analysis of muscle. (A) Gastrocnemius muscle weight expressed as a percentage of body weights at 2–3 months of age. E230 (atg16l1) n = 6, control n = 5; E226 (atg16l1) n = 8, control n = 6. (B) Western blot of muscle lysates from 3 representative mice. Membrane strips taken from the appropriate molecular weight range were analyzed separately by western blot using the indicted antibodies. (C) Bar graphs show levels of LC3 and SQSTM1 relative to GAPDH. (D) Histochemical sections of muscle were immunostained with antibodies against SQSTM1. Enlarged regions of interest are shown in the lower panels. Arrows: SQSTM1 inclusions. Statistical analysis was done by unpaired t test. Error bars represent ±SEM. ***-P < 0.001, **-P < 0.01; ns, non-significant. Magnification 20X, scale bar: 50 µm.

Analysis of muscle. (A) Gastrocnemius muscle weight expressed as a percentage of body weights at 2–3 months of age. E230 (atg16l1) n = 6, control n = 5; E226 (atg16l1) n = 8, control n = 6. (B) Western blot of muscle lysates from 3 representative mice. Membrane strips taken from the appropriate molecular weight range were analyzed separately by western blot using the indicted antibodies. (C) Bar graphs show levels of LC3 and SQSTM1 relative to GAPDH. (D) Histochemical sections of muscle were immunostained with antibodies against SQSTM1. Enlarged regions of interest are shown in the lower panels. Arrows: SQSTM1 inclusions. Statistical analysis was done by unpaired t test. Error bars represent ±SEM. ***-P < 0.001, **-P < 0.01; ns, non-significant. Magnification 20X, scale bar: 50 µm. The kidneys of atg16l1 mice weighed less than controls, but this difference was not statistically significant when expressed as a percentage of body weight (Figure 8A). Kidney lysates of atg16l1 mice contained raised levels of LC3-I and SQSTM1 (Figure 8B and C) and histological sections of kidney showed multiple SQSTM1 inclusions (Figure 8D). We were not, however, able to find evidence of obvious kidney damage and glomerular architecture remained intact. In contrast to the autophagy-negative atg16l1 mice, the muscle and kidney of LAP−deficient atg16l1 mice were of comparable size to littermate controls (Figures 7A and 8A) and blots of tissue lysates did not show raised levels of LC3-I or SQSTM1 (Figures 7B and 8B), consistent with the absence of SQSTM1 inclusions in tissue sections (Figures 7D and 8D). As seen for liver, tissue homeostasis in kidney and muscle required autophagy, but did not require the WD domain of ATG16L1 and was, therefore maintained independently of LAP.
Figure 8.

Analysis of kidney. (A) Kidney weights at 2–3 months expressed (i) directly: E230 (atg16l1 n = 8, control n = 8, E226 (atg16l1) n = 7, control = 8; or as (ii) percentage body weight: E230 (atg16l1 n = 9, control n = 8, E226 (atg16l1) n = 7, control = 6. (B) Western blot of kidney lysates from 3 representative mice. Membranes strips taken from the appropriate molecular weight range were analyzed separately using the indicted antibodies. (C) Bar graphs show levels of LC3 and SQSTM1 relative to GAPDH. (D) Histochemical sections of kidneys immunostained for SQSTM1. (G) Indicates glomerulus. Enlarged regions of interest are shown in lower panels. Arrows: SQSTM1 inclusions. Data from control mice were pooled. Statistical analysis was done by unpaired t test. Error bars represent ±SEM. ***-P < 0.001, **-P < 0.01; ns, non-significant. Magnification 20X, scale bars: 50 µm.

Analysis of kidney. (A) Kidney weights at 2–3 months expressed (i) directly: E230 (atg16l1 n = 8, control n = 8, E226 (atg16l1) n = 7, control = 8; or as (ii) percentage body weight: E230 (atg16l1 n = 9, control n = 8, E226 (atg16l1) n = 7, control = 6. (B) Western blot of kidney lysates from 3 representative mice. Membranes strips taken from the appropriate molecular weight range were analyzed separately using the indicted antibodies. (C) Bar graphs show levels of LC3 and SQSTM1 relative to GAPDH. (D) Histochemical sections of kidneys immunostained for SQSTM1. (G) Indicates glomerulus. Enlarged regions of interest are shown in lower panels. Arrows: SQSTM1 inclusions. Data from control mice were pooled. Statistical analysis was done by unpaired t test. Error bars represent ±SEM. ***-P < 0.001, **-P < 0.01; ns, non-significant. Magnification 20X, scale bars: 50 µm.

