Xiao Xiao1,2, Jiankai Liang2, Chunlong Huang3, Kai Li4, Fan Xing5, Wenbo Zhu2, Ziqing Lin6, Wencang Xu6, Guangen Wu6, Jifu Zhang6, Xi Lin7,8, Yaqian Tan2, Jing Cai2, Jun Hu9, Xueqin Chen7, Youwei Huang7, Zixi Qin7, Pengxin Qiu2, Xingwen Su2, Lijun Chen2, Yuan Lin10,11, Haipeng Zhang12,13, Guangmei Yan14. 1. Institute of Clinical Medicine, The First Affiliated Hospital, University of South China, Hengyang, 421001, China. 2. Department of Pharmacology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, 510080, China. 3. Department of Hepatobiliary Surgery, The First Affiliated Hospital, Sun Yat-sen University, Guangzhou, 510700, China. 4. Guangdong Provincial Key Laboratory of Colorectal and Pelvic Floor Disease, The Sixth Affiliated Hospital of Sun Yat-sen University, Guangzhou, 510655, China. 5. School of Medicine, Sun Yat-sen University, Guangzhou, 510080, China. 6. Guangzhou Virotech Pharmaceutical Co., Ltd, Guangzhou, 510663, China. 7. Department of Pharmacology, School of Medicine, Jinan University, Guangzhou, 510632, China. 8. Institute of Medical Microbiology, Jinan University, Guangzhou, 510632, China. 9. Department of Microbiology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, 510080, China. 10. Department of Pharmacology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, 510080, China. liny96@mail.sysu.edu.cn. 11. Department of Medical Statistics and Epidemiology, School of Public Health, Sun Yat-sen University, Guangzhou, 510080, China. liny96@mail.sysu.edu.cn. 12. Department of Pharmacology, School of Medicine, Jinan University, Guangzhou, 510632, China. haipeng23@163.com. 13. Institute of Medical Microbiology, Jinan University, Guangzhou, 510632, China. haipeng23@163.com. 14. Department of Pharmacology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, 510080, China. ygm@mail.sysu.edu.cn.
Abstract
Oncolytic virotherapy is a promising therapeutic strategy that uses replication-competent viruses to selectively destroy malignancies. However, the therapeutic effect of certain oncolytic viruses (OVs) varies among cancer patients. Thus, it is necessary to overcome resistance to OVs through rationally designed combination strategies. Here, through an anticancer drug screening, we show that DNA-dependent protein kinase (DNA-PK) inhibition sensitizes cancer cells to OV M1 and improves therapeutic effects in refractory cancer models in vivo and in patient tumour samples. Infection of M1 virus triggers the transcription of interferons (IFNs) and the activation of the antiviral response, which can be abolished by pretreatment of DNA-PK inhibitor (DNA-PKI), resulting in selectively enhanced replication of OV M1 within malignancies. Furthermore, DNA-PK inhibition promotes the DNA damage response induced by M1 virus, leading to increased tumour cell apoptosis. Together, our study identifies the combination of DNA-PKI and OV M1 as a potential treatment for cancers.
Oncolytic virotherapy is a promising therapeutic strategy that uses replication-competent viruses to selectively destroy malignancies. However, the therapeutic effect of certain oncolytic viruses (OVs) varies among cancerpatients. Thus, it is necessary to overcome resistance to OVs through rationally designed combination strategies. Here, through an anticancer drug screening, we show that DNA-dependent protein kinase (DNA-PK) inhibition sensitizes cancer cells to OV M1 and improves therapeutic effects in refractory cancer models in vivo and in patienttumour samples. Infection of M1 virus triggers the transcription of interferons (IFNs) and the activation of the antiviral response, which can be abolished by pretreatment of DNA-PK inhibitor (DNA-PKI), resulting in selectively enhanced replication of OV M1 within malignancies. Furthermore, DNA-PK inhibition promotes the DNA damage response induced by M1 virus, leading to increased tumour cell apoptosis. Together, our study identifies the combination of DNA-PKI and OV M1 as a potential treatment for cancers.
Oncolytic viruses are viruses that can selectively infect or replicate in and kill cancer cells but not normal cells, thus making them potentially therapeutically useful[1]. OVs destroy malignancies by inducing direct oncolysis, stimulating antitumour immune responses, or promoting tumour-vasculature shutdown[2].Alphavirus M1 was isolated from culicine mosquitoes collected on the Hainan Island of China and belongs to the Togavirus family of viruses[3-5]. We previously reported that M1 virus selectively kills tumours deficient in zinc-finger antiviral protein (ZAP)[6]. Further investigation demonstrated the safety of M1 virus in nonhuman primates[7]. These data support M1 virus as a promising oncolytic virus in clinical cancer therapy.Tumours are often incapable of producing or responding to interferon (IFN); therefore, OVs can take advantage of this vulnerability to selectively replicate and kill tumours[8]. Although aberrations in cellular antiviral response occur frequently in tumours, the magnitude of the defect is quite variable and can be a barrier to effective OV replication and spread in tumour sites[9-12]. While M1 can cure animals of some tumours deficient in the interferon response pathway, nearly 40% of cancer cell lines are refractory to M1 virus[13]. Indeed, several OVs are being developed that express viral gene products to combat cellular innate immune responses[14,15]; however, this genetic modification ultimately carries some level of risk and could compromise the excellent safety record OVs have enjoyed to date[2,16].Using small molecules to selectively enhance OV growth and replication in tumour sites has been proven to be a promising approach[12,17-19]. In the present study, we screened a small molecule library to discover novel sensitizers of M1-mediated oncolysis. We report here that DNA-PK inhibitors specifically enhance the growth and spread of oncolytic virus M1 in cancer cells. DNA-PK has been reported to be important for interferon regulatory factor 3 (IRF-3)-dependent innate immunity[20,21]; therefore, we demonstrated that inhibition of DNA-PK can attenuate the innate immune response and promote virus replication in cancer cells. We also found that DNA-PK inhibitors could promote the DNA damage response induced by M1 virus, leading to enhanced tumour cell apoptosis. Together, this finding provides a rationale for exploring the combination of OV M1 and DNA-PKI in the treatment of cancers.
