Nicholas Chim1, Lynnette N Jackson1, Anh M Trinh1, John C Chaput1,2,3. 1. Departments of Pharmaceutical Sciences, University of California, Irvine, California. 2. Department of Chemistry, University of California, Irvine, California. 3. Department of Molecular Biology and Biochemistry, University of California, Irvine, California.
Abstract
High resolution crystal structures of DNA polymerase intermediates are needed to study the mechanism of DNA synthesis in cells. Here we report five crystal structures of DNA polymerase I that capture new conformations for the polymerase translocation and nucleotide pre-insertion steps in the DNA synthesis pathway. We suggest that these new structures, along with previously solved structures, highlight the dynamic nature of the finger subdomain in the enzyme active site.
High resolution crystal structures of DNA polymerase intermediates are needed to study the mechanism of DNA synthesis in cells. Here we report five crystal structures of DNA polymerase I that capture new conformations for the polymerase translocation and nucleotide pre-insertion steps in the DNA synthesis pathway. We suggest that these new structures, along with previously solved structures, highlight the dynamic nature of the finger subdomain in the enzyme active site.
DNA polymerase I (DNAP-I) has long been viewed as the canonical model for DNA synthesis in cells (Lehman et al., 1958). Structural insights into the mechanism of DNA synthesis have been obtained from crystal structures of a thermostable bacterial (Geobacillus stearothermophilus, Bst) DNAP-I large fragment that retains catalytic activity inside the crystal lattice (Johnson et al., 2003; Kiefer et al., 1998). The prevailing mechanism invokes the use of a distinct pre-insertion site, observed in the translocated product of in crystallo catalyzed primer-extension reactions where dNTP substrates are soaked into pre-formed crystals of DNAP-I bound to a primer-template duplex (Figure 1—figure supplement 1)(Johnson et al., 2003; Kiefer et al., 1998). The pre-insertion site is a hydrophobic pocket located between the O and O1 helices of the finger subdomain where the n + 1 templating base resides prior to forming the nascent base pair with the incoming dNTP substrate (Johnson et al., 2003). However, the pre-insertion site has not been witnessed in polymerases with homologous active sites (Eom et al., 1996; Li et al., 1998; Yin and Steitz, 2002), implying that DNAP-I follows a complex enzymatic pathway that contains numerous intermediates, many of which have not yet been observed in protein crystals. Here we report five crystal structures of DNAP-I that capture new conformations for the polymerase translocation and nucleotide pre-insertion steps in the DNA synthesis pathway. Together, these structures provide new insight into the mechanism of DNA synthesis and highlight the dynamic nature of the finger subdomain in the enzyme active site.
Figure 1—figure supplement 1.
Prevailing mechanism of DNA synthesis by DNA polymerase I.
The four key mechanistic steps of DNA polymerase I have been determined from the structures of Bst DNA polymerase and T7 RNA polymerase (structural homolog). Starting from the binary complex, the n + 1 templating base resides in the pre-insertion site (pre-IS, pink), located in a hydrophic pocket formed by the O-O1 helices and Tyr714 occupies the insertion site (IS, purple), stacking above the newly formed base pair located in the post insertion site (post-IS, green). Upon dNTP binding, the O-O1 helices undergo a minor conformational change, which displaces the n + 1 base from the pre-IS to produce a ternary complex with the incoming dNTP substrate pairing opposite Tyr714 in the IS. The pre-catalytic state is defined by a more significant conformation change where the O-O1 helices close to allow the formation of a nascent base pair between the n + 1 base and incoming dNTP substrate. Following catalysis, the O-O1 helices remain closed with the displaced pyrophosphate moiety observed as a trapped intermediate. Structural details that occur between post-catalysis, translocation, and formation of the subsequent binary complex remain poorly understood (dotted line).
Results and discussion
Recognizing that in crystallo and solution catalyzed enzymatic reactions can produce different structural results with potentially different functional interpretations (Ehrmann et al., 2017), we chose to investigate the translocated intermediates of DNAP-I using a direct crystallization method that involves solving crystal structures of the enzyme-product complex obtained from primer-extension reactions performed in solution rather than inside the environment of a protein crystal. In these reactions, the starting enzyme-primer-template complex was incubated with solutions of either buffer, dTTP, or dTTP and dATP for 30 min at 37°C. Following primer-extension, the enzyme-product complex was crystallized and cocrystal structures of Bst DNAP-I were solved to resolutions of 1.5 – 2.0 Å (Table 1). This approach was used to obtain high resolution structures of DNAP-I for the starting primer-template complex (n) and two translocated products obtained for the n + 1 and n + 2 nucleotide addition steps using the same primer-template duplex (n) described in previous in crystallo studies (Figure 1a)(Johnson et al., 2003).
Table 1.