Brain

The autophagy-defective atg16l1 mice showed a range of neurological defects including loss of motor coordination, abnormal limb clasping and an unusual splayed gait suggesting defects in both the peripheral and central nervous system (data not shown). The neurological phenotype of autophagy-defective atg16l1 mice mirrored the loss of motor coordination seen in mice deficient in ATG7 in the central nervous system [26]. The brains of the atg16l1 mice were smaller than littermate controls, but there was no significant difference when brain weights were expressed as a percentage of body weight (Figure 9A). There were high levels of SQSTM1 in brain lysates (Figure 9B and C), and brain sections showed evidence of SQSTM1 inclusions (Figure 9D). In contrast, brain lysates from the LAP-deficient atg16l1 mice had levels of LC3-I and SQSTM1 similar to controls (Figure 9B and C), and brains lacked SQSTM1 inclusions (Figure 9D). Although motor coordination appeared normal in the majority of the atg16l10 mice, some developed head tilt suggesting defects in the inner ear or possible ear infection.
Figure 9.

Analysis of brain. (A) Brain weights at 2–3 months expressed (i) directly: E230 (atg161 n = 8, control n = 7, E226 (atg16l1) n = 7, control = 7; or (ii) as percentage body weight: E230 (atg161 n = 8, control n = 9, E226 (atg16l1) n = 6, control = 5. (B) Western blot of brain lysates from 3 representative mice. Membrane strips taken from the appropriate molecular weight range were analyzed separately by western blot using the indicted antibodies. (C) Bar graphs show levels of LC3 and SQSTM1 relative to GAPDH. (D) Histochemical sections of brains were immunostained for SQSTM1. Enlarged regions of interest are shown in lower panels. Arrows indicate SQSTM1 inclusions. Data from control mice were pooled. Statistical analysis was done by unpaired t test. Error bars represents ±SEM. ***-P < 0.001, *-P < 0.1; ns, non-significant. Magnification 20X, scale bars: 50 µm.

Mice with systemic loss of ATG16L1 from all tissues (atg16l1−/-) die at birth from a suckling defect [15]. This raised the question of how the atg16l1 mice, which appear autophagy-defective, survive neonatal lethality. Neonatal lethality in atg5−/- mice can be reversed by brain-specific re-expression of ATG5 [24]. These rescued mice (atg5-null) lack ATG5 and autophagy in non-neuronal tissues and develop multiple organ abnormalities with a phenotype closely resembling the atg16l1 mouse described here. Both the atg5-null and atg16l1 mice, survived neonatal lethality, but grew slowly compared to control mice, and have pronounced hepatomegaly and sarcopenia. This makes it possible that atg16l1 mice described in our study survive neonatal lethality because they carry out a low level of autophagy in the brain. Interestingly, the LC3-I levels in the brain of atg16l1 mice were the same as controls (Figures 9B and 9C). This was in contrast to peripheral tissues such as liver (Figure 5D), muscle (Figure 7B and C) and kidney (Figure 8B and C) where LC3 was elevated 3-4 fold. The preservation of control levels of LC3-I in atg16l1 mice suggest that LC3 may be degraded in the brain by autophagy. This observation, and the striking similarity in phenotype with the neuronal-specific rescue of atg5-null mice described by Yoshii et al [24], suggests that the brain of atg16l1 mice may compensate for the loss of autophagy arising from loss of the E230 residue required for WIPI2 binding. The size exclusion analysis of liver extracts in Figure 2 showed the elution of WIPI2 in high molecular-weight fractions in mice expressing full-length ATG16L1 or the CCD of ATG16L1 that retained glutamate E230 required for WIPI2 binding, but not in mice expressing the ATG16L1E226 CCD lacking E230. This provides an indirect assay for binding of WIPI2 to ATG16L1 when gel filtration was repeated for brain lysates (Figure 10). As seen in liver, ATG16L1 in control mice eluted in high molecular-mass fractions suggesting formation of a 300- to 600-kDa complex. These same fractions contained the ATG12–ATG5 conjugate, but surprisingly these fractions did not contain WIPI2, which eluted between 50 and 100 kDa (Figure 10). Similarly, the ATG16L1E230 and ATG16L1E226 CCDs formed high molecular-weight complexes and co-eluted with ATG12–ATG5 but were unable to move WIPI2 to high molecular-weight fractions. The profiles resembled that seen for the ATG16L1E226 CCD in liver that lacks the E230 glutamate required for WIPI2 binding (Figure 2). Taken together the results suggested that the binding of ATG16L1 to WIPI2 differs in brain compared to liver. This may provide the basis for a low level of autophagy in brain that allows the atg16l1 mice to survive neonatal lethality.
Figure 10.

Analysis of ATG16L1 complexes in brain by gel filtration. The cytosolic fraction of brain homogenates was separated by size-exclusion chromatography on an ENrichTMSEC 650 column. Fraction (0.5 ml) were analyzed by immunoblot for ATG16L1, ATG5 and WIPI2 as indicated. Void volume 10 ml. Migration and elution of molecular mass standards are shown (kDa).