Results
Anticancer drug screening identifies sensitizers for OV M1
To evaluate the oncolytic efficiency of M1 virus, a variety of commonly used cancer cell lines (Fig. 1a) were treated with M1 (MOI = 0.1, 1, 10), and the cell viability was measured 48 h later. It was obviously observed that 5 of 18 cancer cell lines were refractory to M1 virus infection even at a high titre (MOI = 10). These data indicate that it is meaningful to improve the oncolytic activity of M1 in refractory tumour cells and promote the applied range of OV M1 in clinic.
Fig. 1
Combinatorial drug screening identifies DNA-PKI NU7441 as the top sensitizer for OV M1. a Relative cell viability in 18 tumour cell lines treated with M1 (MOI = 10, 1 or 0.1). For each cell line, the percent cell inhibition is colour-coded by quartile. b A flow diagram of the drug-screening protocol. HCT-116 cells were treated with increasing doses of each compound in the absence or presence of M1 virus (MOI = 1) for 72 h. Then, cell viability was measured by the MTT assay. c Representative compounds for drug screening. Dose–response curves were generated for each drug in the absence or presence of M1 virus, and the DAUC (fold) was calculated according to the formula (AUCSingle−AUCCombined)/AUCCombined; the orange areas represent DAUC. d The agents were ranked according to DAUC (fold) between two dose–response curves for the HCT-116 cell line. Each dot represents one candidate drug from the anticancer compound library. e Top 10 candidate compounds identified through this screening. f IC50 isobolograms of the combined effects of NU7441/M1 in HCT-116 and BxPC-3 cell lines. The x and y axes represent equieffect doses for 50% cell killing by M1 and NU7441, respectively. The observed data points are indicated by the empty triangles
Combinatorial drug screening identifies DNA-PKI NU7441 as the top sensitizer for OV M1. a Relative cell viability in 18 tumour cell lines treated with M1 (MOI = 10, 1 or 0.1). For each cell line, the percent cell inhibition is colour-coded by quartile. b A flow diagram of the drug-screening protocol. HCT-116 cells were treated with increasing doses of each compound in the absence or presence of M1 virus (MOI = 1) for 72 h. Then, cell viability was measured by the MTT assay. c Representative compounds for drug screening. Dose–response curves were generated for each drug in the absence or presence of M1 virus, and the DAUC (fold) was calculated according to the formula (AUCSingle−AUCCombined)/AUCCombined; the orange areas represent DAUC. d The agents were ranked according to DAUC (fold) between two dose–response curves for the HCT-116 cell line. Each dot represents one candidate drug from the anticancer compound library. e Top 10 candidate compounds identified through this screening. f IC50 isobolograms of the combined effects of NU7441/M1 in HCT-116 and BxPC-3 cell lines. The x and y axes represent equieffect doses for 50% cell killing by M1 and NU7441, respectively. The observed data points are indicated by the empty trianglesTo identify potential strategies for overcoming tumour resistance to M1 virus, we performed a combinatorial drug screening in the refractory HCT-116colorectal cancer cell line using 47 agents that inhibit pathways involved in growth, metabolism and apoptosis (Supplementary Table 1). Cell viability was measured after treatment with increasing doses of candidate drugs in the presence or absence of M1 virus (Fig. 1b, c). M1 virus (MOI = 1) alone caused slight inhibition of cell viability in the HCT-116 cell line (~12.4% cell viability inhibition) over the course of the assay. Differences in the area under the curve (DAUC) with or without M1 virus for each agent were calculated.Through this drug screening, agents were ranked according to the DAUC (Fig. 1d). The DNA-PK inhibitor NU7441 was identified as the best sensitizer for oncolytic virus M1 (DAUC = 2.58, Fig. 1e). Our screening data also identified the ATM (Ataxia telangiectasia mutated) inhibitor KU-60019 as the second-best sensitizer (DAUC = 2.27, Fig. 1e). Interestingly, both DNA-PK and ATM are components of the DNA damage response (DDR) pathway, demonstrating that the DDR pathway may restrict the oncolytic efficacy of OV M1. Several other drug classes, including the CDK4/6 (cyclin-dependent kinase 4/6) inhibitor palbociclib isethionate and the c-MET (cellular mesenchymal to epithelial transition factor) inhibitor SU11274 were also identified as potential sensitizers for the OV M1 (DAUC > 1, Fig. 1e).To further understand whether the improved cytotoxicity of NU7441/M1 combination is due to an additive effect or a synergistic effect, an analysis using Isobologram was used[22]. All the observed half maximal inhibitory concentration (IC50) of combinations were under the line of additivity, suggesting a synergistic effect of NU7441 and OV M1 (Fig. 1f).
DNA-PK inhibition sensitizes cancer cells to OV M1
DNA-PK is a serine/threonine protein kinase complex composed of a Ku heterodimer (Ku70/Ku80) and a catalytic subunit (DNA-PKcs) that plays important roles in DNA damage repair. When DNA double-strand breaks occur, the Ku heterodimer recognizes free DNA ends and recruits DNA-PKcs, activating its catalytic activity. Then, a complex of proteins is recruited to the site of the breakage and together repair double-strand breaks (DSB), promoting mammalian nonhomologous end-joining (NHEJ). In the event of severe DNA damage, DNA-PK induces programmed cell death[23,24]. As DNA-PK was recently identified as a candidate driver of tumour progression, it also became a potential anticancer target[25,26].NU7441 is a highly potent and selective DNA-PK inhibitor[27,28], which was identified as the top sensitizer for M1 virus through drug screening. To further assess if DNA-PK inhibition can enhance oncolytic activity in other cell lines, we tested NU7441 and M1 combination treatment in five cancer cell lines and five normal cell lines. Our data showed that NU7441 selectively enhanced the oncolytic effect of OV M1 in cancer cells at varying degrees but not normal cells (Fig. 2a). Moreover, two other DNA-PK inhibitors, NU7026 and KU0060648, also significantly improved the oncolytic effect of M1 in HCT-116 cells (Fig. 2b, c). It is noteworthy that both NU7026 and KU0060648 can also target PI3K at higher concentrations. To assess whether the enhanced cancer killing effect is due to an off-target effect, we used two PI3K selective inhibitors (3-MA and GDC0941)[29,30] and three siRNAs targeting PI3KCA. Data showed that PI3K inhibition did not improve the oncolytic efficacy of M1 virus in HCT-116 cells (Supplementary Fig. 1).
