Literature DB >> 30383822

Chlamydia pecorum gastrointestinal tract infection associations with urogenital tract infections in the koala (Phascolarctos cinereus).

Samuel Phillips1, Amy Robbins1,2, Joanne Loader2, Jonathan Hanger2, Rosemary Booth3, Martina Jelocnik4, Adam Polkinghorne4, Peter Timms1.   

Abstract

BACKGROUND: Chlamydia infects multiple sites within hosts, including the gastrointestinal tract (GIT). In certain hosts, gastrointestinal infection is linked to treatment avoidance and self-infection at disease susceptible sites. GIT C. pecorum has been detected in livestock and koalas, however GIT prevalence rates within the koala are yet to be established.
METHODS: Paired conjunctival, urogenital and rectal samples from 33 koalas were screened for C. pecorum and C. pecorum plasmid using 16S rRNA and CDS5-specific quantitative PCR assays, respectively. Amplicon sequencing of 359 bp ompA fragment was used to identify site-specific genotypes.
RESULTS: The overall C. pecorum prevalence collectively (healthy and clinically diseased koalas) was 51.5%, 57.6% and 42.4% in urogenital, conjunctival and gastrointestinal sites, respectively. Concurrent urogenital and rectal Chlamydia was identified in 14 koalas, with no cases of GIT only Chlamydia shedding. The ompA genotype G dominated the GIT positive samples, and genotypes A and E' were dominant in urogenital tract (UGT) positive samples. Increases in C. pecorum plasmid per C. pecorum load (detected by PCR) showed clustering in the clinically diseased koala group (as assessed by scatter plot analysis). There was also a low correlation between plasmid positivity and C. pecorum infected animals at any site, with a prevalence of 47% UGT, 36% rectum and 40% faecal pellet.
CONCLUSIONS: GIT C. pecorum PCR positivity suggests that koala GIT C. pecorum infections are common and occur regularly in animals with concurrent genital tract infections. GIT dominant genotypes were identified and do not appear to be related to plasmid positivity. Preliminary results indicated a possible association between C. pecorum plasmid load and clinical UGT disease.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 30383822      PMCID: PMC6211709          DOI: 10.1371/journal.pone.0206471

