Literature DB >> 30378291

The functional consequences of sodium channel NaV 1.8 in human left ventricular hypertrophy.

Shakil Ahmad1,2, Petros Tirilomis2, Steffen Pabel1, Nataliya Dybkova2, Nico Hartmann2, Cristina E Molina3, Theodoros Tirilomis4, Ingo Kutschka4, Norbert Frey5, Lars S Maier1, Gerd Hasenfuss2, Katrin Streckfuss-Bömeke2, Samuel Sossalla1,2.   

Abstract

AIMS: In hypertrophy and heart failure, the proarrhythmic persistent Na+ current (INaL ) is enhanced. We aimed to investigate the electrophysiological role of neuronal sodium channel NaV 1.8 in human hypertrophied myocardium. METHODS AND
RESULTS: Myocardial tissue of 24 patients suffering from symptomatic severe aortic stenosis and concomitant significant afterload-induced hypertrophy with preserved ejection fraction was used and compared with 12 healthy controls. We performed quantitative real-time PCR and western blot and detected a significant up-regulation of NaV 1.8 mRNA (2.34-fold) and protein expression (1.96-fold) in human hypertrophied myocardium compared with healthy hearts. Interestingly, NaV 1.5 protein expression was significantly reduced in parallel (0.60-fold). Using whole-cell patch-clamp technique, we found that the prominent INaL was significantly reduced after addition of novel NaV 1.8-specific blockers either A-803467 (30 nM) or PF-01247324 (1 μM) in human hypertrophic cardiomyocytes. This clearly demonstrates the relevant contribution of NaV 1.8 to this proarrhythmic current. We observed a significant action potential duration shortening and performed confocal microscopy, demonstrating a 50% decrease in proarrhythmic diastolic sarcoplasmic reticulum (SR)-Ca2+ leak and SR-Ca2+ spark frequency after exposure to both NaV 1.8 inhibitors.
CONCLUSIONS: We show for the first time that the neuronal sodium channel NaV 1.8 is up-regulated on mRNA and protein level in the human hypertrophied myocardium. Furthermore, inhibition of NaV 1.8 reduced augmented INaL , abbreviated the action potential duration, and decreased the SR-Ca2+ leak. The findings of our study suggest that NaV 1.8 could be a promising antiarrhythmic therapeutic target and merits further investigation.
© 2018 The Authors. ESC Heart Failure published by John Wiley & Sons Ltd on behalf of the European Society of Cardiology.

Entities:  

Keywords:  Arrhythmias; Calcium; HFpEF; Late sodium current; Left ventricular hypertrophy; SR-Ca2+ leak; Sodium channels

Mesh:

Substances:

Year:  2018        PMID: 30378291      PMCID: PMC6352890          DOI: 10.1002/ehf2.12378

Source DB:  PubMed          Journal:  ESC Heart Fail        ISSN: 2055-5822


Introduction

Left ventricular remodelling caused by pressure overload can lead to myocardial hypertrophy. Left ventricular hypertrophy (LVH) is an adaptive response to increased chronic workload and a very common clinical finding.1, 2 It has been reported that LVH can potentially increase the incidents of congestive heart failure (HF) and sudden cardiac death.3, 4 Furthermore, it has been shown that structural modifications due to LVH are associated with HF with preserved ejection fraction (HFpEF).5 LVH is also associated with an increased prevalence of cardiac arrhythmias and constitutes an important risk factor for cardiac morbidity and mortality.6, 7, 8, 9 The pathology of LVH shows not only mechanical but also extensive cellular and molecular remodelling including cardiomyocyte growth changes, dysfunction of excitation–contraction coupling, certain metabolic dysfunctions, and fibrosis.10, 11 Patients with severe aortic stenosis‐dependent symptoms have a tremendous risk of sudden cardiac death if only medically treated.12 In the past few decades, a great progress has been made in underpinning the cellular and molecular mechanisms of remodelling in myocardial hypertrophy. However, the involvement of voltage‐gated sodium channel (NaV) isoforms in HFpEF and/or myocardial hypertrophy with preserved ejection fraction leading to cardiac arrhythmias has not been elucidated comprehensively. Besides the peak sodium current causing the action potential (AP) upstroke, a small persistent sodium current is existing, also known as late sodium current (INaL).13 In case of cardiac pathology, some INaL producing NaV channels reopen or remain active throughout the whole AP. The amplitude of INaL is smaller when compared with peak sodium current but eventually with a larger Na integral due to longer persistence during the course of the AP plateau.14 INaL has been reported to be enhanced in different clinically relevant cardiac pathologies like hypoxia, ischaemia, and HF.15, 16, 17 In severe myocardial hypertrophy, INaL is also enhanced18 and may cause intracellular Na+ overload and prolongation of the action potential duration (APD).19 Consequently, the resulting Na+ accumulation may lead to intracellular Ca2+ overload because of reduced efflux and increased influx of Ca2+ through Na+/Ca2+ exchanger.20, 21 The voltage‐gated sodium channel 1.5 (NaV1.5) is considered the predominant cardiac NaV isoform in the heart. In the past few years, different reports suggested the existence of other non‐cardiac sodium channels including NaV1.8 (SCN10A) in the heart, which like NaV1.5 is tetrodotoxin resistant. In addition, genetic variants of SCN10A have been recently shown to influence cardiac conduction.22, 23 Further evidence about NaV1.8 in cardiac conduction comes from genome‐wide association studies reporting that NaV1.8 could modulate cardiac conduction by effecting PR and QRS intervals.23 However, the expression of NaV1.8 in cardiac tissue and its direct involvement in human cardiac arrhythmias is still poorly understood. In the current study, we investigated the presence and the functional role of NaV1.8 in cardiac hypertrophy with preserved contractility derived exclusively from patients suffering from severe aortic stenosis. To study the role of NaV1.8 channel in the electrophysiological context of human LVH, we used two different NaV1.8 blockers, which are described to be very specific for NaV1.8 (A‐803467 and PF‐01247324). The blocker A‐803467 is over 100‐fold more selective for the NaV1.8 channel vs. other human NaV channels.24 Similarly, the drugPF‐01247324 is a highly specific inhibitor of NaV1.8 over other NaV channels, even when used at very high concentration.25