Fig. 2
DNA-PK inhibition enhances anticancer activity of OV M1. a Cells were incubated with increasing concentrations of NU7441 (0.5, 1, 2, 4, 8 μM) in the absence or presence of M1 virus (MOI = 1), and the differences in the AUC (fold) between two dose–response curves for each cell line were calculated according to the formula (AUCSingle – AUCCombined)/AUCCombined. b, c Relative cell viability in HCT-116 cells treated with vehicle, M1, DNA-PK inhibitors (NU7026: 8 μM or KU0060648: 100 nM, KU represents KU0060648), or a combination. n = 3. d, f, Western blot of the cells infected with siRNAs targeting DNA-PKcs. NC, negative control siRNA; 1, 2 and 3 represent three siRNAs targeting DNA-PKcs. e, g, Relative cell viability of tumour cells treated with siRNA targeting DNA-PKcs (48 h), followed by M1 virus infection (MOI = 1). NC, negative control siRNA. n = 3. Data shown as the mean ± SD in b, c, e, g. **P < 0.01; ***P < 0.001 by one-way ANOVA for b, c or two-tailed Student’s t-test for e, g
DNA-PK inhibition enhances anticancer activity of OV M1. a Cells were incubated with increasing concentrations of NU7441 (0.5, 1, 2, 4, 8 μM) in the absence or presence of M1 virus (MOI = 1), and the differences in the AUC (fold) between two dose–response curves for each cell line were calculated according to the formula (AUCSingle – AUCCombined)/AUCCombined. b, c Relative cell viability in HCT-116 cells treated with vehicle, M1, DNA-PK inhibitors (NU7026: 8 μM or KU0060648: 100 nM, KU represents KU0060648), or a combination. n = 3. d, f, Western blot of the cells infected with siRNAs targeting DNA-PKcs. NC, negative control siRNA; 1, 2 and 3 represent three siRNAs targeting DNA-PKcs. e, g, Relative cell viability of tumour cells treated with siRNA targeting DNA-PKcs (48 h), followed by M1 virus infection (MOI = 1). NC, negative control siRNA. n = 3. Data shown as the mean ± SD in b, c, e, g. **P < 0.01; ***P < 0.001 by one-way ANOVA for b, c or two-tailed Student’s t-test for e, gFurthermore, as we expected, knockdown of DNA-PK promoted the oncolytic activity of M1 virus in HCT-116 and BxPC-3 cells (Fig. 2d–g). Collectively, these data suggest that DNA-PK inhibition enhances M1-mediated oncolysis in refractory tumour cells.
DNA-PK inhibition suppresses the antiviral response
To gain an understanding of how DNA-PK inhibitors enhance the oncolytic efficacy of M1, we first evaluated the effect of DNA-PK inhibitors on M1 replication. Fluorescence microscopy showed that the DNA-PK inhibitor enhanced M1 replication through HCT-116 and BxPC-3 cells (Fig. 3a). Single-step growth curves also revealed that DNA-PK inhibitor promoted virus replication in the above cell lines (Fig. 3b). The production of the viral proteins E1 and NS3 was significantly increased after pretreatment with NU7441 (Fig. 3c). Furthermore, similar results were obtained using siRNA against DNA-PKcs; Knockdown of DNA-PKcs increased the production of virus in HCT-116 and BxPC-3 cells (Fig. 3d). These data indicate that DNA-PK inhibition can enhance virus replication in refractory tumour cells.
Fig. 3
DNA-PK inhibition increases the replication of M1 virus in refractory tumour cells. a HCT-116 or BxPC-3 cells were infected with M1-GFP (MOI = 1) in the presence or absence of NU7441 (1 μM) for 24 h, after which the phase-contrast and fluorescence microscopy images were captured. Scale bar: 50 μm. b HCT-116 or BxPC-3 cells were infected with M1-GFP (MOI = 1) in the presence or absence of NU7441 (1 μM). Single-step growth analyses were conducted. n = 4. c HCT-116 or BxPC-3 cells infected with M1-GFP (MOI = 1) in the presence or absence of NU7441 (1 μM), viral structural protein E1 and the non-structural protein NS3 were analyzed by western blot after treatment. d HCT-116 or BxPC-3 cells were treated with siRNA targeting DNA-PKcs (48 h), followed by M1 virus infection (MOI = 1), and then processed for qRT-PCR to measure the viral gene E2 and NS1. n = 3. Data represent the mean ± SD in b, d. *P < 0.05; **P < 0.01; ***P < 0.001 by two-way ANOVA for b or one-way ANOVA for d
DNA-PK inhibition increases the replication of M1 virus in refractory tumour cells. a HCT-116 or BxPC-3 cells were infected with M1-GFP (MOI = 1) in the presence or absence of NU7441 (1 μM) for 24 h, after which the phase-contrast and fluorescence microscopy images were captured. Scale bar: 50 μm. b HCT-116 or BxPC-3 cells were infected with M1-GFP (MOI = 1) in the presence or absence of NU7441 (1 μM). Single-step growth analyses were conducted. n = 4. c HCT-116 or BxPC-3 cells infected with M1-GFP (MOI = 1) in the presence or absence of NU7441 (1 μM), viral structural protein E1 and the non-structural protein NS3 were analyzed by western blot after treatment. d HCT-116 or BxPC-3 cells were treated with siRNA targeting DNA-PKcs (48 h), followed by M1 virus infection (MOI = 1), and then processed for qRT-PCR to measure the viral gene E2 and NS1. n = 3. Data represent the mean ± SD in b, d. *P < 0.05; **P < 0.01; ***P < 0.001 by two-way ANOVA for b or one-way ANOVA for dTo address the mechanism of DNA-PK inhibition facilitating the replication of the virus, we therefore used gene expression microarrays to gain insight into the possible mechanisms involved. Gene ontology analysis of the differentially expressed genes between cells treated with vehicle or M1 revealed a highly significant enrichment of genes related to IFN signalling (Fig. 4a), indicating that activation of IFN pathway inhibits the replication of M1 virus and differing responsiveness of IFN may be responsible for the susceptibility of OV M1. To illustrate this, three sensitive cell lines and three refractory cell lines were exposed to IFN-β, and IRF9 expression was detected as an IFN-responsive gene. Indeed, we found that sensitive cell lines had a poor IFN responsiveness, in that minor induction IRF9 was observed after IFN-β treatment. In M1 refractory cell lines, on the contrary, IFN-β-induced significant increase of IRF9 (Fig. 4b).