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Background

In humans, Chlamydia infections have been directly linked to important diseases such as trachoma, pelvic inflammatory disease (PID) and tubular infertility [1-4]. Similar diseases are also reported in animals, caused by a range of veterinary chlamydial pathogens [5-10]. Beyond infections of the conjunctiva, urogenital and reproductive tracts, a growing body of literature is revealing that several Chlamydia species (C. trachomatis, C. muridarum, C. suis and C. pecorum) can survive within the host gastrointestinal tract (GIT), which can lead to gastrointestinal colonisation and a potential source of self-infection [11-18]. This infection potential is most well-established for the veterinary pathogen, C. pecorum, where rectal shedding rates can be greater than 30% in endemically infected sheep flocks and GIT infection is the initiator of systemic dissemination [19, 20]. Endemic rates of rectal colonisation and faecal shedding of C. pecorum have also been described in cattle, suggesting that GIT colonisation is an important source of transmission, and may lead to long-term adverse health effects [16-18]. In the koala (Phascolarctos cinereus), C. pecorum is the leading cause of disease and a major contributing factor to individual population declines. C. pecorum transmission pathways in the koala have long been thought to be predominantly via sexual transmission [10, 21]. Pap-feeding, the process where the joey ingest maternal caecal material and the GIT is inoculated with microbes essential for browse digestion, has also been hypothesised as a vertical transmission route [22]. Despite the potential importance of C. pecorum GIT infection in the pathogenesis of C. pecorum disease in livestock, surprisingly little is known about this form of infection in koalas with few studies available [21, 23–26]. Two recent studies investigated the koala digestive microbiota by performing 16S rRNA pyrosequencing on hind-gut samples from healthy and diseased, wild and captive koalas, however, they reported no Chlamydiaceae sequences from any koala sampled [27, 28]. Chlamydia may not have been detected in these studies if examined samples lacked epithelial cells containing the intracellular chlamydial infection or as a result of the lowered sensitivity of the chosen (16S) sequencing target. Burach et al. (2014) found histological evidence of Chlamydiaceae in both the urogenital tracts (UGT) and GITs of nine koalas, being the first to suggest alternative modes of Chlamydia transmission [29]. More recently, a study in 2016 reported both matched and discordant C. pecorum genotypes between faecal pellets and UGT samples in five out of six Victorian koalas [25]. The longevity of GIT Chlamydia and the relationship between C. pecorum infections in the GIT, UGT and conjunctivae in koalas is otherwise unknown, challenging efforts to pathogenesis and the relevance of field sampling approaches that rely exclusively on the detection of C. pecorum shedding in koala faecal pellets [25]. The presence of C. pecorum plasmid carriage is another potential factor in pathogenesis, which has been identified in strains infecting koalas, sheep, cattle and pigs (Jelocnik et al., 2015) and originally described in koala strains in 1988 (Girjes et al.). In other species, plasmids expand the genetic diversity of the infecting Chlamydia, and can increase virulence and potential tissue tropism [30, 31]. Mouse models have demonstrated that the presence of a plasmid in C. muridarum species increases virulence, leading to ascending infection of the UGT and hydrosalpinx [32]. Shao and colleagues (2017), also demonstrated that only plasmid positive C. muridarum strains can colonise the mouse GIT [33]. However, the significance of the plasmid in the context of koala C. pecorum GIT infections is unknown and its role in koala C. pecorum pathogenesis is less clear, with two population studies finding contrasting rates of C. pecorum plasmid positivity in association with overt disease [34, 35]. Understanding the complexities of C. pecorum infections in the koala including the associated virulence factors, allows for accurate screening of koalas for chlamydial infections, helps in disease transmission modelling, and aids in the understanding of the effectiveness of future vaccines. In addition, identification of GIT reservoirs of Chlamydia in other species has implications for the screening protocols used to detect human chlamydial infections. The koala model can therefore be used to help understand chlamydial transmission and whether current treatment (antibiotics or vaccination) regimes are effective at clearing these GIT reservoirs. We report here on an investigation into the prevalence of koala gastrointestinal C. pecorum shedding and the relationship to urogenital and ocular shedding, reporting on genotype disparities between anatomical sites and plasmid carriage involvement.

Methods

Ethics approval

Ethical approval for this study was granted by the Queensland Government, Department of Agriculture and Fisheries Animal Ethics Committee (AEC CA No. 2012/03/597 and 2013/09/719) and was performed under a Queensland Scientific Purposes Permit granted by Queensland Government, Department of Environment and Heritage Protection (SPP No. WISP11525212).

Sample collection and DNA isolation

We analysed 163 samples from 29 (17 female, 12 male) apparently healthy koalas and four koalas (one female and three male) with signs of UGT disease, presented to two wildlife treatment facilities from four different regions of South East Queensland, Australia. Urogenital tract disease was diagnosed by a thorough veterinary examination which included a visual assessment for urinary incontinence (signs of “dirty tail/wet bottom”), sonographic evaluation of the bladder and reproductive tract, and cytological examination of the urine sediment. Urogenital (urethral for males and urogenital sinus for females), conjunctival, and rectal swabs and faecal pellets were collected from koalas and stored at -20°C, prior to transportation to the University of the Sunshine Coast (USC). Swabs were swirled in 500 μL of sterile PBS, and 200 mg of the faecal pellet was placed into 1 mL of Qiagen stool storage buffer (InhibitEX Buffer) and stored at -20°C until DNA extraction. For DNA extraction, 200 μL (PBS homogenate from swabs) or 600 μL (InhibitEX homogenate from faecal pellets) was processed using the Qiagen, QIAamp DNA Mini Kit (Venlo, The Netherlands) following the “DNA Purification from Blood or Body Fluids, Spin Protocol” or the “DNA Purification from Scat, Spin Protocol”. All DNA aliquots were stored at -20°C until further use.