Materials and methods

Human myocardial tissue

All procedures were conducted in compliance with the local ethics committee. The study conforms to the World Medical Association declaration of Helsinki. Written informed consent was received from all patients prior to inclusion. Myocardial tissue of the hypertrophied left ventricle was obtained from patients (n = 24; Table ) with severe aortic valve stenosis and preserved ejection fraction undergoing an open‐heart surgery for aortic valve replacement as a classic myectomy (Morrow resection). For molecular purposes, we utilized healthy left ventricular myocardium (n = 12) from healthy donor hearts that were not transplanted because of technical reasons.
Table 1

Patient characteristics: values in the table represent the mean ± standard error of the mean

Male sex50%
Age66.38 ± 3.66 years
Ejection fraction56.95 ± 1.81%
Dyspnoea85.7%
Interventricular septum15.0 ± 1.7 mm
Aortic valve area0.8 ± 0.1 cm2
Mean AV pressure gradient44 ± 6.4 mm Hg
Diabetes4.3%
ACE‐inhibitors17.4%
β‐Blockers65.2%
Diuretics76.5%
Digoxin0.0%
Amiodarone0.0%
AT1 receptor antagonists26.1%
Aldosterone antagonists0.0%
Statins30.4%
Ca channel blockers26.1%

ACE, angiotensin‐converting enzyme; AT1, angiotensin II receptor–type 1; AV, aortic valve.

Patient characteristics: values in the table represent the mean ± standard error of the mean ACE, angiotensin‐converting enzyme; AT1, angiotensin II receptor–type 1; AV, aortic valve.

Western blots

Myocardial tissue samples from patients with LVH (n = 12) compared with healthy control myocardium were homogenized in Tris buffer (pH 7.4) containing Tris–HCl (20 mM), NaCl (200 mM), NaF (20 mM), Na3VO4 (1 mM), dithiothreitol (1 mM), Triton X‐100 (1%), and complete protease and phosphatase inhibitor cocktails (Roche Diagnostics, Germany). Protein concentration was determined by bicinchoninic acid assay (Pierce Biotechnology, United States). Denatured tissue homogenates (10 min, 70°C in 2% beta‐mercaptoethanol) were separated on 7.5% sodium dodecyl sulfate–polyacrylamide gels, then transferred to a nitrocellulose membrane, and incubated with the following primary antibodies: mouse monoclonal anti‐NaV1.8 (1:1000, LSBio, United States, LS‐C109037), rabbit polyclonal anti‐NaV1.5 (1:2000, Alomone Labs, Israel, ASC‐005), and mouse monoclonal anti‐GAPDH (1:20000, Biotrend, Germany, BTMC‐A473‐9) at 4°C overnight. Secondary antibodies included horseradish peroxidase (HRP)‐conjugated goat anti‐rabbit and goat anti‐mouse (1:10000, Jackson ImmunoResearch, United Kingdom, 111‐035‐144 and 115‐035‐062, respectively). The membrane was incubated with secondary antibodies for 1 h at room temperature. Immobilon™ Western Chemiluminescent HRP Substrate (Millipore, Germany) was used for the chemiluminescent detection.

Quantitative real‐time PCR

Human cardiac tissues were snap‐frozen in liquid nitrogen and stored at −80°C. RNA was isolated by use of the SV Total RNA Isolation System (Promega, Germany). DNA standards were generated by serial dilution in diethyl pyrocarbonate water containing yeast tRNA (30 μL/mL) as co‐precipitant and used at varying concentrations between 0.125 and 100 000 fg/μL to ensure exponential growth of DNA amounts in the standard range. One hundred nanogram of RNA was reverse transcribed into cDNA using standard protocols. For quantitative PCR, 10 μL of SYBR Green PCR Master Mix (Thermo Fisher, Germany), 7 μL of nuclease‐free water, 1 μL of forward and 1 μL of reverse primer, and 1 μL of cDNA were mixed. Quantitative PCR was carried out using the iQ5 Multicolor Real‐time PCR Detection System (Bio‐Rad, United States). Forty cycles of 15 s at 95°C followed by 1 min at 60°C were used, and fluorescence was measured after each cycle. After 40 cycles, melt curve analysis was performed to ensure specificity of the products. Thresholds cycles were evaluated and normalized to housekeeping genes and controls. The following primer sequences (5′‐3′) were used for quantitative real‐time PCR analyses: SCN10A, forward TGGCAGATGACCTGGAAGAACC and reverse CGATACGGTAGCAAGTCTTGCG (Origene, Cat. no. HP209444, NM_006514); and GAPDH, forward GTCTCCTCTGACTTCAACAGCG and reverse ACCACCCTGTTGCTGTAGCCAA.