Data collection and refinement statistics
N
n + 1
n + 1, dATP soak
n + 1, dAMPNPP soak
n + 2
Data Collection
Space group
P212121
P212121
P212121
P212121
P212121
Cell Dimensions
a, b, c (Å)
86.1, 93.4, 105.6
88.1, 93.7, 105.8
87.1, 93.5, 105.3
87.44, 93.39, 104.95
87.0, 93.0, 104.7
α, β, γ (°)
90.0, 90.0, 90.0
90.0, 90.0, 90.0
90.0, 90.0, 90.0
90.0, 90.0, 90.0
90.0, 90.0, 90.0
Resolution (Å)
54.31–1.58 (1.64–1.58)
46.09–1.98 (2.05–1.98)
46.7–1.99 (2.06–1.99)
43.72–1.74 (1.78–1.74)
41.04–1.99 (2.06–1.99)
Rmerge
0.7309 (1.35)
0.7085 (1.389)
0.1329 (0.7194)
0.0567 (0.241)
0.3279 (1.745)
CC1/2
0.842 (0.795)
0.759 (0.543)
0.993 (0.796)
0.999 (0.977)
0.991 (0.586)
I / σI
71.43 (3.56)
43.97 (2.64)
17.03 (2.90)
22.78 (9.66)
9.75 (2.49)
Completeness (%)
99.98 (99.98)
96.97 (99.15)
99.92 (99.90)
98.25 (99.33)
99.90 (99.93)
Redundancy
31.3 (25.0)
12.9 (11.0)
6.8 (4.7)
7.0 (6.8)
7.2 (7.3)
Refinement
Resolution (Å)
54.31–1.58 (1.64–1.58)
46.09–1.98 (2.05–1.98)
46.7–1.99 (2.06–1.99)
43.72–1.98 (2.05–1.98)
41.04–1.99 (2.06–1.99)
No. reflections
115039 (11360)
59886 (6056)
59677 (5857)
59416 (5901)
58990 (5831)
Rwork/Rfree
0.165/0.189 (0.199/0.248)
0.202/0.255 (0.264/0.340)
0.184/0.219 (0.239/0.293)
0.222/0.271 (0.225/0.281)
0.192/0.228 (0.332/0.391)
No. atoms
5961
4627
5412
5468
5453
Protein
4636
4627
4639
4661
4590
Duplex
490
469
487
429
475
Solvent
835
546
286
378
388
B-factors
26.73
42.07
45.96
42.25
39.05
Protein
25.11
42.17
45.39
41.74
38.85
Duplex/dAMPNPP
40.11
55.17
117.16
101.56/106.4
60.07
Solvent
36.64
40.95
46.01
41.13
41.37
R.m.s deviations
Bond lengths (Å)
0.006
0.007
0.008
0.008
0.007
Bond angles (°)
0.82
0.89
0.84
1.15
0.85
*Values in parentheses are for the highest-resolution shell.
Figure 1.
The translocation complex of Bst DNAP-I.
(a) Schematic illustration of the primer-extension reactions used to generate enzyme complexes for the starting duplex (n) and translocated products of the n + 1 and n + 2 nucleotide addition steps. (b) Global architecture of Bst DNAP-I bound to the primer-template duplex (n, 6DSW). (c) The active site region of a known n + 1 in crystallo catalysis structure (1L3T). The pre-insertion site (pre-IS) is circled in red. (d) The active site region of the n + 1 solution-catalyzed reaction (6DSY). Color scheme: polymerase (grey), template (blue), primer (orange), magnesium ion (green), n + 1 nucleotide adduct (red), and amino acid side chains (color by atom).
The four key mechanistic steps of DNA polymerase I have been determined from the structures of Bst DNA polymerase and T7 RNA polymerase (structural homolog). Starting from the binary complex, the n + 1 templating base resides in the pre-insertion site (pre-IS, pink), located in a hydrophic pocket formed by the O-O1 helices and Tyr714 occupies the insertion site (IS, purple), stacking above the newly formed base pair located in the post insertion site (post-IS, green). Upon dNTP binding, the O-O1 helices undergo a minor conformational change, which displaces the n + 1 base from the pre-IS to produce a ternary complex with the incoming dNTP substrate pairing opposite Tyr714 in the IS. The pre-catalytic state is defined by a more significant conformation change where the O-O1 helices close to allow the formation of a nascent base pair between the n + 1 base and incoming dNTP substrate. Following catalysis, the O-O1 helices remain closed with the displaced pyrophosphate moiety observed as a trapped intermediate. Structural details that occur between post-catalysis, translocation, and formation of the subsequent binary complex remain poorly understood (dotted line).
(a) Crystal structures of the starting primer-template complex (n). Color scheme and PDB codes: new structure (yellow, 6DSW), known structure (grey, 1L3S). (b–f) Post-chemistry structures comparing the active site conformation for n + 1 and n + 2 translocated products generated from solution and in crystallo catalyzed primer-extension reactions. Color scheme and PDB codes: known n + 1 and n + 2 in crystallo catalyzed structures (grey, 1L3T and 1L3U, respectively), new n + 1 and n + 2 solution-catalyzed structures (yellow, 6DSY and 6DSV, respectively), and a new n + 2 in crystallo catalyzed structure obtained from the n + 1 crystal of a solution-catalyzed reaction (blue, 6DSX). (b,c) Overlays comparing the translocated product obtained from solution and in crystallo catalyzed n + 1 and n + 2 primer-extension reactions, respectively. (d) Overlays of the n + 1 and n + 2 structures from solution catalyzed reactions. (e) Overlay of the n + 2 structures for solution and in crystallo catalyzed reactions that initiate from the same polymerase conformation. (f) Overlay of n + 2 in crystallo catalyzed structures that initiate from different polymerase conformations.
Amino acid residues are depicted as boxes, color-coded by polymerase sub-domain. Thin dashed lines represent interactions between the polymerase and a component of the primer/template duplex.
Amino acid residues are depicted as boxes, color-coded by polymerase sub-domain. Thin dashed lines represent interactions between the polymerase and a component of the primer/template duplex.
Crystal structures obtained by solution catalysis (yellow) are conformationally identical to known binary structures (grey) containing (a) an oxidative lesion at the active site (4B9M), (b) an A:G mismatched in the active site (1NK0), and (c) an inactive Bst mutant (4E0D). Unnatural modifications are highlighted in red.
The translocation complex of Bst DNAP-I.