Discussion

We have generated mice lacking the WD and linker domains of ATG16L1 to study the roles played by autophagy and LAP in maintaining tissue homeostasis in vivo. The atg16l1 mice were unable to activate LAP, but retained glutamate E226 and E230 in the CCD required for WIPI2 binding and could therefore activate autophagy. These mice grew at the same rate as littermate controls, were fertile and did not have obvious defects in liver, kidney, brain or muscle homeostasis. This suggests that autophagy rather than LAP plays a major role in reducing tissue damage in vivo. The WD domain of ATG16L1 in higher eukaryotes including insects, nematodes, plants and humans contains over half the amino acids of the 66-kDa protein [21]. Gel filtration analysis suggested that full-length ATG16L1 formed a 300- to 600-kDa complex in liver and brain. The CCDs of the atg16l1 and atg16l1 mice eluted over a broad size ranging from 50–400 kDa suggesting multimeric assembly in the absence of the WD domain. These results are consistent with previous gel filtration analysis [21] demonstrating 600- to 800-kDa complexes of ATG16L1 in lysates of liver, brain and fibroblast cell lines, and the formation of additional smaller complexes ranging between 100 and 300 kDa in fibroblasts expressing ATG16L1 lacking the WD domain. Initial calculations based on gel filtration suggest formation of complexes containing 8 copies of ATG16L1 bound to the ATG12–ATG5 conjugate [21]. Later work analyzing the ATG16L1 complex by sucrose gradient sedimentation suggests ATG16L1 exists as a dimer [27]. This discrepancy in size estimation could be explained if ATG16L1 adopted an elongated conformation in solution accelerating its elution from gel filtration columns. Regardless of the precise size of complexes formed by ATG16L1 and the CCDs of the atg16l1, all three co-eluted with ATG12–ATG5. This increase in apparent size of the 72 kDa ATG12–ATG5 conjugate suggests the conjugate binds all 3 CCDs via the N-terminal ATG5 binding domain. The binding of WIPI2 to ATG16L1 requires glutamate E230 in the CCD, which is absent in the CCD of the atg16l1. The lack of elution of WIPI2 in high molecular-weight liver fractions containing the CCD of the atg16l1 mouse suggested that loss of glutamate E230 results in reduced WIPI2 binding in vivo. Analysis of brain. (A) Brain weights at 2–3 months expressed (i) directly: E230 (atg161 n = 8, control n = 7, E226 (atg16l1) n = 7, control = 7; or (ii) as percentage body weight: E230 (atg161 n = 8, control n = 9, E226 (atg16l1) n = 6, control = 5. (B) Western blot of brain lysates from 3 representative mice. Membrane strips taken from the appropriate molecular weight range were analyzed separately by western blot using the indicted antibodies. (C) Bar graphs show levels of LC3 and SQSTM1 relative to GAPDH. (D) Histochemical sections of brains were immunostained for SQSTM1. Enlarged regions of interest are shown in lower panels. Arrows indicate SQSTM1 inclusions. Data from control mice were pooled. Statistical analysis was done by unpaired t test. Error bars represents ±SEM. ***-P < 0.001, *-P < 0.1; ns, non-significant. Magnification 20X, scale bars: 50 µm. The WD domains of ATG16L1 represent as much as a third of the total protein. It is perhaps remarkable that this complex of 7 bladed β-propellers, which are thought to provide a platform for protein-protein interactions important for autophagy, play little role in maintaining tissue homeostasis ‘in vivo’. Instead, evolution appears to have confined this important role to the N-terminal ATG5 binding and CC domains conserved through to the yeast ortholog Atg16 [28]. Binding of ATG16L1 to WIPI2 requires glutamate residues E226 and E230 in the ATG16L1 CCD, which bind arginine R108 and R125 exposed on the surface of WIPI2. Deletion of either E226 or E230 in ATG16L1 abrogates binding to WIPI2, and expression of WIPI2 lacking R108 and R125 is unable to reconstitute LC3 recruitment to phagophores in WIPI2-depleted cells [18]. Our study shows that the integrity of this WIP2 binding site within the short N-terminal domain is critical for autophagy in vivo, because loss of one amino acid, E230, required for WIPI2 binding, results in loss of autophagy and results in multiple tissue abnormalities. Analysis of ATG16L1 complexes in brain by gel filtration. The cytosolic fraction of brain homogenates was separated by size-exclusion chromatography on an ENrichTMSEC 650 column. Fraction (0.5 ml) were analyzed by immunoblot for ATG16L1, ATG5 and WIPI2 as indicated. Void volume 10 ml. Migration and elution of molecular mass standards are shown (kDa). Macrophages and fibroblasts cultured from mice lacking the WD domain were unable to activate LAP. This is in agreement with previous work [22], showing that the WD domain is required for several noncanonical pathways that recruit LC3-II to endocytic compartments. These include newly formed macropinosomes, phagosomes containing latex beads or apoptotic corpses, endosomes swollen by monensin or a combination of ammonium chloride and the vacuolating toxin A