Myocyte isolation

Left ventricular myocardium was rinsed, cut into small pieces, and incubated at 37°C in a spinner flask filled with Joklik‐MEM (JMEM) solution (PAN‐Biotech, Germany) that contained 1.0 mg/mL collagenase (Worthington type 1, 185 U/mg, CellSystems, France) and 13% trypsin (Life Technologies, United States). After 45 min, the supernatant was discarded, and fresh JMEM solution containing collagenase was added. The solution was incubated for 10 min until myocytes were disaggregated. The supernatant that contained disaggregated cells was removed and centrifuged (700 rpm, 5 min). Fresh JMEM with collagenase was added to the remaining tissue. This procedure was repeated four to five times. After every step, the centrifuged cells were resuspended in JMEM solution that contained bovine calf serum 10%, and pH was adjusted to 7.4 at room temperature. Only cell solutions that contained elongated, not granulated, cardiomyocytes with cross‐striations were selected for experiments, plated on laminin‐coated recording chambers, and left to settle for 30 min.

Whole‐cell patch clamp

I measurements

Ruptured‐patch whole‐cell voltage‐clamp was used to measure INaL in human ventricular cardiomyocytes isolated from hypertrophied hearts with microelectrodes (2–3 MΩ). Pipettes were filled with solution containing CsCl (95 mM), Cs‐glutamate (40 mM), NaCl (10 mM), MgCl2 (0.92 mM), Mg‐ATP (5 mM), Li‐GTP (0.3 mM), HEPES (5 mM), niflumic acid (0.03 mM; to block Ca2+‐activated chloride current), nifedipine (0.02 mM; to block Ca2+ current), strophanthidin (0.004 mM; to block Na+/K+‐ATPase), EGTA (1 mM), and CaCl2 (0.36 mM; free [Ca2+]i, 100 nM), and pH was adjusted to 7.2 with CsOH. The bath solution contained NaCl (135 mM), tetramethylammonium chloride (5 mM), CsCl (4 mM), MgCl2 (2 mM), glucose (10 mM), and HEPES (10 mM), and pH was adjusted to 7.4 with CsOH. To minimize contaminating Ca2+ currents during INaL measurements, Ca2+ was omitted from the bath solution. Access resistance was <7 MΩ. Cardiomyocytes were held at −120 mV, and INaL was elicited using a train of pulses to −35 mV (1000 ms duration, 10 pulses, basic cycle length 2 s). Recordings were initiated 3 min after rupture. The measured INaL at −35 mV was leak subtracted before calculation of the INaL integral (between 100 and 500 ms) and was normalized to membrane capacitance of the measured cell. Cardiomyocytes were treated with either A‐803467 (30 nM) or PF‐01247324 (1 μM) for 10 min and compared with the control untreated cells. Measurements were conducted at a temperature of 37.7°C.

Action potential duration measurements

To record the AP from human ventricular cardiomyocytes, the whole‐cell patch‐clamp technique was used to measure membrane potential (current clamp configuration). Microelectrodes (7–8 MΩ) were filled with solution containing K‐Aspartate (92 mM), KCl (48 mM), Mg‐ATP (1 mM), HEPES (10 mM), EGTA (0.02 mM), GTP‐Tris (0.1 mM), and Na2‐ATP (4 mM), and final pH was adjusted at 7.2 with KOH solution. Bath solution contained NaCl (140 mM), KCl (4 mM), MgCl2 (1 mM), CaCl2 (2 mM), glucose (10 mM), and HEPES (10 mM), and final pH was adjusted to 7.4 with NaOH. Action potentials were continuously elicited by square current pulses of 1–2 nA amplitude and 1–5 ms duration at increasing stimulation frequency (0.5–3 Hz). Access resistance was typically ~5–15 MΩ after patch rupture. Fast capacitance was compensated for in a cell‐attached configuration. Recordings were commenced after cell stabilization, which was ~10 min after rupture. Human cell measurements were conducted at a temperature of 37.7°C. Every cell was patched and measured before and after drug application. In all patch‐clamp experiments, cardiomyocytes were mounted on the stage of a microscope (Nikon T 300). Fast capacitance was compensated in cell‐attached configuration. Membrane capacitance and series resistance were compensated after patch rupture. Signals were filtered with 2.9 and 10 kHz Bessel filters and recorded with an EPC10 amplifier (HEKA Elektronik, Germany). NaV1.8 was inhibited using either A‐803467 (30 nM for 10 min) or PF‐01247324 (1 μM for 5 min). Both drugs were added to the bath solution.