(a) Schematic illustration of the primer-extension reactions used to generate enzyme complexes for the starting duplex (n) and translocated products of the n + 1 and n + 2 nucleotide addition steps. (b) Global architecture of Bst DNAP-I bound to the primer-template duplex (n, 6DSW). (c) The active site region of a known n + 1 in crystallo catalysis structure (1L3T). The pre-insertion site (pre-IS) is circled in red. (d) The active site region of the n + 1 solution-catalyzed reaction (6DSY). Color scheme: polymerase (grey), template (blue), primer (orange), magnesium ion (green), n + 1 nucleotide adduct (red), and amino acid side chains (color by atom).
Prevailing mechanism of DNA synthesis by DNA polymerase I.
The four key mechanistic steps of DNA polymerase I have been determined from the structures of Bst DNA polymerase and T7 RNA polymerase (structural homolog). Starting from the binary complex, the n + 1 templating base resides in the pre-insertion site (pre-IS, pink), located in a hydrophic pocket formed by the O-O1 helices and Tyr714 occupies the insertion site (IS, purple), stacking above the newly formed base pair located in the post insertion site (post-IS, green). Upon dNTP binding, the O-O1 helices undergo a minor conformational change, which displaces the n + 1 base from the pre-IS to produce a ternary complex with the incoming dNTP substrate pairing opposite Tyr714 in the IS. The pre-catalytic state is defined by a more significant conformation change where the O-O1 helices close to allow the formation of a nascent base pair between the n + 1 base and incoming dNTP substrate. Following catalysis, the O-O1 helices remain closed with the displaced pyrophosphate moiety observed as a trapped intermediate. Structural details that occur between post-catalysis, translocation, and formation of the subsequent binary complex remain poorly understood (dotted line).
Conformational changes at the active site of Bst DNAP-I.
(a) Crystal structures of the starting primer-template complex (n). Color scheme and PDB codes: new structure (yellow, 6DSW), known structure (grey, 1L3S). (b–f) Post-chemistry structures comparing the active site conformation for n + 1 and n + 2 translocated products generated from solution and in crystallo catalyzed primer-extension reactions. Color scheme and PDB codes: known n + 1 and n + 2 in crystallo catalyzed structures (grey, 1L3T and 1L3U, respectively), new n + 1 and n + 2 solution-catalyzed structures (yellow, 6DSY and 6DSV, respectively), and a new n + 2 in crystallo catalyzed structure obtained from the n + 1 crystal of a solution-catalyzed reaction (blue, 6DSX). (b,c) Overlays comparing the translocated product obtained from solution and in crystallo catalyzed n + 1 and n + 2 primer-extension reactions, respectively. (d) Overlays of the n + 1 and n + 2 structures from solution catalyzed reactions. (e) Overlay of the n + 2 structures for solution and in crystallo catalyzed reactions that initiate from the same polymerase conformation. (f) Overlay of n + 2 in crystallo catalyzed structures that initiate from different polymerase conformations.
Two-dimensional interaction map for the n + 1 structure obtained from in crystallo catalysis.
Amino acid residues are depicted as boxes, color-coded by polymerase sub-domain. Thin dashed lines represent interactions between the polymerase and a component of the primer/template duplex.
Two-dimensional interaction map for n + 1 structure obtained from a solution-catalyzed reaction.
Amino acid residues are depicted as boxes, color-coded by polymerase sub-domain. Thin dashed lines represent interactions between the polymerase and a component of the primer/template duplex.
Crystal structures obtained from solution catalyzed reactions resemble active site conformations observed in ‘distorted’ conformations.
Crystal structures obtained by solution catalysis (yellow) are conformationally identical to known binary structures (grey) containing (a) an oxidative lesion at the active site (4B9M), (b) an A:G mismatched in the active site (1NK0), and (c) an inactive Bst mutant (4E0D). Unnatural modifications are highlighted in red.*Values in parentheses are for the highest-resolution shell.Structures of the enzyme-primer-template complex (n) before catalysis reflect the initiation step of DNA synthesis. Superposition of the new structure obtained for the initiation step against the previously solved structure reveals that both structures adopt the same active site conformation (Figure 1—figure supplement 2a). This result implies that any structural differences observed between the translocated product of solution and in crystallo catalyzed reactions should be due to the catalysis environment rather than the starting polymerase conformation.
Figure 1—figure supplement 2.
Conformational changes at the active site of Bst DNAP-I.
(a) Crystal structures of the starting primer-template complex (n). Color scheme and PDB codes: new structure (yellow, 6DSW), known structure (grey, 1L3S). (b–f) Post-chemistry structures comparing the active site conformation for n + 1 and n + 2 translocated products generated from solution and in crystallo catalyzed primer-extension reactions. Color scheme and PDB codes: known n + 1 and n + 2 in crystallo catalyzed structures (grey, 1L3T and 1L3U, respectively), new n + 1 and n + 2 solution-catalyzed structures (yellow, 6DSY and 6DSV, respectively), and a new n + 2 in crystallo catalyzed structure obtained from the n + 1 crystal of a solution-catalyzed reaction (blue, 6DSX). (b,c) Overlays comparing the translocated product obtained from solution and in crystallo catalyzed n + 1 and n + 2 primer-extension reactions, respectively. (d) Overlays of the n + 1 and n + 2 structures from solution catalyzed reactions. (e) Overlay of the n + 2 structures for solution and in crystallo catalyzed reactions that initiate from the same polymerase conformation. (f) Overlay of n + 2 in crystallo catalyzed structures that initiate from different polymerase conformations.