C. pecorum PCR detection and ompA genotyping

We performed real-time PCR (qPCR) for the detection of C. pecorum genomic DNA targeting a 204 bp fragment of the 16S rRNA gene [36]. Quantification was performed by plotting the crossing points against a standard curve produced using a serial dilution of known standards from 1 x 106 to 1 x 102 copies/μL [37]. To determine the genotype of the infecting strain, we amplified a 359 bp region of the C. pecorum ompA gene (between variable regions three and four) [36] and performed Sanger sequencing (Macrogen, South Korea) to determine the C. pecorum ompA genotype present in urogenital, rectal and faecal samples according to the scheme first outlined in Kollipara et al., (2013). No ompA typing was performed on conjunctival C. pecorum qPCR positive samples. Forward and reverse ompA sequences were trimmed for quality and combined into one contig using the Staden sequence analysis software. Resulting sequences were analysed by BLASTn to infer the ompA genotype. C. pecorum genotype results were then analysed for genotype prevalence and diversity between different anatomical sites from the same koala. PCR amplification of the koala β-actin gene was also performed on all samples as an internal control to identify any PCR inhibition and failed DNA extraction [38]. The prevalence of C. pecorum at each site was noted and then each site was directly compared for concurrent C. pecorum at multiple sites using 2x2 tables. Generation of correlation coefficients, confidence intervals and P-values for comparisons of quantified rectal (rectal swab or faecal pellet), UGT and conjunctival (either eye) results were performed using the statistical package R (version x64 3.2.4). We performed qPCR detection for the C. pecorum plasmid targeting a 233 bp fragment of the of the C. pecorum plasmid (CDS5 or Pgp3 locus) on all UGT, rectal and faecal pellet samples. Using specific primers plasF– 5’–AATGGAAGGAGCTGTTGTC– 3’ and plasR– 5’–GATGTTGTTTCTGCATTAAGG– 3’ and Bio-Rad Sybr-green Itaq master mix, with an initial 95°C enzyme activation for 5 minutes, then 40 cycles of 95°C denaturation for 5 seconds, 57°C primer binding for 30 seconds and 72°C for 25 seconds with a fluorescence data capture. Finally, a melt profile was generated from 55°C to 95°C at 0.5°C per 2 seconds per step.

Results

We analysed a total of 163 samples from 29 outwardly healthy koalas and from four koalas with clinical signs of UGT disease (rectal samples from two outwardly healthy koalas were not collected) (S1 Table). Using a C. pecorum-specific 16S rRNA qPCR assay, we detected C. pecorum shedding in the conjunctiva of 19 koalas (57.6%) (12 female and seven male), the UGT in 17 koalas (51.5%) (nine female and eight male), and the gastrointestinal site (rectal swab and/or faecal pellet) in 14 koalas (six female and eight male) (Table 1).
Table 1

Prevalence of C. pecorum at urogenital, ocular and rectal sites.

SiteResultAll Koalas (%)Female Koalas (%)Male Koalas (%)
Ocular (either eye)Positive19 (57.6)12 (66.7)7 (46.6)
Negative14 (42.4)6 (33.3)8 (53.3)
UrogenitalPositive17 (51.5)9 (50.0)8 (53.3)
Negative16 (48.5)9 (50.0)7 (46.6)
Rectal (rectal swab or faecal pellet)Positive14 (42.4)6 (33.3)8 (53.3)
Negative19 (57.6)12 (66.7)7 (46.6)
Total number of koalas sampled331815
There was a moderate agreement (Cohen’s Kappa = 0.56 95%CI (25.0, 86.8)) of C. pecorum shedding between rectal swabs and faecal pellets (Table 2), with no isolated cases of GIT C. pecorum (from either site).
Table 2

Comparison of faecal pellet and rectal swab C. pecorum 16S rRNA PCR results.

Rectal swab
Faecal pelletNegativePositiveTotalCohen's kappa95%CI
Negative184220.550.25, 0.87
Positive279
Total201131
We observed a very high correlation between infection at the GIT and UGT sites, with 14 of the 17 (82%) positive animals being positive at both sites with a similar chlamydial DNA load between sites (R = 0.86, P = <0.0001 and 95%CI (72.84, 92.76)) (Table 3).
Table 3

Concurrent C. pecorum detection between urogenital and rectal sites.