Measurement of Ca2+ sparks

Isolated cardiomyocytes were incubated at room temperature for 30 min with a Fluo‐4 AM loading buffer (10 μM; Molecular Probes, Life Technologies). Experimental solution contained NaCl (136 mM), KCl (4 mM), NaH2PO4 (0.33 mM), NaHCO3 (4 mM), CaCl2 (2 mM), MgCl2 (1.6 mM), HEPES (10 mM), and glucose (10 mM), and final pH was adjusted to 7.4 by addition of NaOH solution at room temperature. NaV1.8 inhibitors A‐803467 (30 nM) and PF‐01247324 (1 μM) were added to their respective groups in the experimental solution. Cells were continuously superfused during experiments. To wash out the loading buffer and to remove any extracellular dye (as well as to provide enough time for complete de‐esterification of Fluo‐4 AM), cells were superfused with experimental solution for 5 min before the experiments were begun. Ca2+ spark measurements were performed with a laser scanning confocal microscope (LSM 5 Pascal, Zeiss, Germany) using a ×40 oil‐immersion objective. Fluo‐4 was excited by an argon ion laser (488 nm), and emitted fluorescence was collected through a 505 nm long‐pass mission filter. Fluorescence images were recorded in the line scan mode with 512 pixels per line (width of each scan line: 38.4 μm) and a pixel time of 0.64 μs. One image consists of 10 000 unidirectional line scans, which equates to a measurement period of 7.68 s. Experiments were conducted at resting conditions after the sarcoplasmic reticulum (SR) was loaded with Ca2+ by repetitive field stimulation (10 pulses at 1 Hz, 20 V). Ca2+ sparks were analysed with the program SparkMaster for ImageJ. The mean spark frequency of the respective cell resulted from the number of sparks normalized to cell width and scan rate (100 μm−1 s−1).

Results

Regulation of Na1.5 and Na1.8 in human left ventricular hypertrophy

To investigate the regulation of NaV1.8 and NaV1.5 protein expression in human LVH compared with healthy control ventricular myocardium tissue homogenates, western blots were performed. We found a significant up‐regulation of NaV1.8 protein expression (1.96‐ ± 0.31‐fold) in LVH compared with healthy control ventricular myocardium (Figure B). In contrast, the expression of NaV1.5 protein was significantly decreased (0.60‐ ± 0.10‐fold) compared with Non‐failing (NF) (Figure B). In accordance to our findings of NaV1.8 expression at the protein level, we recorded a significant up‐regulation of NaV1.8 mRNA levels in LVH (2.34‐ ± 0.64‐fold, n = 5) compared with NF (n = 10) by quantitative PCR. The mRNA expression of NaV1.8 is shown as relative expression to the housekeeping gene GAPDH (Figure C).
Figure 1

Regulation of NaV1.8 and NaV1.5 expression in hypertrophy. (A) Western blots were performed utilizing left ventricular human tissue homogenates. (B) Densitometry data of NaV1.8 and NaV1.5 show a significant up‐regulation of NaV1.8 and down‐regulation of NaV1.5. GAPDH was used as an internal loading control in all blots [NF: n = 12; and left ventricular hypertrophy (LVH): n = 12]. (C) Real‐time quantitative PCR showing the relative mRNA expression of NaV1.8/GAPDH in left ventricle of human NF (n = 10) and LVH (n = 5). *P ≤ 0.05 and **P ≤ 0.01 vs. NF. Student's t‐test. Data shown as mean ± standard error of the mean and individual values.

Regulation of NaV1.8 and NaV1.5 expression in hypertrophy. (A) Western blots were performed utilizing left ventricular human tissue homogenates. (B) Densitometry data of NaV1.8 and NaV1.5 show a significant up‐regulation of NaV1.8 and down‐regulation of NaV1.5. GAPDH was used as an internal loading control in all blots [NF: n = 12; and left ventricular hypertrophy (LVH): n = 12]. (C) Real‐time quantitative PCR showing the relative mRNA expression of NaV1.8/GAPDH in left ventricle of human NF (n = 10) and LVH (n = 5). *P ≤ 0.05 and **P ≤ 0.01 vs. NF. Student's t‐test. Data shown as mean ± standard error of the mean and individual values.

Na1.8 contributes to I and action potential duration in human hypertrophy

Given the increased expression of NaV1.8 in human LVH, we investigated the potential contribution to the augmentation of INaL and APD prolongation under hypertrophic condition. We adopted the approach using novel‐specific blockers of NaV1.8 channel A‐803467 and PF‐01247324 to inhibit the activity of this channel in human LVH cardiomyocytes for recording INaL and APDs by patch clamp. Cardiomyocytes were superfused with either A‐803467 or PF‐01247324. Our data show a significant reduction in INaL (Figure ) and also shortening of APD90 (Figure ) when cardiomyocytes were exposed to NaV1.8 inhibitors compared with the control group. Furthermore, both NaV1.8 inhibitors do not exert any effect on the upstroke velocity and amplitude of the AP (Figure A and B). Therefore, it can be concluded that NaV1.8 contributes to INaL in terms of a positive net inward current to APD prolongation in human hypertrophy.
Figure 2

(A) Original traces and (B) data showing individual and mean values ± standard error of the mean of INaL in human ventricular cardiomyocytes isolated from left ventricular hypertrophy patients (control: n = 8 cells; A‐803467: n = 7 cells; PF‐01247324: n = 7 cells). *P ≤ 0.05. One‐way analysis of variance and Bonferroni's post‐test.

Figure 3

(A) Original action potential recording (0.5 Hz) and (B) data showing individual and mean values ± standard error of the mean of APD90 in left ventricular cardiomyocytes from patients with left ventricular hypertrophy. A‐803467 or PF‐01247324 paced at 0.5 and 1 Hz (n = 5 cells and n = 4 cells, respectively; *P ≤ 0.05 vs. control). Two‐way repeated measures analysis of variance and Bonferroni's post‐test. All the action potential duration (APD) measurements were performed pairwise by wash‐in.