To evaluate the elongation step of DNA synthesis, the translocated products obtained from solution and in crystallo catalyzed primer-extension reactions were compared, both globally and locally within the enzyme active site (Johnson et al., 2003; Kiefer et al., 1998). All of the structures adopt the same overall topology commonly observed for A-family DNA polymerases (Figure 1b). However, careful analysis of the enzyme active site did reveal clear conformational differences between structures obtained from solution-catalyzed reactions versus those obtained from in crystallo catalyzed reactions (Figure 1c,d). The in crystallo catalyzed reactions adopt an active site conformation that is nearly identical to the starting conformation, which represents the initiation step of DNA synthesis (Figure 1—figure supplement 2a). However, the solution catalyzed reactions produce a different active site conformation that binds the duplex in a different position and base pair geometry (Figure 1—figure supplement 2b,c).Major structural differences are depicted in the 2D interaction maps, which show that the solution catalyzed reactions produce a translocated product with markedly fewer contacts to the phosphodiester linkage, sugar, and nucleobase moieties of the primer-template duplex as compared to the translocated product obtained by in crystallo catalysis (Figure 1—figure supplements 3 and 4, Supplementary file 1a). A particularly striking example of conformational disparity is Tyr714, a critical active site residue involved in the mechanism of DNA synthesis (Bell et al., 1997; Carroll et al., 1991). In the solution catalyzed structures, Tyr714 stabilizes the newly formed base pair by stacking above the primer strand, while this residue stacks above the template strand in the in crystallo catalyzed structures (Figure 1c,d). Importantly, the pre-insertion site is not observed in the solution catalyzed reactions due to a kink in the O-helix, which abrogates the O-O1 loop in the finger subdomain (Figure 1d). Absent a hydrophobic pocket, the n + 1 nucleotide in the template strand stacks against Tyr719 in the O1 helix, which positions the base for a subsequent round of catalysis. The solution catalyzed structures obtained for the n + 1 and n + 2 translocated products adopt identical active site conformations (Figure 1 – figure supplement 2d), which together represent a new intermediate along the DNA replication pathway of Bst DNAP-I.
Figure 1—figure supplement 3.
Two-dimensional interaction map for the n + 1 structure obtained from in crystallo catalysis.
Amino acid residues are depicted as boxes, color-coded by polymerase sub-domain. Thin dashed lines represent interactions between the polymerase and a component of the primer/template duplex.
Figure 1—figure supplement 4.
Two-dimensional interaction map for n + 1 structure obtained from a solution-catalyzed reaction.
Amino acid residues are depicted as boxes, color-coded by polymerase sub-domain. Thin dashed lines represent interactions between the polymerase and a component of the primer/template duplex.
Next, we examined whether a solution catalyzed conformation could be converted to an in crystallo conformation through a round of in crystallo catalysis. Accordingly, dATP was soaked into a crystal of the n + 1 translocated product obtained by crystallization of a solution catalyzed reaction. Following one cycle of in crystallo catalysis, an n + 2 translocated structure was produced that now contained the pre-insertion site and matched the active site conformation of previous in crystallo results (Figure 1 – figure supplement 2e, f). This observation demonstrates that in crystallo catalysis favors an active site conformation that contains the pre-insertion site, as the same active site conformation is obtained from two different starting points.Interestingly, the translocated product obtained from the set of solution catalyzed reactions is similar to known Bst DNAP-I structures solved with duplexes that contain damaged DNA intermediates and active site mutations (Figure 1—figure supplement 5, Supplementary file 1b). These structures were previously thought to contain a distorted active site conformation due to the position of Tyr714 relative to its conformation in the in crystallo catalysis structures (Gehrke et al., 2013; Johnson and Beese, 2004; Wang et al., 2012). However, given the homology of these structures to the translocated product of solution catalyzed reactions, we postulate that Tyr714 functions as a regulatory checkpoint in the mechanism of DNA synthesis by evaluating the geometry of the newly formed base pair.
Figure 1—figure supplement 5.
Crystal structures obtained from solution catalyzed reactions resemble active site conformations observed in ‘distorted’ conformations.
Crystal structures obtained by solution catalysis (yellow) are conformationally identical to known binary structures (grey) containing (a) an oxidative lesion at the active site (4B9M), (b) an A:G mismatched in the active site (1NK0), and (c) an inactive Bst mutant (4E0D). Unnatural modifications are highlighted in red.
Next, we wondered whether the mechanism of DNAP-I included the formation of a pre-insertion complex, which is a ternary structure different from the previously discussed pre-insertion site observed in the binary structure of in crystallo catalyzed primer-extension reactions. Previously, Wu and colleagues solved the ternary structure of a mutant version of Bst DNAP-I bound to an incoming dATP substrate (Miller et al., 2015). Although that structure was originally described as an open ternary complex, presumably to avoid confusion with the pre-insertion site, it resembles the pre-insertion complex first observed in Klentaq1 (Li et al., 1998). The key difference between the open ternary and pre-insertion complex is whether the incoming nucleotide is paired opposite the templating base or an active site residue (Doublié et al., 1998; Yin and Steitz, 2004). Since the structure by Wu and colleagues shows the incoming substrate paired opposite Tyr714, it should be considered a pre-insertion complex.We demonstrated that the wild-type polymerase is also capable of forming a pre-insertion complex by solving the ternary structure of the enzyme bound to the non-hydrolyzable analog, dAMPNPP. The resulting structure (Figure 2) closely resembles the mutant Bst polymerase structure determined by Wu and colleagues and shows Tyr714 paired opposite the incoming nucleotide (Miller et al., 2015). Although the phosphate tail shows nearly 100% occupancy, the sugar and nucleobase moieties are flexible, which is consistent with the dynamic properties of the incoming nucleotide in an open polymerase conformation. Nevertheless, the structure shows that the incoming nucleotide is stabilized by polar contacts to the negatively charged triphosphate moiety. These observations demonstrate that Bst DNAP-I adopts a pre-insertion complex similar to other A-family DNA polymerases (Rothwell and Waksman, 2005), which clarifies an important step in the mechanism of DNA synthesis.