Fig. 4
DNA-PK inhibitors hinders M1 virus-induced IFN antiviral response. a Gene ontology analysis of the pathways that are overrepresented among the differentially expressed genes between the M1-treated or vehicle-treated HCT-116 cells. b Cells were treated with vehicle or IFN-β (10 ng/μl) for 16 h. Induction of IRF-9 was analysed by western blot. c–h HCT-116 cells were treated with vehicle or NU7441 (1 μM, NU represent NU7441) and M1 virus (MOI = 1) for 24 h and then processed for the qRT-PCR to measure IFN-stimulated gene transcripts. n = 3. Data represent the mean ± SD. *P < 0.05; **P < 0.01 by one-way ANOVA. i HCT-116 cells were pre-treated with NU7441 (1 μM) for 1 h and then infected with M1-GFP at an MOI of 10 in the presence or absence of recombinant IFNα (1000 units/ml). GFP expression was monitored 48 h after M1 inoculation. Scale bar: 50 μm
DNA-PK inhibitors hinders M1 virus-induced IFN antiviral response. a Gene ontology analysis of the pathways that are overrepresented among the differentially expressed genes between the M1-treated or vehicle-treated HCT-116 cells. b Cells were treated with vehicle or IFN-β (10 ng/μl) for 16 h. Induction of IRF-9 was analysed by western blot. c–h HCT-116 cells were treated with vehicle or NU7441 (1 μM, NU represent NU7441) and M1 virus (MOI = 1) for 24 h and then processed for the qRT-PCR to measure IFN-stimulated gene transcripts. n = 3. Data represent the mean ± SD. *P < 0.05; **P < 0.01 by one-way ANOVA. i HCT-116 cells were pre-treated with NU7441 (1 μM) for 1 h and then infected with M1-GFP at an MOI of 10 in the presence or absence of recombinant IFNα (1000 units/ml). GFP expression was monitored 48 h after M1 inoculation. Scale bar: 50 μmMoreover, we found that antiviral factors, including IRF9, IFNL1, OASL, IFIT1, IFIT2 and IFIT3 were significantly upregulated in HCT-116 after M1 treatment (Fig. 4c–h). In contrast, DNA-PK inhibitor NU7441 could abrogate the induced expression of genes related to the interferon cascade (Fig. 4c–h). We further evaluated virus replication in the presence or absence of IFNα. As predicted, M1-GFP was severely impaired by the addition of IFNα, but this protective effect was reversed by the pretreatment of HCT-116 cells with NU7441 (Fig. 4i). Our data support the notion that DNA-PKI acts to inhibit the IFN signalling pathway.
DNA-PKI and M1 cooperate to trigger irresolvable ER stress
The endoplasmic reticulum (ER) functions primarily to process newly synthesized secretory and transmembrane proteins. Abnormal accumulation of misfolded proteins in this compartment causes a state of ‘ER stress’[31]. Our previous study demonstrated that massive M1 replication leads to misfolded protein accumulating in the ER, resulting in ER stress-mediated apoptosis in sensitive cancer cells[5,6]. Hence, we inferred that DNA-PK inhibition enhanced the production of M1 virus and caused prolonged and severe ER stress.Through transmission electron microscopy, we observed catastrophic destruction of the ER in HCT-116 cells after treatment with NU7441 and M1 (Fig. 5a, b). Furthermore, we examined several biomarkers of ER stress, including protein kinase RNA-like ER kinase (PERK) and its downstream phosphorylated eukaryotic translational initiation factor 2α (p-eIF2α). Levels of PERK and p-eIF2α were both elevated in the combination group compared with the single agent (Fig. 5c). We also observed an increase in apoptotic cells after NU7441 treatment and M1 infection, and apoptotic pathways involved in ER stress, including CHOP and JNK signal pathway[32], were strongly activated after M1/NU7441 treatment (Fig. 5d, e). Evidence support that mitochondrial apoptosis pathways are involved in ER stress[33], we next detected mitochondrial membrane potential (MMP) and found M1/NU7441 combination treatment induces MMP loss, indicating that mitochondrial apoptotic pathway was activated (Fig. 5f). Further, we performed Annexin V/propidine iodide staining to detect the rates of tumour cell apoptosis. The percentage of early apoptotic cells was remarkably higher in the combination group than with the M1 or NU7441 treatment alone (Fig. 5g, h).