from Helicobacter pylori, and endosomes targeted by the M2 proton channel encoded by influenza virus. Furthermore, loss of the WD domain from ATG16L1 in dendritic cells results in reduced secretion of TNF and IL1B in response to CLEC4N/Dectin2 signalling [23] and reduced antigen presentation by dendritic cells [22]. The requirement of the WD domain for LAP suggests that the scaffold provided by the WD domains of ATG16L1 has evolved a specialized role, independent of autophagy, to ensure the quality control of endocytic pathways by conjugating LC3 to phagosomes containing pathogens or apoptotic cells, or endocytic compartments showing signs of damage. This is supported by the observation that the WD domain of ATG16L1 binds NOD-like receptors [29], MEFV/TRIM20 [30], TMEM59 [31] and EVA1A/TMEM166 [32], which are important in pathogen recognition. Our observation that mice remain viable and maintain tissue homeostasis over long periods in the absence of the WD domain suggests that LAP does not play an essential role in preventing tissue damage in vivo. LAP in phagocytic cells requires RUBCN and CYBB/NOX2 [3] and mice with Lyz2/LysM-cre-targeted disruption of either of these genes in macrophages, monocytes and neutrophils, grow slowly. We did not observe slowed growth for the atg16l1 LAP-defective mice suggesting that loss of LAP from all tissues allows mice to compensate for loss of LAP in phagocytic cells. Alternatively, the deletion of the WD domain, and loss of RUBCN and CYBB/NOX2, inactivate LAP by different mechanisms. ATG16L1 is downstream of RUBCN and CYBB/NOX2, and it will be interesting to determine if the WD domain interacts with RUBCN or UVRAG or components of the CYBB/NOX2 complex. Defective clearance of apoptotic cells following LAP deficiency resulting from lack of CYBB/NOX2 or RUBCN in phagocytic cells predisposes mice to an autoimmune disease resembling systemic lupus erythematosus [4]. At 52 wk, rubcn mice have increased levels of antibody against double-stranded DNA, anti-nuclear antibodies and deposition of immune complexes in the kidney. Our analysis of LAP-deficient atg16l1 mice at 20–24 wk did not show elevated cytokines or anti-nuclear antibodies (not shown), but this does not preclude development of lupus-like autoimmunity as they age further. MEFs cultured from atg16l1 mice were unable to activate autophagy in response to starvation, and the mice showed accumulation of SQSTM1 in vivo. These mice grew slowly, were infertile and showed defects in liver, brain and muscle homeostasis, and neurological defects similar to those reported for mice with analogous tissue-specific loss of autophagy genes. These mice again highlight the importance of autophagy for maintaining tissue health in vivo, but, surprisingly, the atg16l1 mice were able to survive neonatal lethality. These mice therefore differ from mice with systemic deletion of Atg3, Atg5, Atg12 or Atg16l1, which die within hours of birth because they cannot compensate for loss of placental nutrition [12,14,15]. This suggests that the truncated CCDE226 may provide functions that are missing when Atg16l1 is deleted completely. The CCDE226 retains the ATG5 binding domain allowing the CCD E226 to bind the ATG12–ATG5 conjugate and assemble into an ATG12–ATG5-ATG16L1 CCDE226 complex. This complex may maintain E3 ligase activity and be able to facilitate lipidation of LC3 and autophagosome formation at a low level. Evidence for a low level of autophagy is provided in Figure 3A where accumulation of SQSTM1 in MEFs from atg16l1 appeared lower than following complete loss of ATG16L1, and there was a feint band for LC3-II. In addition, the requirement for WIPI2 binding to ATG16L1 to initiate autophagy may differ between brain and peripheral tissues. Support for this is provided by gel filtration analysis which suggested that binding of WIPI2 to the E230 glutamate residue in the CCD of ATG16L1 occurred in liver, but binding was much weaker in brain. The phenotype of the atg16l1 mouse was very similar to the atg5-null mouse described by Yoshii et al [24] where ATG5 expression was restored in the brain of atg5 mice. In common with atg16l1 mice, the atg5-null mouse survived neonatal lethality but grew slowly and showed SQSTM1 accumulation in peripheral tissues, particularly liver and muscle. The atg5-null mice were sterile and have the pronounced hepatomegaly seen in atg16l1 mice. This makes it possible that a low level of autophagy in the brain of atg16l1 mice allows them to survive neonatal lethality. Indirect evidence for this is provided by the observation that LC3-I levels were not raised in the brains of atg16l1 mice (Figure 8B) compared to muscle (Figure 6B), liver (Figure 4D) and kidney (7B). The truncated CCDE226 is able to protect against neonatal lethality, but not able to provide long-term protection against neurological defects. This phenotype is similar to the mice lacking ATG7 in the central nervous system [26] where neurons accumulate SQSTM1 inclusions and ubiquitin, and Purkinjie cells and pyramidal neurons are lost from the cerebellar cortex.