Figure 2.
The pre-insertion complex of Bst DNAP-I.
(a) An open ternary structure of Bst DNAP-I (yellow) with a primer-template duplex (color by atom), non-hydrolyzable dATP analog (dAMPNPP, red), and magnesium ion (green) bound in the enzyme active site. Superimposed on the stick model is a 2Fo-Fc omit map contoured at 2.0σ for interacting residues, yellow mesh, and Fo-Fc omit maps contoured at 1.0σ for dAMPNPP and magnesium, red and green mesh, respectively. (b) Comparison of the new ternary structure (yellow, 6DSU) superimposed on a mutant Bst DNAP-I structure solved with dATP bound in the enzyme active site (grey, 4YFU).
The pre-insertion complex of Bst DNAP-I.
(a) An open ternary structure of Bst DNAP-I (yellow) with a primer-template duplex (color by atom), non-hydrolyzable dATP analog (dAMPNPP, red), and magnesium ion (green) bound in the enzyme active site. Superimposed on the stick model is a 2Fo-Fc omit map contoured at 2.0σ for interacting residues, yellow mesh, and Fo-Fc omit maps contoured at 1.0σ for dAMPNPP and magnesium, red and green mesh, respectively. (b) Comparison of the new ternary structure (yellow, 6DSU) superimposed on a mutant Bst DNAP-I structure solved with dATP bound in the enzyme active site (grey, 4YFU).Based on the structures reported here, we propose a revised mechanism for DNA synthesis by DNA polymerase I. The catalytic cycle consists of four key steps that derive from high resolution structures of Bst DNAP-I and its homolog T7 RNA polymerase (Figure 3). Starting from the newly determined post-translocation complex, the polymerase undergoes a conformation change to adopt the pre-insertion complex with an incoming nucleotide paired opposite Tyr714 in the enzyme active site. This conformational change involves release of the n + 1 templating base from its stacking interaction with Tyr719 in the O1 helix and the repositioning of Tyr714 in the enzyme active site. The enzyme then undergoes a more significant conformational change to adopt the closed ternary complex (Johnson et al., 2003), which defines the pre-catalytic state of the enzyme. Immediately following phosphodiester bond formation, the enzyme adopts a post-catalytic complex in which the primer has been extended by one nucleotide (Yin and Steitz, 2004). The enzyme then translocates to the next position on the template to initiate another cycle of nucleotide addition.
Figure 3.
Revised mechanism of DNAP-I.
The four key mechanistic steps of DNAP-I depict a replication cycle for DNA synthesis. The translocation complex (top) is stabilized by π-stacking interactions between Tyr719 and the n + 1 templating base and between Tyr714 and the primer strand. Tyr714 occupies the insertion site (IS, purple) while a newly formed base pair is located in the post insertion site (post-IS, green). In the pre-insertion complex (right), the O-helix adjusts to accommodate the incoming dNTP substrate, which binds opposite Tyr714 in the IS. In the closed ternary complex (bottom), the polymerase undergoes a major conformational change to allow the n + 1 templating base to form a nascent base pair with the dNTP substrate in pre-catalytic state. Following catalysis, the finger subdomain remains closed with a trapped pyrophosphate moiety observed in the active site of the post-catalytic complex (left). To complete the cycle, the finger subdomain opens, pyrophosphate is released, and the enzyme translocates to the next position on the template. The translocation (6DSY), pre-insertion (6DSU), and closed ternary complexes (1VL5) are based on crystal structures Bst DNAP-I. The post-catalytic complex is based on the structure of T7 RNAP (1S77), which is a homolog of Bst DNAP-I.
Revised mechanism of DNAP-I.
The four key mechanistic steps of DNAP-I depict a replication cycle for DNA synthesis. The translocation complex (top) is stabilized by π-stacking interactions between Tyr719 and the n + 1 templating base and between Tyr714 and the primer strand. Tyr714 occupies the insertion site (IS, purple) while a newly formed base pair is located in the post insertion site (post-IS, green). In the pre-insertion complex (right), the O-helix adjusts to accommodate the incoming dNTP substrate, which binds opposite Tyr714 in the IS. In the closed ternary complex (bottom), the polymerase undergoes a major conformational change to allow the n + 1 templating base to form a nascent base pair with the dNTP substrate in pre-catalytic state. Following catalysis, the finger subdomain remains closed with a trapped pyrophosphate moiety observed in the active site of the post-catalytic complex (left). To complete the cycle, the finger subdomain opens, pyrophosphate is released, and the enzyme translocates to the next position on the template. The translocation (6DSY), pre-insertion (6DSU), and closed ternary complexes (1VL5) are based on crystal structures Bst DNAP-I. The post-catalytic complex is based on the structure of T7 RNAP (1S77), which is a homolog of Bst DNAP-I.In summary, we present crystal structures of DNA polymerase I that capture the translocation and nucleotide pre-insertion steps in the DNA synthesis pathway. We suggest that these new structures, along with previously solved structures obtained by in crystallo catalysis, highlight the dynamic nature of the finger subdomain in the enzyme active site. Together, the new and existing structures expand our understanding of the mechanism of DNA synthesis by capturing important intermediates in a complicated reaction pathway.