Figure 4

(A) Individual and mean values ± standard error of the mean showing upstroke velocity of action potential in control and drug groups from left ventricular hypertrophy cardiomyocytes. (B) Data showing individual and mean values ± standard error of the mean of action potential amplitude (APA) measurements from isolated human left ventricular hypertrophy cardiomyocytes. (C) Graph shows the resting membrane potential (RMP) of cardiomyocytes measured under control condition and drug treatments (PF‐01247324: n = 5 cells; and A‐804367: n = 4 cells). All measurements were performed pairwise by wash‐in. Paired Student's t‐test was performed.

(A) Original traces and (B) data showing individual and mean values ± standard error of the mean of INaL in human ventricular cardiomyocytes isolated from left ventricular hypertrophy patients (control: n = 8 cells; A‐803467: n = 7 cells; PF‐01247324: n = 7 cells). *P ≤ 0.05. One‐way analysis of variance and Bonferroni's post‐test. (A) Original action potential recording (0.5 Hz) and (B) data showing individual and mean values ± standard error of the mean of APD90 in left ventricular cardiomyocytes from patients with left ventricular hypertrophy. A‐803467 or PF‐01247324 paced at 0.5 and 1 Hz (n = 5 cells and n = 4 cells, respectively; *P ≤ 0.05 vs. control). Two‐way repeated measures analysis of variance and Bonferroni's post‐test. All the action potential duration (APD) measurements were performed pairwise by wash‐in. (A) Individual and mean values ± standard error of the mean showing upstroke velocity of action potential in control and drug groups from left ventricular hypertrophy cardiomyocytes. (B) Data showing individual and mean values ± standard error of the mean of action potential amplitude (APA) measurements from isolated human left ventricular hypertrophy cardiomyocytes. (C) Graph shows the resting membrane potential (RMP) of cardiomyocytes measured under control condition and drug treatments (PF‐01247324: n = 5 cells; and A‐804367: n = 4 cells). All measurements were performed pairwise by wash‐in. Paired Student's t‐test was performed.

Contribution of Na1.8 to proarrhythmic SR‐Ca 2+ leak

During pathological conditions such as HF, an enhanced INaL can lead to disturbed SR‐Ca2+ metabolism and hence potentially proarrhythmic SR‐Ca2+ leakiness. This can give rise to delayed after‐depolarizations and thereby arrhythmias. However, the contribution of different NaV isoforms to SR‐Ca2+ leak in human LVH has not been evaluated. Therefore, we measured SR‐Ca2+ leak in isolated cardiomyocytes from human hypertrophied hearts. We detected a high incident of spontaneous diastolic Ca2+ release events in hypertrophied cardiomyocytes in the absence of inhibitors (Figure A). When cardiomyocytes were incubated with NaV1.8 inhibitors either A‐803467 or PF‐01247324, a significant decrease in calcium spark frequency (CaSpF) and SR‐Ca2+ leak was observed compared with control group (Figure B and E). In control cells, CaSpF was 0.68 ± 0.12 μm−1 s−1 (n = 145 cells/12 patients), while in A‐806734‐treated myocytes, CaSpF was reduced to 0.27 ± 0.06 μm−1 s−1 (n = 124 cells/11 patients, P ≤ 0.01) and in PF‐01247324‐treated myocytes to 0.26 ± 0.07 μm−1 s−1 (n = 91 cells/9 patients, P ≤ 0.01), respectively (Figure B). NaV1.8 inhibition with PF‐01247324 also resulted in a significant reduction of the Ca2+ spark duration (Figure C), while no differences were recorded for Ca2+ spark amplitude between control and drug treatment groups (Figure D). These data clearly demonstrate the important role of the NaV1.8 channel in SR‐Ca2+ leak regulation in hypertrophy. Taken together, proarrhythmic SR‐Ca2+ release can significantly be decreased by targeting NaV1.8 with specific inhibitors.
Figure 5

(A) Representative line scan images and (B) calcium spark frequency (CaSpF) in left ventricular cardiomyocytes from patients with left ventricular hypertrophy under control condition and NaV1.8 inhibition. Pre‐incubation with either A‐803467 or PF‐01247324 resulted in a significant decrease of CaSpF in hypertrophy compared with control. (C) Mean values of spark duration and (D) spark amplitude of cardiomyocytes. (E) Calculated full SR‐Ca2+ leak in left ventricular cardiomyocytes from left ventricular hypertrophy patients (control: n = 145; A‐803467: n = 124 cells; PF‐01247324: n = 91 cells). Data shown as mean ± standard error of the mean. One‐way analysis of variance and Bonferroni's post‐test. *P ≤ 0.05, **P ≤ 0.01.

(A) Representative line scan images and (B) calcium spark frequency (CaSpF) in left ventricular cardiomyocytes from patients with left ventricular hypertrophy under control condition and NaV1.8 inhibition. Pre‐incubation with either A‐803467 or PF‐01247324 resulted in a significant decrease of CaSpF in hypertrophy compared with control. (C) Mean values of spark duration and (D) spark amplitude of cardiomyocytes. (E) Calculated full SR‐Ca2+ leak in left ventricular cardiomyocytes from left ventricular hypertrophy patients (control: n = 145; A‐803467: n = 124 cells; PF‐01247324: n = 91 cells). Data shown as mean ± standard error of the mean. One‐way analysis of variance and Bonferroni's post‐test. *P ≤ 0.05, **P ≤ 0.01.