Urogenital
Male RectalNegativePositive
UrogenitalNegative70
RectalNegativePositivePositive08
Negative163
Positive014Urogenital
Correlationr = 0.86 P = <0.0001Female RectalNegativePositive
95%CI (72.84, 92.76)Negative93
Positive06
By comparison, only 33.3% of koalas had concurrent conjunctival and GIT C. pecorum infections (five males and six females). There was also a disparity in the chlamydial DNA load between GIT and conjunctival sites (R = 0.24, P = 0.19 and 95%CI (-11.75, 53.53)) (Table 4).
Table 4

Concurrent C. pecorum detection between conjunctival and rectal sites.

Ocular
Male RectalNegativePositive
OcularNegative52
RectalNegativePositivePositive35
Negative118
Positive311Ocular
Correlationr = 0.24 P = 0.19Female RectalNegativePositive
95%CI (-11.75, 53.53)Negative66
Positive06
Similarly, the level of co-infection at ocular and UGT sites was modest at 42.4% of koalas (five males and nine females), also with a disparity in the chlamydial DNA load between sites (R = 0.31, P = 0.08 and 95%CI (-3.79, 59.00)) (Table 5).
Table 5

Concurrent C. pecorum detection between ocular and urogenital sites.

Ocular
Male UrogenitalNegativePositive
OcularNegative52
UrogenitalNegativePositivePositive35
Negative115
Positive314Ocular
Correlationr = 0.31 P = <0.08Female UrogenitalNegativePositive
95%CI (-3.79, 59.00)Negative63
Positive09
To determine the infecting C. pecorum genotype at each individual site of infection in the same koala, we amplified and sequenced the variable domain 3–4 of the C. pecorum ompA gene (S1 Fig and S2 Table). Of the 12 positive rectal swabs, 11 were genotype G with one sample unable to be genotyped (Fig 1A). Of the 10 faecal pellets with detectable C. pecorum, seven were genotype G, one was genotype E’, one was genotype A and one sample was unable to be genotyped (Fig 1B). By comparison, of the 15 positive UGT samples, five were genotype A, three were genotype E’, one was genotype G and six samples were unable to be genotyped (Fig 1C). Comparison of C. pecorum genotypes of concurrent (GIT/urogenital) infections showed that female koalas only had mixed genotypes between sites, with GIT genotype G and UGT genotypes A and E’ identified (Fig 2A). Conversely, males had both mixed and identical genotypes between sites with GIT genotypes G, A and E’ and UGT genotypes G, A and E’ identified (Fig 2B).
Fig 1

ompA genotyping of A) Shows only mixed infections between the rectal and UGT sites occurring in female koalas, indicating only sexual transmission of C. pecorum B) Shows both mixed and identical genotypes infecting the rectal and urogenital sites of male koalas, indicating both sexual and faecal/genital transmission of C. pecorum. C) Overall prevalence of concurrent infections in all koalas.

Fig 2

ompA genotyping of , A) Shows only mixed infections between the rectal and UGT sites occurring in female koalas, indicating only sexual transmission of C. pecorum B) Shows both mixed and identical genotypes infecting the rectal and urogenital sites of male koalas, indicating both sexual and faecal/genital transmission of C. pecorum.

ompA genotyping of A) Shows only mixed infections between the rectal and UGT sites occurring in female koalas, indicating only sexual transmission of C. pecorum B) Shows both mixed and identical genotypes infecting the rectal and urogenital sites of male koalas, indicating both sexual and faecal/genital transmission of C. pecorum. C) Overall prevalence of concurrent infections in all koalas. ompA genotyping of , A) Shows only mixed infections between the rectal and UGT sites occurring in female koalas, indicating only sexual transmission of C. pecorum B) Shows both mixed and identical genotypes infecting the rectal and urogenital sites of male koalas, indicating both sexual and faecal/genital transmission of C. pecorum. The presence of C. pecorum plasmid carriage was investigated by PCR to identify any associations between genotype site dominance and increased virulence. Analysis of C. pecorum positivity, plasmid positivity and koala UGT health status revealed two clusters of samples on a scatter plot (Fig 3). The first cluster (Fig 3A) was a cluster of high plasmid qPCR load (log10 > 2) with 66% (10/15 samples) of the samples from koalas with signs of UGT disease. The second cluster (Fig 3B) consisted of below detectable limits of plasmid (detected by qPCR) samples, consisting of 90% (19/21 samples) outwardly healthy koalas. There were no discernible differences between outwardly healthy koalas and koalas with signs of UGT disease when compared to C. pecorum load (detected by qPCR), with a DNA load range in each cluster of log10 between three and seven (with one outlier log10 > 8). There was also a low correlation between plasmid positivity and C. pecorum infected animals at any site, with a prevalence of 47% in the UGT, 36% in the rectum and 40% in faecal pellets (Table 6).
Fig 3

A) Shows a second cluster of increasing plasmid PCR load dominated by koalas with signs of urogenital disease. B) Shows one cluster, indicating plasmid negative C. pecorum strains dominated by healthy koalas.