Materials and methods
Bst cloning, Expression, and Purification
The Bst (amino acid residues 299–876) gene was PCR amplified from a previously constructed pDEST007-Bst vector generously donated by Prof Thomas Carell using Bst_for (ATCGCATTTACGCTTGCTGAC, IDT) and Bst_rev (ATGCGGCC TCGAGTCATTATTTCGCATCATACCACG, IDT) primers containing NdeI and BsaI restriction enzyme sites (underlined), respectively. Purified PCR product and the expression vector, pGDR11, were digested with NdeI and BsaI restriction enzymes (NEB) and ligated and the resulting pGDR11-Bst construct was sequence verified (Retrogen). DH5-α cells (NEB) harboring pGDR11-Bst were grown aerobically at 37°C in LB medium containing 100 μg mL−1 ampicillin. At an OD600 of 0.8, expression of a tagless Bst was induced with 1 mM isopropyl β-D-thiogalactoside at 18°C for 16 hr. Cells were harvested by centrifugation for 20 min at 3315 x g at 4°C and lysed in 40 mL lysis buffer (50 mM Tris-Cl pH 7.5, 1 mM EDTA, 10 mM BME, 0.1 % v/v NP-40, 0.1 % v/v Tween20, 5 mg egg hen lysozyme) by sonication. The cell lysate was centrifuged at 23,708 x g for 30 min and the clarified supernatant was heat treated for 20 min at 60°C and centrifuged again at 23,708 x g for 30 min. The supernatant was loaded onto two 5 mL HiTrap Q HP columns (GE) assembled in tandem and washed with low salt buffer (50 mM Tris-Cl pH 7.5, 100 mM NaCl, 1 mM EDTA, 10 mM BME). Bst was eluted with a high salt buffer (50 mM Tris-Cl pH 7.5, 1M NaCl, 0.1 mM EDTA, 10 mM BME) using a linear gradient. Eluted fractions containing Bst were visualized by SDS-PAGE, pooled, and dialyzed against low salt buffer. The dialyzed sample was loaded onto a 5 mL HiTrap Heparin column (GE), washed with low salt buffer, and eluted using a linear gradient of high salt buffer. Eluted fractions containing Bst were visualized using SDS-PAGE and concentrated using a 30 kDa cutoff Amicon centrifugal filter (Millipore). Further purification was achieved by size exclusion chromatography (Superdex 200 HiLoad 16/600, GE) pre-equilibrated with Bst buffer (50 mM Tris-Cl pH 7.5, 150 mM NaCl, 1 mM EDTA, 10 mM BME). Purified Bst was concentrated to 20 mg mL−1 for crystallization trials using a 30 kDa cutoff Amicon centrifugal filter (Millipore).
Crystallization procedures
General information
All reagents purchased from commercial suppliers were of analytical grade. Stock solutions of 2-methyl-2,4-pentanediol (Hampton Research), ammonium sulfate (Teknova) and 2-(N-morpholino) ethanesulfonic acid (Calbiochem) were filtered before use.
Sample preparation
The DNA template (5’-GACGTACGTGATCGCA-3’, T) and primer (5’-GCGATCACGT-3’, P) strands, purchased from IDT, were used without further purification for crystallization trials. The P/T duplex (0.18 mM final concentration) was prepared by combining equal amounts of the primer and template strands in Bst buffer supplemented with 20 mM MgCl2, and annealing the strands by heating at 95°C for 5 min and cooling to 10°C over 10 min.
Crystallization
All polymerase samples were prepared at a final protein concentration of 4 mg mL−1. The binary complex (n) was prepared by incubating Bst polymerase with three molar equivalents of the P/T duplex at 37°C for 30 min. For the primer extension complexes, the n sample was further incubated a second time with 10 M excess of dTTP (n + 1 complex) or dTTP +dATP (n + 2 complex) and 10 mM manganese chloride at 37°C for 30 min. Following primer-extension, 24–well plate hanging drop trays were used to monitor crystal growth over a range of ammonium sulfate and MPD concentrations, based on previously published conditions (Johnson et al., 2003). Each drop contained 1 μL of sample mixed with 1 μL of mother liquor over 500 μL of mother liquor per well. Trays were stored in the dark at room temperature and crystal growth was generally observed after 2 days. For the in crystallo extension, single crystals of the n + 1 extension product obtained from a solution-catalyzed reaction were transferred to a drop containing stabilization buffer (0.1 M MES pH 5.8, 2 M ammonium sulfate, 2.5% MPD) supplemented with 30 mM dATP and soaked for 4 days prior to harvesting. For the pre-insertion complex, single crystals of the n + 1 extension product obtained from a solution-catalyzed reaction were transferred to a drop containing stabilization buffer supplemented with 30 mM adenosine-5’-[(β,γ)-imido] triphosphate (dAMPNPP) and soaked for 5–6 days before harvesting.