Fig. 5
DNA-PK inhibitors plus M1 virus induces irresolvable ER stress. a Transmission electron microscopy (TEM) images of tumours after 36 h of treatment with vehicle, NU7441 (1 μM), M1 (MOI = 1) or NU7441/M1. Scale bar: 1 μm. b Higher magnification images from the red box in a. Orange arrows indicate the ER in the tumours. Relative sizes of the ER are indicated by red lines. Scale bar: 0.5 μm. c Cells were treated with vehicle, NU7441 (1 μM), M1 (MOI = 1) or NU7441/M1 for 48 h, and proteins of ER stress markers were analysed by western blot. d Cells were treated with NU7441(1 μM), M1(MOI = 1) or the combination for 48 h. Hoechst 33342 staining was used to stain nuclei of cells. Red arrows indicate the condensed nuclei. Scale bars: 50 μm. e Cells were treated with vehicle, NU7441 (1 μM), M1 (MOI = 1) or NU7441/M1 for 48 h, ER stress-associated apoptotic pathways, including the JNK (Jun N-terminal kinase) pathway and the CHOP (C/EBP-homologous protein) pathway, were analysed by western blot. f JC-1 staining was applied for assessing mitochondrial membrane potential in HCT-116 cells after treatment with drugs for 48 h. Scale bars: 50 μm. g HCT-116 cells were infected with M1 (MOI = 1) with or without NU7441 (1 μM) for 48 h, the cells were stained with fluorescein isothiocyanate-conjugated Annexin V/propidium iodide, and flow cytometric analysis was performed. h Quantification of apoptosis rates from g. n = 3. i, j Cells were treated with vehicle, NU7441 (4 μM), M1 (MOI = 1) or NU7441/M1 for 24 h. CRT exposure was examined by flow cytometry (i) and ATP secretion in supernatant was detected by bioluminescence detection kit for ATP (j). n = 3. Data represent the mean ± SD in h–j. *P < 0.05; **P < 0.01; ***P < 0.001 by one-way ANOVA
DNA-PK inhibitors plus M1 virus induces irresolvable ER stress. a Transmission electron microscopy (TEM) images of tumours after 36 h of treatment with vehicle, NU7441 (1 μM), M1 (MOI = 1) or NU7441/M1. Scale bar: 1 μm. b Higher magnification images from the red box in a. Orange arrows indicate the ER in the tumours. Relative sizes of the ER are indicated by red lines. Scale bar: 0.5 μm. c Cells were treated with vehicle, NU7441 (1 μM), M1 (MOI = 1) or NU7441/M1 for 48 h, and proteins of ER stress markers were analysed by western blot. d Cells were treated with NU7441(1 μM), M1(MOI = 1) or the combination for 48 h. Hoechst 33342 staining was used to stain nuclei of cells. Red arrows indicate the condensed nuclei. Scale bars: 50 μm. e Cells were treated with vehicle, NU7441 (1 μM), M1 (MOI = 1) or NU7441/M1 for 48 h, ER stress-associated apoptotic pathways, including the JNK (Jun N-terminal kinase) pathway and the CHOP (C/EBP-homologous protein) pathway, were analysed by western blot. f JC-1 staining was applied for assessing mitochondrial membrane potential in HCT-116 cells after treatment with drugs for 48 h. Scale bars: 50 μm. g HCT-116 cells were infected with M1 (MOI = 1) with or without NU7441 (1 μM) for 48 h, the cells were stained with fluorescein isothiocyanate-conjugated Annexin V/propidium iodide, and flow cytometric analysis was performed. h Quantification of apoptosis rates from g. n = 3. i, j Cells were treated with vehicle, NU7441 (4 μM), M1 (MOI = 1) or NU7441/M1 for 24 h. CRT exposure was examined by flow cytometry (i) and ATP secretion in supernatant was detected by bioluminescence detection kit for ATP (j). n = 3. Data represent the mean ± SD in h–j. *P < 0.05; **P < 0.01; ***P < 0.001 by one-way ANOVAIt has been proved that ER stress induced by oncolytic virus may elicit immunogenic cell death (ICD), which release immunostimulatory signals that can lead to antitumour immunity[34]. During ICD, tumour cells express calreticulin (CRT) on the cell surface that attracts antigen-presenting cells (APCs)[35]. Moreover, dying cells release immunomodulatory molecules such as adenosine triphosphate (ATP) into the extracellular microenvironment, leading to potent antigen presentation[36]. APCs that take up tumour-associated antigens migrate to the lymph nodes to present antigens to T cells for establishment of anticancer immunity[34]. To figure out whether NU7441/M1 combined treatment can induce ICD, calreticulin (CRT) exposure and ATP secretion were examined. Slight increase of CRT exposure and ATP secretion were detected after either M1 virus or NU7441 treatment alone. Combination treatment triggered more significant increase of the ICD hallmarks (Fig. 5i, j), suggesting that ICD was induced by NU7441 plus OV M1.Together, these data provide evidence that the combination of NU7441 with M1 induces irresolvable ER stress, which triggers the ER stress-associated apoptosis and immunogenic cell death.
DNA-PK inhibition enhances M1-mediated DNA damage response
Previous studies have reported that the HSV and KSHV virus causes DNA damage that is associated with the phosphorylation of H2AX (p-H2AX), a sensitive marker of DNA double-strand breaks (DSBs)[37]. Most DSBs in human cells are repaired by nonhomologous end-joining (NHEJ) that directly ligates broken DNA ends via a critical regulator DNA-PK. Here, we speculated that enhanced replication of M1 virus by DNA-PK inhibition may induce DNA damage in cancer cells; meanwhile, the inhibition of DNA-PK hinders DSB repair in those cells, which promotes cell apoptosis.To test our hypothesis, we first assessed DSBs via the neutral comet assay[38]. Either NU7441 or M1 virus treatment alone slightly increased tail moments, while the combination of both had a significant induction of DSBs (Fig. 6a, b, Supplementary Fig. 3a, b). We next sought to find out whether the M1-induced DSBs lead to activation of DNA-PK and ATM, two critical members of DNA repair system. Expression of p-DNA-PKcs and p-ATM were both upregulated after M1 infection in both HCT-116 cells and BxPC-3 cells (Fig. 6c, d), providing direct evidence of activation of DDR pathway.