Discussion

LVH is a common clinical finding in daily practice caused, besides some other reason, by hypertension and aortic valve stenosis. At the early stages, myocardial hypertrophy serves as a compensatory mechanism, which can lead to systolic HF at later stages.26 Importantly, patients with symptomatic aortic stenosis have a tremendous risk of sudden cardiac death if only medically treated.12 In the past few decades, a great progress has been made in underpinning the cellular and molecular mechanisms of remodelling during hypertrophy. However, the mechanistic links between dysregulated proteins and in particular arrhythmogenesis, especially in human hypertrophy, still remain elusive. We herein investigated the regulation of neuronal sodium channel NaV1.8 and its role in pathophysiology of human significant hypertrophy. We demonstrate that NaV1.8 expression is up‐regulated during LVH with preserved ejection fraction compared with healthy left ventricles, while NaV1.5 expression is down‐regulated in parallel. To the best of our knowledge, this is the first report of such an ion channel switch in human hypertrophy. Furthermore, inhibition of NaV1.8 by specific blockers causes a significant reduction of the enhanced INaL and consequently leads to abbreviated APDs in LVH. Moreover, we observed a significant decrease of the proarrhythmic SR‐Ca2+ leak by inhibition of NaV1.8 in human hypertrophied cardiomyocytes. Therefore, inhibition of NaV1.8 modulates well‐accepted proarrhythmogenic triggers such as INaL, APD prolongation, and diastolic SR‐Ca2+ leak. In the current study, we found increased expression of NaV1.8 at both mRNA and protein level in human LVH with preserved contractility when compared with NF. Transcripts of many non‐cardiac NaV channels (NaV1.1, NaV1.3, NaV1.2, and NaV1.6) including NaV1.8 were detected in mouse and dog heart, while there was no previous evidence of NaV1.8 expression in the human ventricle during LVH.27, 28 Moreover, there have been conflicting reports about the involvement of these non‐cardiac NaV isoforms in INaL enhancement in animal models due to species‐specific expression. We already reported that the protein expression of other non‐cardiac NaV channels (NaV1.1 and NaV1.6) was down‐regulated while NaV1.5 was increased showing no significant INaL enhancement in a transverse aortic constriction mouse model of compensated hypertrophy.17 Similar findings were reported in a dog and rat HF model where NaV1.5 protein expression was found to be down‐regulated, whereas a significant increase in INaL was observed.29, 30 These findings from animal models suggest the involvement of other non‐cardiac sodium channels in INaL augmentation and arrhythmogenesis under hypertrophy and HF conditions. However, animal models represent a very artificial variability in hypertrophy, which cannot be compared directly with human hypertrophy with severe aortic stenosis. Moreover, these animal‐derived findings cannot be directly translated into the human because of severe differences in cellular electrophysiology. Therefore, the translational data of our current study add novel knowledge on INaL regulation in hypertrophy and show for the first time that INaL augmentation is also caused by over‐expression of NaV1.8 in human hypertrophy. Electrophysiological recordings also described that non‐cardiac NaV channels contribute to INaL up to 44% in canine ventricular cardiomyocytes under normal physiological conditions31 and NaV1.8 was suggested to be a major contributor of INaL in healthy mouse ventricular cardiomyocytes.32 However, NaV1.8 was not investigated before in animal models with present heart disease, for example, hypertrophy. It was shown previously by us and other groups that increased INaL is implicated as potential contributor to proarrhythmogenic triggers and thereby to the occurrence of arrhythmias.33, 34, 35 During different pathological conditions associated with heart diseases, over‐expression of these non‐cardiac NaV channels was also shown to be responsible for the prolonged cardiac APD.31 The functional properties of NaV1.8 are characterized by a long AP duration with preserved excitability during sustained stimulation in the dorsal root ganglion.36 In accordance with an enhanced INaL, we observed prolongation of APD in ventricular cardiomyocytes of hypertrophy patients. Inhibition of NaV1.8 with specific blockers showed a significant abbreviation of APD. Up‐regulated NaV1.8 expression in human hypertrophy may cause increased INaL potentially leading to a pathological prolongation of APD in this disease. This prolonged APD can give rise to early after‐depolarizations, thereby posing increased fatal risk for ventricular arrhythmias.13 The partial inhibition of INaL up to 50% not only restored healthy APD in failing cardiomyocytes but also ceased after‐depolarizations.13 Isolated cardiomyocytes from patients with hypertrophic cardiomyopathy showed an augmented INaL with a subsequent increase in intracellular Ca2+ load.18 Enhanced INaL might lead to diastolic Ca2+ overload through the Na+/Ca2+ exchanger operation in reverse mode.37 An increase in diastolic Ca2+ not only results in impaired relaxation but also plays a key role in activating pro‐hypertrophic signalling pathways, leading to increased stiffness of the left ventricle.38, 39 These data suggest that INaL is not only the consequence of hypertrophy but is also involved in inducing diastolic intracellular Ca2+ overload. The resulting Ca2+ load is thought to trigger intracellular spontaneous Ca2+‐release events, leading to cytosolic Ca2+ oscillations, automaticity, and triggered activity. In addition to animal studies, we have previously demonstrated that inhibition of an enhanced INaL with tetrodotoxin or ranolazine reduces the SR‐Ca2+ leak in human diseased cardiomyocytes.37, 40 In the present study, we extend this evidence to human cardiomyocytes with very significant hypertrophy and HFpEF. The highly specific inhibition of NaV1.8 potently suppressed the diastolic SR‐Ca2+ leak in ventricular cardiomyocytes of patients with severe LV hypertrophy. Taken together, the data of our present study define a significant contribution of NaV1.8 in the initiation of proarrhythmic triggers via INaL‐induced SR‐Ca2+ leak and also APD prolongation. The differences between the activation of NaV1.5 and NaV1.8 suggest that the selective inhibition of NaV1.8‐mediated INaL can be antiarrhythmic. Patients with severe aortic stenosis and concomitant LV hypertrophy including HFpEF are at high risk of sudden cardiac death, and one of the probable causes is lethal arrhythmias. Our current study provides better understanding of electrophysiological disturbances that occur in human severe hypertrophy. We identified a potential new ion channel target (NaV1.8) and provide a respective possible pharmacological antiarrhythmic approach. Therefore, these findings provide basic evidence for in vivo studies.