Data collection, structure determination, and refinement
Five diffraction datasets corresponding to n, n + 1, n + 1 dATP soak, n + 1 dAMPNPP soak, and n + 2 were collected at the Advanced Light Source (Lawrence Berkeley National laboratory, Berkeley, CA) from single crystals. Images were indexed, integrated, and merged using XDS (Kabsch, 2010). Data collection statistics are summarized in Table 1. Molecular replacement (MR) using Phaser (McCoy et al., 2007) was performed using PDB structures 1L3S, 1L3T, and 1L3U (Johnson et al., 2003) as search models for n, n + 1, and n + 1 dATP soak datasets, respectively. MR for dAMPNPP was performed using 1L3T (Johnson et al., 2003) as the search model and MR for n + 2 was performed using the n + 1 structure as the search model. All final models were determined using iterative rounds of manual building through Coot (Emsley et al., 2010) and refinement with phenix (Afonine et al., 2012). The final stages of refinement employed TLS parameters for all structures. The stereochemistry and geometry of all structures were validated with Molprobity (Chen et al., 2010), with the final refinement parameters summarized in Table 1. Final coordinates and structure factors have been deposited in the Protein Data Bank. All molecular graphics were prepared with PyMOL (Delano, 2002).In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "Crystal Structures of DNA Polymerase I Capture the Physiological Intermediates of Translocation and Pre-Insertion" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by John Kuriyan as the Senior and Reviewing Editor. The reviewers have opted to remain anonymous.The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.This manuscript from Chim et al. describes the results of a crystallographic characterization of the Bst DNA polymerase I large fragment, a model enzyme for understanding the A-family DNA polymerases. The authors describe novel structures, compared with those in previous publications in the field and deposited in the PDB. Instead of relying on use of an in crystallo reaction set up toward following the reaction cycle, the authors used "direct" crystallization of complexes formed in solution. The crystal structures obtained in this work are generally similar to the crystal structures published by the group of Lorena Beese (Johnson et al., 2003; Kiefer et al., 1998), using the identical DNA polymerase and DNA substrates. In the original work, the different structures were obtained by extending a DNA substrate by one or two nucleotides in crystals. In the current work, the authors reproduce identical structures by performing the same in-crystal extension of the DNA substrate. The authors also present two new structures that are the results of performing the extension in solution before crystallization. These new structures differ from the in-crystal structures in that the template base that is to be paired with the incoming nucleotide (n+1 base) is not bound to the so-called pre-insertion site but positioned on the other side of a helix that borders the pre-insertion site.In summary, the authors present structures of reaction intermediates in the DNA polymerase cycle that have not been observed previously. The results emphasize the point of dynamics in the fingers domain as the enzyme transitions from one step to the next in the reaction cycle.We agree that this work is important, and potentially suitable for publication in eLife, because of the fundamental importance of DNA replication mechanisms.We have serious concerns, however, with the way that the overall import of the work is currently presented, in terms of its potential "physiological relevance". All structural analyses are results of artifacts of the solution or crystal conditions, and it is likely that conformations that are stable enough to be trapped in one way or the other represent intermediates or transitions on an underlying free-energy surface that are inadequately sampled by current experimental methods and our inability to mimic cellular conditions. In particular, the authors argue that their new structures are "physiologically relevant", while those obtained previously through in-crystal extension are not. The authors provide no evidence to support this statement.Their first argument is that the "pre-insertion site is inconsistent with the fast rate of Bst DNAP-I (~200nt/s)" (Introduction). Yet the authors do not explain why this would be inconsistent. They also claim that the binding of the n+1 base in the pre-insertion site "has not been witnessed in polymerases with homologous active sites" (Introduction). However, one of the referenced structures is without DNA, one is an RNA polymerase with a DNA-RNA hybrid substrate, and two of these are from a different species (Thermus aquaticus), both of which did not include a primer extension step. In contrast, one paper (Golosov, 2010) describes a molecular dynamics analysis that is completely consistent with the binding of the n+1 base into the pre-insertion site.Curiously, the conformation of the DNA template observed in their new structure has been observed before, but only in structures "that contain damaged DNA intermediates and active site mutations" (Results and Discussion section). This might even argue against the new structures representing the "physiologically relevant state", at least for normal base pairs.It is possible that both sets of structures could represent intermediates in a complex DNA extension cycle that contains many different intermediate structures. We do not feel that it is necessary to diminish the importance of previous contributions to gain value for this new work, which we find interesting in its own right.We are prepared to consider a revised manuscript that takes into account the points made below. It is stressed, however, that the editors and the reviewers require that the Title and the language of the paper be changed so that a dichotomy, unsupported by additional data, not be presented between "physiologically relevant" and "physiologically irrelevant". No new experiments are requested.Essential Revisions:As noted above, change the Title of the paper to not imply physiological relevance or irrelevance.It seems that the authors have a strong bias against the original, in-crystal extended structures, a bias that is voiced throughout the paper without much clarification. Please remove or modify these speculations in light of the comments made above. Some of these are pointed out below:"…the pre-insertion site may be a constraint of the crystal lattice and not a relevant intermediate in the DNA synthesis pathway." (Introduction)"Recognizing that in crystallo and solution catalyzed enzymatic reactions can produce different structural results with different functional interpretations," (Introduction)"This work provides a telltale illustration of the problems that can arise when soaking substrates into preformed crystals of enzymes that undergo significant conformational changes (Ehrmann et al., 2017). To avoid such problems, we suggest validating important soaking results with cocrystallization."Introduction, “[…] the pre-insertion site is inconsistent with the fast rate of Bst DNAP-I (~200 nt/sc) […]”: the inconsistency asserted is not clear and is not explained. These comments undercut the manuscript and are not meaningful as written.In summary, the manuscript should be revised to highlight the impact of the present work without repudiating the significance of previous work.We agree that this work is important, and potentially suitable