Fig. 6
The combination of DNA-PK inhibitors and M1 virus-induced enhanced DNA damage response. a Cells were treated with vehicle, NU7441 (1 μM), M1 (MOI = 1) or NU7441/M1 for 36 h, and comet assay was used to assess double-strand breaks (DSBs). b Quantification of tail moment from a. Box-and-whisker plots show the median (horizontal line), interquartile range (box) and min to max of the data. 62, 61, 60 and 64 cells of vehicle, NU7441, M1 and NU7441/M1 groups, were analyzed, ***P < 0.001 by Kruskal–Wallis test. c, d Immunoblots of proteins after infection with M1 virus (MOI = 1) for 0, 24, 36 and 48 h. e, f Cells were exposed to NU7441 (1 μM), M1 (MOI = 1) or a combination as indicated. p-H2AX (a marker of DNA damage response), cleaved-caspase-3 (a marker of apoptosis) and p-DNA-PKcs (target of NU7441) were determined by western blot. g, h Cells were transfected with siRNA targeting DNA-PKcs (48 h), and this was followed by M1 virus infection (MOI = 1) for 48 h. Proteins were examined by western blot
The combination of DNA-PK inhibitors and M1 virus-induced enhanced DNA damage response. a Cells were treated with vehicle, NU7441 (1 μM), M1 (MOI = 1) or NU7441/M1 for 36 h, and comet assay was used to assess double-strand breaks (DSBs). b Quantification of tail moment from a. Box-and-whisker plots show the median (horizontal line), interquartile range (box) and min to max of the data. 62, 61, 60 and 64 cells of vehicle, NU7441, M1 and NU7441/M1 groups, were analyzed, ***P < 0.001 by Kruskal–Wallis test. c, d Immunoblots of proteins after infection with M1 virus (MOI = 1) for 0, 24, 36 and 48 h. e, f Cells were exposed to NU7441 (1 μM), M1 (MOI = 1) or a combination as indicated. p-H2AX (a marker of DNA damage response), cleaved-caspase-3 (a marker of apoptosis) and p-DNA-PKcs (target of NU7441) were determined by western blot. g, h Cells were transfected with siRNA targeting DNA-PKcs (48 h), and this was followed by M1 virus infection (MOI = 1) for 48 h. Proteins were examined by western blotFurthermore, we observed that the expression of p-H2AX (a marker of DNA damage response) and cleaved-caspase-3 (a marker of cell apoptosis) were strongly induced after combined treatment with M1 and NU7441 compared with either treatment alone (Fig. 6e, f). These data imply that M1 infection causes slight DNA damage and activates DNA-PK, the DNA repair machinery, whose suppression by NU7441 leads to extensive DNA damage and promotes cell apoptosis. In addition, knockdown of DNA-PK also manipulated DNA damage connected with DSBs. We found that the expression of the viral protein E1, p-H2AX and cleaved-caspase-3 was upregulated in siDNA-PK-treated groups compared to the negative control group after M1 infection (Fig. 6g, h). It is worth noting that H2AX is phosphorylated predominantly by ATM and DNA-PK following DNA damage[39,40]. Since the increase in p-H2AX can still be observed when DNA-PK is inhibited, the actual induction level in DNA damage in the presence of both DNA-PK inhibitor and oncolytic virus M1 may be underestimated by the p-H2AX western blot. Above all, our data demonstrates that DNA-PK inhibition also potentiates DNA damage-mediated cell death besides the activation of the severe ER stress.
DNA-PKI plus OV M1 is effective in vivo and patient samples
To evaluate the anticancer activity of M1/DNA-PKI in vivo, mice with subcutaneous HCT-116 and BxPC-3tumours were treated with (i) intravenous M1 virus, (ii) intraperitoneal NU7441 injection or (iii) a combination of the two. M1 virus plus NU7441 treatment significantly restricted tumour growth compared with monotherapies alone (Fig. 7a–f). Meanwhile, there were no significant differences in body weight among these groups (Supplementary Fig. 4a, b). At the endpoint, the levels of p-H2AX, Ki-67 and cleaved-caspase-3 were further examined in the subcutaneous xenograft tumour sections by immunohistochemistry staining. We observed that Ki-67 was downregulated, while p-H2AX and cleaved-caspase-3 were elevated in the combined treatment group compared with the single treatment groups (Fig. 7g, h).
Fig. 7
Inhibiting DNA-PK enhances oncolytic therapy in murine cancer models and patient tumour samples. a Timeline of the experimental setup for b, c. b, c HCT-116 xenografts were treated with vehicle, M1 virus (2 × 106 pfu, i.v., intravenously injection), NU7441 (10 mg/kg/day, i.p., intraperitoneal.) or a combination. Vehicle, n = 6; M1, n = 6; NU7441, n = 7; NU7441 + M1, n = 7. b Tumour growth presented as the mean tumour volume ± SD. **P < 0.01 for NU7441 + M1 group versus single agents. Statistical significance was using repeated measure ANOVA. c Representative images of tumours from each group in b at the experimental endpoints. d Timeline of the experimental setup for e, f. e, f BxPC-3 xenografts were treated with vehicle, M1 virus (2 × 106 pfu, i.v., intravenously injection), NU7441 (10 mg/kg/day, i.p., intraperitoneal.) or a combination. Vehicle, n = 5; M1, n = 5; NU7441, n = 5; NU7441 + M1, n = 7. e Tumour growth is presented as the mean tumour volume ± SD. **P < 0.01 for NU7441 + M1 group versus single agents. Statistical significance was using repeated measure ANOVA. f Representative images of tumours from each group in e at the experimental endpoints. g Tumour tissues from c were evaluated through immunohistochemistry for p-H2AX (a marker of DSBs), Ki-67 (a marker of proliferation) and cleaved-caspase-3 (a marker of cell apoptosis). Scale bar: 50 μm. h Tumour tissues from f were evaluated through immunohistochemistry for p-H2AX, Ki-67 and cleaved-caspase-3. Scale bar: 50 μm. i Tumour infiltrating T cells from immunocompetent C57/BL6 mice were evaluated through immunohistochemistry for CD4 and CD8. Scale bar: 50 μm. j Primary colorectal tumour cells isolated from six patients were treated with vehicle, NU7441 (1 μM), M1 (MOI = 1) or a combination for 72 h, and cell viability was assessed. P represent Patient