Conflict of interest

None declared.

Funding

S.A. and S.S. are funded by the Marga und Walter Boll‐Stiftung through a research grant (project no. 220‐12.1‐15). K.S.‐B. is funded by the Bundesministerium für Bildung und Forschung (BMBF) grant e:Bio—Modul II—Verbundprojekt: CaRNAtion (031L0075C to K.S.‐B. and G.H.). S.S. and L.S.M. are funded by the ReForM‐Programme of the University Hospital Regensburg. N.D. and G.H. are funded by the Deutsche Forschungsgemeinschaft (DFG, SFB 1002).
  41 in total

Review 1.  Regression of left ventricular hypertrophy; what are appropriate therapeutic objectives?

Authors:  D J Sheridan; M P Kingsbury; N A Flores
Journal:  Br J Clin Pharmacol       Date:  1999-02       Impact factor: 4.335

2.  Post-transcriptional alterations in the expression of cardiac Na+ channel subunits in chronic heart failure.

Authors:  Stephen Zicha; Victor A Maltsev; Stanley Nattel; Hani N Sabbah; Albertas I Undrovinas
Journal:  J Mol Cell Cardiol       Date:  2004-07       Impact factor: 5.000

3.  Expression pattern of neuronal and skeletal muscle voltage-gated Na+ channels in the developing mouse heart.

Authors:  Volker Haufe; Juan A Camacho; Robert Dumaine; Bernd Günther; Christian Bollensdorff; Gisela Segond von Banchet; Klaus Benndorf; Thomas Zimmer
Journal:  J Physiol       Date:  2005-03-03       Impact factor: 5.182

4.  Hypoxia increases persistent sodium current in rat ventricular myocytes.

Authors:  Y K Ju; D A Saint; P W Gage
Journal:  J Physiol       Date:  1996-12-01       Impact factor: 5.182

Review 5.  Three 4-letter words of hypertension-related cardiac hypertrophy: TRPC, mTOR, and HDAC.

Authors:  Mazen Kurdi; George W Booz
Journal:  J Mol Cell Cardiol       Date:  2011-02-19       Impact factor: 5.000

6.  Ranolazine improves diastolic dysfunction in isolated myocardium from failing human hearts--role of late sodium current and intracellular ion accumulation.

Authors:  Samuel Sossalla; Stefan Wagner; Eva C L Rasenack; Hanna Ruff; Sarah L Weber; Friedrich A Schöndube; Theodor Tirilomis; Gero Tenderich; Gerd Hasenfuss; Luiz Belardinelli; Lars S Maier
Journal:  J Mol Cell Cardiol       Date:  2008-03-14       Impact factor: 5.000

7.  Genetic variation in SCN10A influences cardiac conduction.

Authors:  John C Chambers; Jing Zhao; Cesare M N Terracciano; Connie R Bezzina; Weihua Zhang; Riyaz Kaba; Manoraj Navaratnarajah; Amol Lotlikar; Joban S Sehmi; Manraj K Kooner; Guohong Deng; Urszula Siedlecka; Saurabh Parasramka; Ismail El-Hamamsy; Mark N Wass; Lukas R C Dekker; Jonas S S G de Jong; Michael J E Sternberg; William McKenna; Nicholas J Severs; Ranil de Silva; Arthur A M Wilde; Praveen Anand; Magdi Yacoub; James Scott; Paul Elliott; John N Wood; Jaspal S Kooner
Journal:  Nat Genet       Date:  2010-01-10       Impact factor: 38.330

8.  Molecular pathways underlying cardiac remodeling during pathophysiological stimulation.

Authors:  Izhak Kehat; Jeffery D Molkentin
Journal:  Circulation       Date:  2010-12-21       Impact factor: 29.690

9.  Late INa increases diastolic SR-Ca2+-leak in atrial myocardium by activating PKA and CaMKII.

Authors:  Thomas H Fischer; Jonas Herting; Fleur E Mason; Nico Hartmann; Saera Watanabe; Viacheslav O Nikolaev; Julia U Sprenger; Peidong Fan; Lina Yao; Aron-Frederik Popov; Bernhard C Danner; Friedrich Schöndube; Luiz Belardinelli; Gerd Hasenfuss; Lars S Maier; Samuel Sossalla
Journal:  Cardiovasc Res       Date:  2015-05-18       Impact factor: 10.787