Materials and methods

Construction of the targeting vector

A P1 artificial chromosome (PAC) mouse genomic DNA library (Source BioScience, 711_RPCI21mPAC) was screened with a 0.5-kb Xho I-Sal I fragment obtained from the Atg16l1 IMAGE cDNA clone 6,813,377/AV130 A2 (Source BioScience). A 10-kb XhoI and a 13-kb BamHI fragment, containing exons 1–10 of Atg16l1, were subcloned into pBSIISK- (Agilent, 212,206). Two stop codons and restriction sites for NheI, XhoI, EcoRV and EcoRI were introduced into exon 6 after amino acid position 230 by PCR. Two 1.5-kb fragments were generated using primer pairs CCAAATCCAGGTACCTCTCAG.seq in combination with ATCCTCGAGATCGATGCTAGCCTACTATTCCTTTGCTGCTTCTGCAAG.rev and ATCGATCTCGAGGATATCGAATTCCCTCTACCTGTTGAACAGTG.seq in combination with CCTGGCCCGGGCATGATAATG.rev, followed by an annealing PCR of the 2 fragments using primers CCAAATCCAGGTACCTCTCAG.seq and CCTGGCCCGGGCATGATAATG.rev to generate a 3-kb fragment, which was cloned into a SmaI-cut pUC19 vector (Addgene, 50,005). The bovine growth hormone polyadenylation site (bGH-pA; derived from pPGK-Cre-bpA, Addgene, 11,543) was cloned into the blunt-ended XhoI site, followed by cloning the blunt-ended PGK-Neo-frt cassette [33] into EcoRV. A KpnI-SmaI fragment of an 8.7-kb SacI-SmaI fragment, generated from the 10-kb XhoI and 13-kb BamHI genomic clones, was then exchanged with the modified exon 6-containing genomic PCR fragment.

Embryonic stem cells and generation of homozygous mice

Embryonic stem cells were cultured as described previously [34]. R1 cells (2x107) [35] were electroporated with 30 µg NotI-linearized targeting vector as described. G418-resistant clones were screened by Southern hybridization for homologous recombination. Positive clones were expanded, re-analyzed by Southern blot analysis and PCR, and injected into C57L/B6 blastocysts. Highly chimeric male founder mice were obtained, which were crossed with C57LB/6 females to obtain heterozygous F1 offspring. The neomycin cassette was removed by crossing F1 offspring with FlpO transgenic mice [36] and mice were subsequently crossed onto a C57L/B6 background. Genotype analysis was performed using primers CAAATATGCCTTCAGAACTG and GCTGTAGTTCCAATCCCTAA, resulting in 290-bp and 640-bp fragments for wild-type and mutant mice, respectively.

Mice

These studies used adult male and female mice of approximately 2–3 months of age from the first cross of 129 and C57BL/6. All experiments were performed in accordance with UK Home Office guidelines and under the UK Animals (Scientific procedures) Act1986. The growth rate of these mice was estimated by recording weights each week. Mice were killed by schedule-1 procedures and dissected to harvest brain, liver, gastrocnemius muscle and kidney. The weights of the organs were recorded before fixing or freezing.

Cells and cell culture

MEFs were generated by serial passage of cells taken from mice at embryonic day 13.5 and cultured in DMEM (ThermoFisher scientific, 11,570,586) with 10% FCS. BMDMs were generated from bone marrow isolated from femur and tibia flushed with RPMI 1640 (Sigma, R8758). Macrophages were generated by culturing adherent cells in RPMI 1640 containing 10% FCS and CSF1/M-CSF (Peprotech, 315–02; 30 ng/ml) for 6 d. Macrophage populations were quantified by FACS using antibodies against FCGR3/CD16-FCGR2B/CD32, ADGRE1/F4/80 and ITGAM/CD11b (BioLegend, 101,320, 123,107).

Autophagy and LC3-associated phagocytosis

Autophagy was activated by incubating cells in HBSS (ThermoFisher, 11,550,456) to create starvation for 2 h at 37°C. LAP was stimulated in bone marrow-derived macrophages by Pam3CSK4-coupled beads. Carboxyl-modified beads (polybead carboxylate 3.0 µm, 09850) were conjugated with Pam3csk4 (invivogen, TLRL-PMS) by following the manufacturer’s protocol (Bangs Laboratories, Inc. Tech Note 205, III.). Pam3CSK4-coupled beads were added to macrophage cultures at a ratio of 10:1 (bead/cell) for 1.5 h before being fixed and the location of LC3 analyzed by immunofluorescence microscopy.