Inhibiting DNA-PK enhances oncolytic therapy in murinecancer models and patienttumour samples. a Timeline of the experimental setup for b, c. b, c HCT-116 xenografts were treated with vehicle, M1 virus (2 × 106 pfu, i.v., intravenously injection), NU7441 (10 mg/kg/day, i.p., intraperitoneal.) or a combination. Vehicle, n = 6; M1, n = 6; NU7441, n = 7; NU7441 + M1, n = 7. b Tumour growth presented as the mean tumour volume ± SD. **P < 0.01 for NU7441 + M1 group versus single agents. Statistical significance was using repeated measure ANOVA. c Representative images of tumours from each group in b at the experimental endpoints. d Timeline of the experimental setup for e, f. e, f BxPC-3 xenografts were treated with vehicle, M1 virus (2 × 106 pfu, i.v., intravenously injection), NU7441 (10 mg/kg/day, i.p., intraperitoneal.) or a combination. Vehicle, n = 5; M1, n = 5; NU7441, n = 5; NU7441 + M1, n = 7. e Tumour growth is presented as the mean tumour volume ± SD. **P < 0.01 for NU7441 + M1 group versus single agents. Statistical significance was using repeated measure ANOVA. f Representative images of tumours from each group in e at the experimental endpoints. g Tumour tissues from c were evaluated through immunohistochemistry for p-H2AX (a marker of DSBs), Ki-67 (a marker of proliferation) and cleaved-caspase-3 (a marker of cell apoptosis). Scale bar: 50 μm. h Tumour tissues from f were evaluated through immunohistochemistry for p-H2AX, Ki-67 and cleaved-caspase-3. Scale bar: 50 μm. i Tumour infiltrating T cells from immunocompetent C57/BL6mice were evaluated through immunohistochemistry for CD4 and CD8. Scale bar: 50 μm. j Primary colorectal tumour cells isolated from six patients were treated with vehicle, NU7441 (1 μM), M1 (MOI = 1) or a combination for 72 h, and cell viability was assessed. P represent PatientGiven that the combination of NU7441 and M1 elicit ER stress-induced ICD, we sought to analyze the composition and activation status of tumour microenvironment after the combined therapy in two immunocompetent mouse models with MC38 colon cancer and Pan02 pancreatic ductal adenocarcinoma cells (our data demonstrated that DNA-PK inhibitor can improve the oncolytic efficacy of M1 virus in both two mousetumour cell lines in vitro, shown in Supplementary Fig. 5). Immunohistochemistry staining results showed that M1 monotherapy recruited CD4+ and CD8+ T cells in both models and combined therapy induced more infiltrating T cells (Fig. 7i). These data suggest that the combination approach can activate the antitumour immune immunity to participate in tumour cell clearance.To validate the clinical relevance of this therapeutic strategy, we examined the anticancer activity of M1/DNA-PKI in freshly derived patienttumour samples. Primary colorectal tumour cells from six patients were treated with NU7441, M1 virus, or a combination. In agreement with our previous observation, NU7441 sensitized tumour cells to M1 virus-mediated cell death (Fig. 7j). Collectively, these data indicate that this combinatorial therapeutic strategy is tolerable and effective in the treatment of cancers in vivo and in patienttumour samples.
Discussion
Alphavirus M1 is a promising anticancer therapeutic. As we prepare to evaluate M1 in the clinical setting, preclinical studies should realistically assess the limitations of the virus as a monotherapy and explore opportunities to enhance viral oncolytic efficacy. Identifying small molecules that act synergistically with M1 virus may be an effective strategy for optimizing tumour cell killing. In this study, through an anticancer drug screen, we discovered that DNA-PK inhibitors can cooperate with oncolytic virus M1 by promoting virus replication and increasing the virus-mediated DNA damage response in refractory tumour cells (Fig. 8). We show here that DNA-PK inhibitors elicit these two effects simultaneously, further dissecting that their individual influences can provide deeper understanding of their interplay and contribution to the observed phenomena.
Fig. 8
Graphical model of DNA-PKI and OV M1 combination therapy. A subset of tumour cells are innately resistant to oncolytic virus M1, and infection induces the production of type I IFN, which hampers viral replication. Treatment with DNA-PK inhibitors blocks the IFN antiviral response induced by M1 virus, resulting in increased virus replication, and triggers prolonged and severe ER stress. In addition, M1 virus causes DNA damage in tumour cells. In response to DNA damage, DDR pathways are immediately activated by PI3K-related kinases, including DNA-PK, to maintain gene stability. Thus, co-treatment with DNA-PK inhibitors hinder the DNA repair function and promote DNA damage induced by M1 virus. Above all, the DNA-PK inhibitors act synergistically with OV M1 by attenuating the IFN antiviral pathway and increasing DNA damage-mediated cell apoptosis
Graphical model of DNA-PKI and OV M1 combination therapy. A subset of tumour cells are innately resistant to oncolytic virus M1, and infection induces the production of type I IFN, which hampers viral replication. Treatment with DNA-PK inhibitors blocks the IFN antiviral response induced by M1 virus, resulting in increased virus replication, and triggers prolonged and severe ER stress. In addition, M1 virus causes DNA damage in tumour cells. In response to DNA damage, DDR pathways are immediately activated by PI3K-related kinases, including DNA-PK, to maintain gene stability. Thus, co-treatment with DNA-PK inhibitors hinder the DNA repair function and promote DNA damage induced by M1 virus. Above all, the DNA-PK inhibitors act synergistically with OV M1 by attenuating the IFN antiviral pathway and increasing DNA damage-mediated cell apoptosisEukaryotic cells possess intrinsic defence mechanisms against infections by viruses that directly restrict viral replication and assembly upon infection via ubiquitously existing proteins[18]. During the evolution of malignancies, genetic abnormalities accumulate that provide cancer cells with growth and survival advantages but at the same time compromise the ability of individual tumour cells to mount a robust antiviral response[10,12,41-43]. For this reason, oncolytic viruses can selectively infect and spread in tumour