10.  Autonomic regulation therapy to enhance myocardial function in heart failure patients: the ANTHEM-HFpEF study.

Authors:  Lorenzo A DiCarlo; Imad Libbus; H Uday Kumar; Sanjay Mittal; Rajendra K Premchand; Badri Amurthur; Bruce H KenKnight; Jeffrey L Ardell; Inder S Anand
Journal:  ESC Heart Fail       Date:  2017-12-28
View more
  10 in total

1.  Rotors anchored by refractory islands drive torsades de pointes in an experimental model of electrical storm.

Authors:  Masatoshi Yamazaki; Naoki Tomii; Koichi Tsuneyama; Hiroki Takanari; Ryoko Niwa; Haruo Honjo; Itsuo Kodama; Tatsuhiko Arafune; Naomasa Makita; Ichiro Sakuma; Dobromir Dobrev; Stanley Nattel; Yukiomi Tsuji
Journal:  Heart Rhythm       Date:  2021-10-20       Impact factor: 6.343

2.  Mexiletine-like cellular electrophysiological effects of GS967 in canine ventricular myocardium.

Authors:  Tamás Hézső; Muhammad Naveed; Csaba Dienes; Dénes Kiss; János Prorok; Tamás Árpádffy-Lovas; Richárd Varga; Erika Fujii; Tanju Mercan; Leila Topal; Kornél Kistamás; Norbert Szentandrássy; János Almássy; Norbert Jost; János Magyar; Tamás Bányász; István Baczkó; András Varró; Péter P Nánási; László Virág; Balázs Horváth
Journal:  Sci Rep       Date:  2021-05-05       Impact factor: 4.379

Review 3.  Do age-associated changes of voltage-gated sodium channel isoforms expressed in the mammalian heart predispose the elderly to atrial fibrillation?

Authors:  Emmanuel Isaac; Stephanie M Cooper; Sandra A Jones; Mahmoud Loubani
Journal:  World J Cardiol       Date:  2020-04-26

4.  Absence of Functional Nav1.8 Channels in Non-diseased Atrial and Ventricular Cardiomyocytes.

Authors:  Simona Casini; Gerard A Marchal; Makiri Kawasaki; Fransisca A Nariswari; Vincent Portero; Nicoline W E van den Berg; Kaomei Guan; Antoine H G Driessen; Marieke W Veldkamp; Isabella Mengarelli; Joris R de Groot; Arie O Verkerk; Carol Ann Remme
Journal:  Cardiovasc Drugs Ther       Date:  2019-12       Impact factor: 3.727

5.  Inhibition of NaV1.8 prevents atrial arrhythmogenesis in human and mice.

Authors:  Steffen Pabel; Shakil Ahmad; Petros Tirilomis; Thea Stehle; Julian Mustroph; Maria Knierim; Nataliya Dybkova; Philipp Bengel; Andreas Holzamer; Michael Hilker; Katrin Streckfuss-Bömeke; Gerd Hasenfuss; Lars S Maier; Samuel Sossalla
Journal:  Basic Res Cardiol       Date:  2020-02-20       Impact factor: 17.165

6.  Detrimental proarrhythmogenic interaction of Ca2+/calmodulin-dependent protein kinase II and NaV1.8 in heart failure.

Authors:  Philipp Bengel; Nataliya Dybkova; Petros Tirilomis; Katrin Streckfuss-Bömeke; Samuel Sossalla; Shakil Ahmad; Nico Hartmann; Belal A Mohamed; Miriam Celine Krekeler; Wiebke Maurer; Steffen Pabel; Maximilian Trum; Julian Mustroph; Jan Gummert; Hendrik Milting; Stefan Wagner; Senka Ljubojevic-Holzer; Karl Toischer; Lars S Maier; Gerd Hasenfuss
Journal:  Nat Commun       Date:  2021-11-15       Impact factor: 14.919

Review 7.  Late Sodium Current of the Heart: Where Do We Stand and Where Are We Going?

Authors:  Balázs Horváth; Norbert Szentandrássy; János Almássy; Csaba Dienes; Zsigmond Máté Kovács; Péter P Nánási; Tamas Banyasz
Journal:  Pharmaceuticals (Basel)       Date:  2022-02-15

8.  The functional consequences of sodium channel NaV 1.8 in human left ventricular hypertrophy.

Authors:  Shakil Ahmad; Petros Tirilomis; Steffen Pabel; Nataliya Dybkova; Nico Hartmann; Cristina E Molina; Theodoros Tirilomis; Ingo Kutschka; Norbert Frey; Lars S Maier; Gerd Hasenfuss; Katrin Streckfuss-Bömeke; Samuel Sossalla
Journal:  ESC Heart Fail       Date:  2018-10-30

9.  ESC Heart Failure increases its impact factor.

Authors:  Markus S Anker; Zoltán Papp; Gábor Földes; Stephan von Haehling
Journal:  ESC Heart Fail       Date:  2020-10-28

Review 10.  Is hypertensive left ventricular hypertrophy a cause of sustained ventricular arrhythmias in humans?

Authors:  R Nadarajah; P A Patel; M H Tayebjee
Journal:  J Hum Hypertens       Date:  2021-03-05       Impact factor: 3.012

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.