for publication in eLife, because of the fundamental importance of DNA replication mechanisms.We have serious concerns, however, with the way that the overall import of the work is currently presented, in terms of its potential "physiological relevance". All structural analyses are results of artifacts of the solution or crystal conditions, and it is likely that conformations that are stable enough to be trapped in one way or the other represent intermediates or transitions on an underlying free-energy surface that are inadequately sampled by current experimental methods and our inability to mimic cellular conditions. In particular, the authors argue that their new structures are "physiologically relevant", while those obtained previously through in-crystal extension are not. The authors provide no evidence to support this statement.We agree with the reviewers that, without additional experimental evidence, the claim of physiological relevance or irrelevance by any set of crystal structures is premature and unjustified. In the revised manuscript, we have removed all discussion of physiological relevance and presented all structural intermediates as a continuum of a complex DNA synthesis pathway.Their first argument is that the "pre-insertion site is inconsistent with the fast rate of Bst DNAP-I (~200nt/s)" (Introduction). Yet the authors do not explain why this would be inconsistent. They also claim that the binding of the n+1 base in the pre-insertion site "has not been witnessed in polymerases with homologous active sites" (Introduction). However, one of the referenced structures is without DNA, one is an RNA polymerase with a DNA-RNA hybrid substrate, and two of these are from a different species (Thermus aquaticus), both of which did not include a primer extension step. In contrast, one paper (Golosov, 2010) describes a molecular dynamics analysis that is completely consistent with the binding of the n+1 base into the pre-insertion site.We removed the claim that the pre-insertion site is inconsistent with the fast rate of Bst DNAP-I. However, we chose to retain the statement that the pre-insertion site has not been witnessed in polymerases with homologous active sites, as this sentence provides justification for the current work. In addition to changes to the text, references were provided to support the claims.Curiously, the conformation of the DNA template observed in their new structure has been observed before, but only in structures "that contain damaged DNA intermediates and active site mutations" (Results and Discussion section). This might even argue against the new structures representing the "physiologically relevant state", at least for normal base pairs.We chose to keep this paragraph in the manuscript as it describes a key observation that provides support for Tyr714 as a possible regulatory checkpoint. We do not feel that this paragraph diminishes previous work, as all assertions of physiological relevance or irrelevance have been removed from the text.It is possible that both sets of structures could represent intermediates in a complex DNA extension cycle that contains many different intermediate structures. We do not feel that it is necessary to diminish the importance of previous contributions to gain value for this new work, which we find interesting in its own right.The entire manuscript was revised to state that all intermediates identified in the current study and previous work represent individual steps in a complex DNA extension pathway.We are prepared to consider a revised manuscript that takes into account the points made below. It is stressed, however, that the editors and the reviewers require that the Title and the language of the paper be changed so that a dichotomy, unsupported by additional data, not be presented between "physiologically relevant" and "physiologically irrelevant". No new experiments are requested.Essential Revisions:As noted above, change the Title of the paper to not imply physiological relevance or irrelevance.We have changed the Title and revised the Abstract to remove any discussion of physiological relevance or irrelevance.It seems that the authors have a strong bias against the original, in-crystal extended structures, a bias that is voiced throughout the paper without much clarification. Please remove or modify these speculations in light of the comments made above. Some of these are pointed out below:"…the pre-insertion site may be a constraint of the crystal lattice and not a relevant intermediate in the DNA synthesis pathway." (Introduction)This sentence was removed from the text and surrounding sentences were modified."Recognizing that in crystallo and solution catalyzed enzymatic reactions can produce different structural results with different functional interpretations," (Introduction).In the absence of any discussion of physiological relevance, we feel this sentence remains true and does not diminish the impact of previous work. However, we have included the word ‘potentially’ in the sentence to soften the language."This work provides a telltale illustration of the problems that can arise when soaking substrates into preformed crystals of enzymes that undergo significant conformational changes (Ehrmann et al., 2017). To avoid such problems, we suggest validating important soaking results with cocrystallization."These sentences were removed from the text and the summary paragraph was re-written to be consistent with the revised text.Introduction, “[…] the pre-insertion site is inconsistent with the fast rate of Bst DNAP-I (~200 nt/sc) […]”: the inconsistency asserted is not clear and is not explained. These comments undercut the manuscript and are not meaningful as written.These lines were removed from the manuscript.In summary, the manuscript should be revised to highlight the impact of the present work without repudiating the significance of previous work.We have carefully rewritten the entire manuscript to present all structural intermediates, new and known, as a continuum of a complex DNA synthesis pathway.
Key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Strain, strain background (E. coli)
DH5-αderivative
NEB
C2987H
Chemically competent cells for recombinant expression of Bst DNAP-I
Recombinant DNA reagent
pDEST007-Bst
PMID: 20813757
Original expression plasmid for Bst DNAP-I
Recombinant DNA reagent
pGDR11
PMID: 9401025
Expression plasmid for Bst DNAP-I used in this study
Authors: Tim H Gehrke; Ulrike Lischke; Karola L Gasteiger; Sabine Schneider; Simone Arnold; Heiko C Müller; David S Stephenson; Hendrik Zipse; Thomas Carell Journal: Nat Chem Biol Date: 2013-05-19 Impact factor: 15.040
Authors: Pavel V Afonine; Ralf W Grosse-Kunstleve; Nathaniel Echols; Jeffrey J Headd; Nigel W Moriarty; Marat Mustyakimov; Thomas C Terwilliger; Alexandre Urzhumtsev; Peter H Zwart; Paul D Adams Journal: Acta Crystallogr D Biol Crystallogr Date: 2012-03-16
Authors: Frederik Rainer Ehrmann; Johann Stojko; Alexander Metz; François Debaene; Luzi Jakob Barandun; Andreas Heine; François Diederich; Sarah Cianférani; Klaus Reuter; Gerhard Klebe Journal: PLoS One Date: 2017-04-18 Impact factor: 3.240
Authors: Vincent B Chen; W Bryan Arendall; Jeffrey J Headd; Daniel A Keedy; Robert M Immormino; Gary J Kapral; Laura W Murray; Jane S Richardson; David C Richardson Journal: Acta Crystallogr D Biol Crystallogr Date: 2009-12-21
Authors: Airlie J McCoy; Ralf W Grosse-Kunstleve; Paul D Adams; Martyn D Winn; Laurent C Storoni; Randy J Read Journal: J Appl Crystallogr Date: 2007-07-13 Impact factor: 3.304