Tissue western blotting

Dissected tissue was snap-frozen in liquid nitrogen, ground to a fine powder under liquid nitrogen and lysed in RIPA buffer (150 mM sodium chloride, 1% TritonX-100 [Sigma, P1379-1L], 0.5% sodium deoxycholate [Sigma, D-5670], 0.1% sodium dodecyl sulfate [Fisher Bioreagents, BP166-500], 50 mM Tris, pH 8.0) containing protease (Sigma, P8340) and phosphatase (Sigma, P5726) inhibitors followed by homogenization and freeze thaw. Samples were clarified by centrifugation (10,600 g, 10 min at 4°C). Supernatants containing ~10 ug protein were boiled in Laemmli buffer followed by SDS-PAGE using 4–12% gradient gels (Expedeon, NBT41212). The resolved proteins were electro-blotted onto nitrocellulose membrane (Bio-Rad, 1,620,115), blocked (5% skimmed milk in 1X TBS [50mM Tris (pH 7.5), 150mM NaCl], 1 h, room temperature) and then probed first with appropriate primary (ATG16L1 [MBL, M150-3], SQSTM1/p62 [Abcam, ab91526], GAPDH [Abcam, ab9482] and LC3A/B [Cell Signalling Technology, 4108]) and then secondary antibody (Cell Signalling Technology, 7074S and 7076S). Blots were visualized by exposure to Supersignal West Pico chemiluminescent substrate (ThermoFisher Scientific, 34,080). Bands were quantified through ImageJ (NIH, USA), analyzed (unpaired t-test) and plotted via GraphPad prism 7 software.

Cell western blotting

Protein was extracted using M-PER (ThermoFisher Scientific, 78,501) with complete protease inhibitor cocktail (Sigma, 04693159001) for 30 min on ice. Samples were clarified by centrifugation (10,600Xg, 10 min). From the supernatants, protein concentrations were determined using the BCA protein assay system (ThermoFisher Scientific, 23,225) according to the manufacturer’s protocol. Protein (20 µg) was separated on a precast 4–12% gradient SDS-PAGE gel (Expedeon, NBT41212) and transferred to immobilon PVDF (Millipore, IPFL00010) for blotting. Membranes were probed using antibodies for ATG16L1 (MBL), SQSTM1/p62, (Abcam), LC3A/B and ACTB/actin (Sigma, A5441). Primary antibodies were detected using IRDye labelled secondary antibodies (LI-COR biosciences, 926–32,211, 926–68,020) at 1∶10,000 dilution. Proteins were visualized using the Odyssey infrared system (LI-COR).

Gel filtration chromatography

Freshly dissected livers and brains were suspended in cold phosphate-buffered saline (Oxoid, BR0014G) containing protease inhibitors (Roche, 05892791001) and homogenized using a Dounce homogenizer. Particulate material was removed by sequential centrifugation at 100Xg and 13,000Xg (4°C) for 20 min. The supernatants were clarified by ultracentrifugation (100,000Xg, 4°C, 1 h) and analyzed by the gel filtration using an ENrichTMSEC 650 (Bio-Rad, 780–1650,) column and AKTA purifier (GE Healthcare) to collect 0.5-ml fractions. Fractions were analyzed by SDS-PAGE followed by western blotting on PVDF membranes probed for ATG16L1, ATG5 (Abcam, ab108327) and WIPI2 (Abcam, ab101985). The void volume (Vo) was estimated using Blue dextran (Sigma, D4772-1VL) and the elution volumes (Ve) of molecular size standards (Sigma, MWGF1000) allowed the determination of Ve: V0 ratios to create a standard curve.

Cytokine assays

Serum from young (2–3 months) and aged (5–6 months) mice were analyzed for cytokines using ProcartaPlexTM Simplex Immunoassay kits (ThemoFisher Scientific, EPX01A-26,015–901, EPX01A-20,603–901, EPX01A-26,004–901, EPX01A-26,005–901, EPX01A-20,607–901 and EPX01A-26,002–901) by following the manufacturer’s instructions. Samples were read on a Luminex TM 100/200TM instrument (Luminex Corp.).