Table 6

Prevalence of C. pecorum plasmid positive strains.

Overall plasmid positive (%)16SrRNA and plasmid positive (%)
Urogenital8 (24.2)7 (46.6)
Rectal5 (16.1)4 (36.4)
Faecal pellet6 (18.2)4 (40.0)
A) Shows a second cluster of increasing plasmid PCR load dominated by koalas with signs of urogenital disease. B) Shows one cluster, indicating plasmid negative C. pecorum strains dominated by healthy koalas. Identification and quantification of the C. pecorum plasmid revealed that the identified rectal dominant C. pecorum genotype G is not associated with plasmid positivity, with only 18% of rectal positive samples being positive for the plasmid.

Discussion

This study aimed to identify the prevalence of GIT Chlamydia pecorum infections in South East Queensland koalas and identify any relationships between infections at Chlamydia shedding sites through genotype analysis and plasmid positivity. The data presented indicates that C. pecorum is present within the GIT in 42% of the koalas sampled. Furthermore, GIT positivity was detected in 14/17 koalas with concurrent UGT Chlamydia. We found no association however, between conjunctival and GIT infections. Genotyping (ompA) results suggest genotype G is dominant within the GIT and that this dominance is not dependent on plasmid positivity. We also identified an association between plasmid positivity and UGT disease progression. The high rate (82% of positive animals) of concurrent GIT and UGT chlamydial infections (as detected by qPCR) and relatively few UGT only infections (three female koalas) has been identified in other hosts and briefly koalas. Previous studies have reported that chlamydial species such as C. muridarum (in vivo lab studies), C. gallinacea, C. suis and recently C. trachomatis, can all colonise the GIT in mice, poultry, pigs and humans respectively [11-14]. Over the past 10 years four studies investigated C. pecorum colonisation at the GIT of both lambs and cattle [16, 17, 19, 20]. In addition, there have been four studies investigating koala GIT colonisation by C. pecorum which identified Chlamydiaceae DNA within mucosal tissues of the GIT and reported that C. pecorum can be detected from koala faecal pellets but not hind gut faecal material [25, 27–29]. Matching of genotypes between GIT and UGT sites showed that only two koalas had the same genotype at both sites (G/G and mixed/E’ (mixed = G/E’)) (Fig 2B). This suggests that perhaps genetically distinct strains have distinct tissue tropisms in the koala. While genotype G was the dominant genotype in the GIT, genotypes A and E’ were the dominant types at the UGT site. C. pecorum tissue tropisms have previously been identified in livestock, with C. pecorum multi locus sequence types 62, 63, 71, 78, 79, 80, 81 and 83 dominating the rectum and sequence types 23, 69, 72 and 82 dominating the conjunctiva in Australian sheep [19]. Tissue tropic strains of Chlamydia have previously been reported in humans with C. trachomatis ompA genotypes A to C dominating the ocular site and strains D to K dominating the genital site [4, 39].We used partial ompA gene to genotype our strains, and while this gene has been used extensively for C. pecorum genotyping in the past, [35, 36, 40, 41] it is unlikely that the major outer membrane protein is solely responsible for any tissue tropism. Recent reports, for example, indicate that C. trachomatis genotype G is rectal tropic due to three polymorphisms contained within the ORFs encoding for two Pmp proteins (CT144, CT154 and CT326)[42]. Previous studies have shown that not all strains of C. pecorum carry the plasmid and that the presence of the plasmid might correlate with virulence [34, 43]. We were able to identify 19 plasmid positive C. pecorum isolates in this study. Overall 20% of the samples contained a plasmid bearing C. pecorum, with a similar distribution between sampled sites (UGT 24%, rectal 16% and faecal pellet 18%). A strong association between UGT disease and plasmid positivity was identified, with 100% of koalas with UGT disease infected with plasmid positive chlamydial strains (Fig 3A). Furthermore, it was observed that a high plasmid load was associated with UGT disease. Studies in mouse models with C. muridarum have also identified this association, reporting that only plasmid positive C. muridarum strains were able to ascend the UGT and cause disease [32]. However, our results are based on only four koalas and further identification of plasmid positive strains from koalas with current UGT disease is needed to confirm these findings. The correlation results in our study show that there is a significant probability that a koala with UGT C. pecorum will also have GIT C. pecorum, although with variation in infecting genotype. Further analysis of these results showed that 22% of males had an identical Chlamydia genotype at both the GIT and UGT sites, indicating that direct faecal genital contamination may be present in males, presumably associated with the anatomical positioning of the retracted penis. By comparison, in female koalas, there were no identified concurrent matching genotypes at the GIT and UGT sites. Furthermore, only females were identified with isolated UGT infections, further indicating the male anatomy is a source for faecal genital contamination. Limitations to this study were the use of C. pecorum 16S rRNA targets, which have recently been identified as misidentifying non C. pecorum DNA targets [44]. However, by confirming all 16S rRNA samples using ompA as a secondary target we overcame the lowered specificity of this target.