Histochemistry

Dissected tissues were fixed in 10% neutral buffer formalin (Sigma, HT501128), dehydrated, paraffin embedded and sectioned (5-µm thickness) prior to staining in hematoxylin and eosin (H&E). For immunohistochemistry deparaffinized and rehydrated sections were subjected to microwave-based antigen retrieval in citrate buffer (~ 0.24% trisodium citrate dihydrate, ~ 0.038% citric acid, in water). The sections were then incubated in hydrogen peroxide buffer (10% H2O2 in methanol) to mask any background peroxidase activity followed by treatment with blocking solution (10% goat serum [Gibco, 16,210–072], 0.30% Triton X-100 in PBS). Sections were stained with appropriate primary (anti SQSTM1/p62 antibody, anti MKI67/Ki67 antibody [Abcam, ab66155], anti ITGAM/Cd11b antibody [Abcam, ab133357]) and secondary antibodies (anti rabbit-HRP; Dako, K4003). The signals were developed with chromogen buffer (Dako, K3468). Tissue sections were mounted using cover glass and mounting medium (Neomount; Merck, 1,090,160,100) and imaged using 20X and 40X objectives on a bright-field microscope (Zeiss). The images were analyzed using Axio Vision software (cell circumference measurement, Axio Vision SE64 Rel. 4.8) and ImageJ software (cell counter plugin, NIH, USA). The obtained data were analyzed (unpaired t test) and plotted through GraphPad prism 7 software.

Fluorescence imaging

Cells grown on glass coverslips were fixed at −20°C in ice cold methanol for 7 min, then blocked in 5% goat serum, 0.3% Triton X-100 in PBS (Sigma, G9023; X100). Cells were incubated with anti LC3A/B (Cell Signalling Technology, 4108; 1:500 in 1% BSA [Europa Bioproducts Ltd., EQBAH62-1000], 0.3% Triton X-100 in PBS). Washed cells were incubated with secondary antibody anti-rabbit-Alexa Fluor 488 (Life Technologies, A11008) and counterstained with 4ʹ, 6 diamidino-2-phenylindole (DAPI; ThermoFisher Scientific, 10,116,287) and mounted on slides with Fluoromount-G from Southern biotech (ThermoFisher Scientific, 15,586,276). Cells were imaged on a Zeiss Imager M2 Apotome microscope with a 63X, 1.4 NA oil-immersion objective using 365 ± 40 nm excitation and 445 ± 25 nm emission for DAPI, 470 ± 20 nm excitation and 525 ± 25 nm emission for LC3. Images were obtained using a Zeiss Axioplan microscope with bright field.

Statistics

Unpaired t test was employed for the data analysis across all the experiments. The data were analyzed and plotted through GraphPad prism 7 software.

Microscopy

All the fluorescent imaging was carried out using an Apotome microscope from Zeiss, fitted with 63X objective. All the immunohistochemistry for bright-field imaging was carried out using an Axioplan 2 microscope from Zeiss, fitted with 20X, 40X objectives and a colored Axio Cam HRc camera from Zeiss.
  36 in total

1.  Loss of autophagy in the central nervous system causes neurodegeneration in mice.

Authors:  Masaaki Komatsu; Satoshi Waguri; Tomoki Chiba; Shigeo Murata; Jun-ichi Iwata; Isei Tanida; Takashi Ueno; Masato Koike; Yasuo Uchiyama; Eiki Kominami; Keiji Tanaka
Journal:  Nature       Date:  2006-04-19       Impact factor: 49.962

2.  V-ATPase and osmotic imbalances activate endolysosomal LC3 lipidation.

Authors:  Oliver Florey; Noor Gammoh; Sung Eun Kim; Xuejun Jiang; Michael Overholtzer
Journal:  Autophagy       Date:  2015       Impact factor: 16.016

3.  TMEM59 defines a novel ATG16L1-binding motif that promotes local activation of LC3.

Authors:  Emilio Boada-Romero; Michal Letek; Aarne Fleischer; Kathrin Pallauf; Cristina Ramón-Barros; Felipe X Pimentel-Muiños
Journal:  EMBO J       Date:  2013-02-01       Impact factor: 11.598

4.  Loss of Atg12, but not Atg5, in pro-opiomelanocortin neurons exacerbates diet-induced obesity.

Authors:  Ritu Malhotra; James P Warne; Eduardo Salas; Allison W Xu; Jayanta Debnath
Journal:  Autophagy       Date:  2015       Impact factor: 16.016

Review 5.  LC3-Associated Phagocytosis and Inflammation.

Authors:  Bradlee L Heckmann; Emilio Boada-Romero; Larissa D Cunha; Joelle Magne; Douglas R Green
Journal:  J Mol Biol       Date:  2017-08-25       Impact factor: 5.469

6.  Mouse Apg16L, a novel WD-repeat protein, targets to the autophagic isolation membrane with the Apg12-Apg5 conjugate.

Authors:  Noboru Mizushima; Akiko Kuma; Yoshinori Kobayashi; Akitsugu Yamamoto; Masami Matsubae; Toshifumi Takao; Tohru Natsume; Yoshinori Ohsumi; Tamotsu Yoshimori
Journal:  J Cell Sci       Date:  2003-05-01       Impact factor: 5.285