Conclusions

We found that genotypes dominant in rectal swabs and faecal pellets were often different from those recovered from UGT swabs in the same koala providing evidence for GIT infection, as opposed to contamination of rectal swabs by UGT shedding. This finding has clinical implications for the monitoring of healthy koalas for the presence of Chlamydia infections and also has implications for vaccine research, with the need to monitor vaccine effectiveness at all sites of infection, including the GIT, UGT and conjunctival sites. Although our finding are preliminary, the presence of plasmid-bearing C. pecorum strains in the UGT correlates with urogenital disease, suggesting that this could be a critical risk factor in the development of UGT disease.

C. pecorum real time PCR quantified results and ompA (VD3/4) genotype at each anatomical site.

(XLSX) Click here for additional data file.

Maximum Parsimony analysis of taxa for all 29 ompA genotypes identified.

(TIF) Click here for additional data file.

C. pecorum ompA (VD3/4) genotype sequences.

(XLS) Click here for additional data file.
  39 in total

1.  What proportion of episodes of gonorrhoea and chlamydia becomes symptomatic?

Authors:  Eline L Korenromp; Mondastri K Sudaryo; Sake J de Vlas; Ronald H Gray; Nelson K Sewankambo; David Serwadda; Maria J Wawer; J Dik F Habbema
Journal:  Int J STD AIDS       Date:  2002-02       Impact factor: 1.359

2.  Longitudinal prevalence and faecal shedding of Chlamydia pecorum in sheep.

Authors:  Rongchang Yang; Caroline Jacobson; Graham Gardner; Ian Carmichael; Angus J D Campbell; Una Ryan
Journal:  Vet J       Date:  2014-05-29       Impact factor: 2.688

3.  Genetic diversity of Chlamydia pecorum strains in wild koala locations across Australia and the implications for a recombinant C. pecorum major outer membrane protein based vaccine.

Authors:  Avinash Kollipara; Adam Polkinghorne; Charles Wan; Pride Kanyoka; Jon Hanger; Joanne Loader; John Callaghan; Alicia Bell; William Ellis; Sean Fitzgibbon; Alistar Melzer; Kenneth Beagley; Peter Timms
Journal:  Vet Microbiol       Date:  2013-08-18       Impact factor: 3.293

Review 4.  Chlamydiaceae in cattle: commensals, trigger organisms, or pathogens?

Authors:  Petra Reinhold; Konrad Sachse; Bernhard Kaltenboeck
Journal:  Vet J       Date:  2010-10-25       Impact factor: 2.688

5.  Chlamydia pecorum is the endemic intestinal species in cattle while C. gallinacea, C. psittaci and C. pneumoniae associate with sporadic systemic infection.

Authors:  Jing Li; Weina Guo; Bernhard Kaltenboeck; Konrad Sachse; Yi Yang; Guangwu Lu; Jilei Zhang; Lu Luan; Jinfeng You; Ke Huang; Haixiang Qiu; Yaoyao Wang; Min Li; Zhangping Yang; Chengming Wang
Journal:  Vet Microbiol       Date:  2016-08-13       Impact factor: 3.293

6.  Impact of latent infections with Chlamydophila species in young cattle.

Authors:  Petra Reinhold; Julia Jaeger; Elisabeth Liebler-Tenorio; Angela Berndt; Ruediger Bachmann; Evelyn Schubert; Falk Melzer; Mandy Elschner; Konrad Sachse
Journal:  Vet J       Date:  2007-02-21       Impact factor: 2.688

7.  The Chlamydia trachomatis plasmid is a transcriptional regulator of chromosomal genes and a virulence factor.

Authors:  John H Carlson; William M Whitmire; Deborah D Crane; Luke Wicke; Kimmo Virtaneva; Daniel E Sturdevant; John J Kupko; Stephen F Porcella; Neysha Martinez-Orengo; Robert A Heinzen; Laszlo Kari; Harlan D Caldwell
Journal:  Infect Immun       Date:  2008-03-17       Impact factor: 3.441

8.  Equine chlamydiosis-An emerging infectious disease requiring a one health surveillance approach.

Authors:  K A Taylor; D Durrheim; J Heller; B O'Rourke; K Hope; T Merritt; P Freeman; C Chicken; J Carrick; J Branley; P Massey
Journal:  Zoonoses Public Health       Date:  2017-10-05       Impact factor: 2.702

9.  Development and evaluation of rapid novel isothermal amplification assays for important veterinary pathogens: Chlamydia psittaci and Chlamydia pecorum.

Authors:  Martina Jelocnik; Md Mominul Islam; Danielle Madden; Cheryl Jenkins; James Branley; Scott Carver; Adam Polkinghorne
Journal:  PeerJ       Date:  2017-09-08       Impact factor: 2.984

10.  The cryptic plasmid is more important for Chlamydia muridarum to colonize the mouse gastrointestinal tract than to infect the genital tract.

Authors:  Lili Shao; Jose Melero; Nu Zhang; Bernard Arulanandam; Joel Baseman; Quanzhong Liu; Guangming Zhong
Journal:  PLoS One       Date:  2017-05-25       Impact factor: 3.240

View more
  6 in total

1.  Antibiotic treatment of Chlamydia-induced cystitis in the koala is linked to expression of key inflammatory genes in reactive oxygen pathways.

Authors:  Samuel Phillips; Bonnie L Quigley; Ammar Aziz; Wendy Bergen; Rosemary Booth; Michael Pyne; Peter Timms
Journal:  PLoS One       Date:  2019-08-15       Impact factor: 3.240

Review 2.  Chlamydiae from Down Under: The Curious Cases of Chlamydial Infections in Australia.

Authors:  Martina Jelocnik
Journal:  Microorganisms       Date:  2019-11-22

3.  A targeted approach to investigating immune genes of an iconic Australian marsupial.

Authors:  Luke W Silver; Yuanyuan Cheng; Bonnie L Quigley; Amy Robbins; Peter Timms; Carolyn J Hogg; Katherine Belov
Journal:  Mol Ecol       Date:  2022-05-17       Impact factor: 6.622

Review 4.  Vaccination against the Koala Retrovirus (KoRV): Problems and Strategies.

Authors:  Joachim Denner
Journal:  Animals (Basel)       Date:  2021-12-14       Impact factor: 2.752

5.  Completing the Genome Sequence of Chlamydia pecorum Strains MC/MarsBar and DBDeUG: New Insights into This Enigmatic Koala (Phascolarctos cinereus) Pathogen.

Authors:  Rhys T White; Alistair R Legione; Alyce Taylor-Brown; Cristina M Fernandez; Damien P Higgins; Peter Timms; Martina Jelocnik
Journal:  Pathogens       Date:  2021-11-25

6.  Koala immunogenetics and chlamydial strain type are more directly involved in chlamydial disease progression in koalas from two south east Queensland koala populations than koala retrovirus subtypes.

Authors:  Amy Robbins; Jonathan Hanger; Martina Jelocnik; Bonnie L Quigley; Peter Timms
Journal:  Sci Rep       Date:  2020-09-14       Impact factor: 4.996

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.