7.  Absence of integrin alpha 7 causes a novel form of muscular dystrophy.

Authors:  U Mayer; G Saher; R Fässler; A Bornemann; F Echtermeyer; H von der Mark; N Miosge; E Pöschl; K von der Mark
Journal:  Nat Genet       Date:  1997-11       Impact factor: 38.330

8.  The role of autophagy during the early neonatal starvation period.

Authors:  Akiko Kuma; Masahiko Hatano; Makoto Matsui; Akitsugu Yamamoto; Haruaki Nakaya; Tamotsu Yoshimori; Yoshinori Ohsumi; Takeshi Tokuhisa; Noboru Mizushima
Journal:  Nature       Date:  2004-11-03       Impact factor: 49.962

9.  Nod1 and Nod2 direct autophagy by recruiting ATG16L1 to the plasma membrane at the site of bacterial entry.

Authors:  Leonardo H Travassos; Leticia A M Carneiro; Mahendrasingh Ramjeet; Seamus Hussey; Yun-Gi Kim; João G Magalhães; Linda Yuan; Fraser Soares; Evelyn Chea; Lionel Le Bourhis; Ivo G Boneca; Abdelmounaaim Allaoui; Nicola L Jones; Gabriel Nuñez; Stephen E Girardin; Dana J Philpott
Journal:  Nat Immunol       Date:  2009-11-08       Impact factor: 25.606

10.  TRIM-mediated precision autophagy targets cytoplasmic regulators of innate immunity.

Authors:  Tomonori Kimura; Ashish Jain; Seong Won Choi; Michael A Mandell; Kate Schroder; Terje Johansen; Vojo Deretic
Journal:  J Cell Biol       Date:  2015-09-14       Impact factor: 10.539

View more
  36 in total

Review 1.  Activation and targeting of ATG8 protein lipidation.

Authors:  Sascha Martens; Dorotea Fracchiolla
Journal:  Cell Discov       Date:  2020-05-05       Impact factor: 10.849

2.  A guide to membrane atg8ylation and autophagy with reflections on immunity.

Authors:  Vojo Deretic; Michael Lazarou
Journal:  J Cell Biol       Date:  2022-06-14       Impact factor: 8.077

3.  A noncanonical autophagy is involved in the transfer of Plasmodium-microvesicles to astrocytes.

Authors:  Inès Leleu; Delphine Genete; Sophie Salomé Desnoulez; Nasreddine Saidi; Priscille Brodin; Frank Lafont; Stanislas Tomavo; Sylviane Pied
Journal:  Autophagy       Date:  2021-11-06       Impact factor: 13.391

4.  lncRNA ZNF649-AS1 Induces Trastuzumab Resistance by Promoting ATG5 Expression and Autophagy.

Authors:  Mingli Han; Xueke Qian; Hui Cao; Fang Wang; Xiangke Li; Na Han; Xue Yang; Yunqing Yang; Dongwei Dou; Jianguo Hu; Wei Wang; Jing Han; Fan Zhang; Huaying Dong
Journal:  Mol Ther       Date:  2020-07-21       Impact factor: 11.454

5.  Non-canonical autophagy drives alternative ATG8 conjugation to phosphatidylserine.

Authors:  Joanne Durgan; Alf H Lystad; Katherine Sloan; Sven R Carlsson; Michael I Wilson; Elena Marcassa; Rachel Ulferts; Judith Webster; Andrea F Lopez-Clavijo; Michael J Wakelam; Rupert Beale; Anne Simonsen; David Oxley; Oliver Florey
Journal:  Mol Cell       Date:  2021-04-27       Impact factor: 17.970

Review 6.  The Macroautophagy Machinery in MHC Restricted Antigen Presentation.

Authors:  Christian Münz
Journal:  Front Immunol       Date:  2021-02-25       Impact factor: 7.561

7.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

Review 8.  Autophagy & Phagocytosis in Neurological Disorders and their Possible Cross-talk.

Authors:  Gaigai Li; Prativa Sherchan; Zhouping Tang; Jiping Tang
Journal:  Curr Neuropharmacol       Date:  2021       Impact factor: 7.708

9.  Atg21 organizes Atg8 lipidation at the contact of the vacuole with the phagophore.

Authors:  Lena Munzel; Piotr Neumann; Florian B Otto; Roswitha Krick; Janina Metje-Sprink; Benjamin Kroppen; Narain Karedla; Jörg Enderlein; Michael Meinecke; Ralf Ficner; Michael Thumm
Journal:  Autophagy       Date:  2020-06-09       Impact factor: 16.016

10.  Genetic Variants and Functional Analyses of the ATG16L1 Gene Promoter in Acute Myocardial Infarction.

Authors:  Falan Han; Shuchao Pang; Zhaoqing Sun; Yinghua Cui; Bo Yan
Journal:  Front Genet       Date:  2021-06-17       Impact factor: 4.599

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.