sites. Although defects in cellular innate immunity are commonly found in tumour cells, the extent of the defect is quite variable[12,44,45]. Our data demonstrated that M1 infection induces the activation of antiviral factors in refractory cancer cells, restricting M1 replication and oncolysis. Nevertheless, we observed that DNA-PK inhibitors abrogate the induced expression of the genes related to interferon cascade and promote virus replication in the refractory tumour cells. Increased production of M1 consequently induces prolonged and severe ER stress, which has been reported in our previous report[6].DNA double-strand breaks (DSBs) are the most cytotoxic and are repaired by two major pathways, with nonhomologous end-joining (NHEJ) being the most active in both replicating and non-replicating cells alike[25]. Tumour cells may be ‘addicted’ to compensatory DDR pathways, unregulated or otherwise, for survival[46], potentially contributing to therapeutic resistance. Therefore, DDR pathways make an ideal target for therapeutic intervention: (i) to prevent or reverse therapy resistance or (ii) using a synthetic lethal approach to specifically kill cancer cells that are dependent on a compensatory DNA repair pathway for survival in the context of cancer-associated oxidative and replicative stress[46].Oncolytic viruses have been reported to induce the DNA damage response, such as parvoviruses, adenovirus and herpes simplex virus[47-49]. In this study, we demonstrated that M1 virus-induced DNA damage responses associated with the phosphorylation of H2AX (p-H2AX), a sensitive marker of DSB[50]. Therefore, we sought to determine whether the DNA-PK inhibitor could abrogate the DNA repair function of tumour cells and thus promote the DDR mediated by M1 virus. As expected, the combined treatment of M1/DNA-PKI was effective in inducing robust DNA damage and killing tumour cells.In human cells, three related kinases, ATM, ATR and DNA-PK, control DDR. In general, DDR involves DNA lesion recognition, followed by the initiation of a cellular signalling cascade to promote DNA repair[51]. DNA-PK and ATM are involved in DSB repair mediated by homologous recombination (HR) or NHEJ (J). DNA-PK acts as a sensor for DSBs, and its major role is in promoting NHEJ. ATM is a master regulator of cellular responses to DSB that activates a DSB-signalling cascade by HR or NHEJ. After recruited and activated by DSBs, ATM phosphorylates several key proteins, including p53 and CHK2, that initiate activation of the DNA damage checkpoint, leading to cell cycle arrest, DNA repair or apoptosis. Unlike the DNA-PK and ATM primary response to DSB, ATR is the apical DNA replication stress response kinase, responding to a wide range of DNA damage and DNA replication problems[52-54]. In the present study, we discovered that ATM inhibitor can also potentiate oncolytic efficiency in HCT-116 cells (Fig. 1d, e, Supplementary Table 1). These data implied that the oncolytic activity of M1 could be improved by impairing the DDR pathway.Targeting DNA-PK as a therapeutic intervention in humanmalignancy, especially to sensitize tumour cells to chemotherapy or radiotherapy, has recently been proposed to be of clinical interest. CC-122 is a DNA-PK inhibitor in phase I clinical trial (NCT01421524) for solid tumours, non-Hodgkin lymphoma and multiple myeloma. CC-115, a dual inhibitor of DNA-PK and mTOR, is currently in phase I trial (NCT01353625) for advanced solid tumours and haematologic malignancies, whereas ZSTK474 is a PI3K inhibitor that also inhibits DNA-PK, is currently in phase I trials (NCT01280487 and NCT01682473) for advanced solid malignancies. In combination with radiotherapy, phase I clinical trials (NCT02516813 and NCT02316197) of a DNA-PK inhibitor MSC2490484A in advanced solid tumours or chronic lymphocytic leukaemia are being studied. While the study of the safety, tolerability and pharmacokinetic/pharmacodynamic profile of DNA-PK inhibitor VX-984 in combination with chemotherapy (NCT02644278) has been completed. These clinically relevant DNA-PK inhibitors may provide good chances for combination therapy with oncolytic viruses.Overall, our study suggests that DNA-PK inhibitors can provide a significant therapeutic benefit combined with the oncolytic virus M1 in the treatment of cancers.
Methods
Cell lines and viruses
Primary normal cells, including human hepatocytes (HH), humanpancreatic stellate cells (HpaSteC) and human aortic endothelial cells (HAEC), were purchased from ScienCell Research Laboratories. Normal cell line L-02 is kindly provided by Shimei Zhuang. Humanglioblastoma cell line U-251 MG was obtained from Cell Bank of Type Culture Collection of Chinese Academy of Sciences. Humancolon mucosal epithelial cell line NCM460, mousecolorectal cancer cell line MC38 and mousepancreatic cancer cell line Pan02 were purchased from GuangZhou Jennio Biotech Co., Ltd (China). All other cell lines were purchased from American Type Culture Collection (Maryland, USA). None of cell lines is listed in the database of commonly misidentified cell lines maintained by ICLAC (Version 8.0). The cell lines have been authenticated by the short tandem repeat (STR) assay and were confirmed to be without mycoplasma contamination.Primary normal cells were cultured according to the instructions provided. All other cells were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% foetal bovine serum (FBS) and 1% penicillin/streptomycin. M1 was grown in Vero cells. M1 virus was obtained from Department of Pharmacology, Zhongshan School of Medicine, Sun Yat-sen University. M1-GFP is a recombinant derivative of M1 expressing jellyfish green fluorescent protein. Virus titre was determined by TCID50 using BHK-21 cells and converted to PFU.
Antibodies and reagents
Antibodies used in this study are listed as follows: DNA-PKcs (ab32566, Abcam, UK, 1:5000), phosphorylated DNA-PKcs (ab124918, Abcam, 1:5000), phosphorylated ATM (ab81292, Abcam, 1:5000), ATM (ab32420, Abcam, 1:5000), PI3KCA (ab124918, Abcam, 1:1000), phosphorylated histone H2AX (2577, Cell Signaling Technology, USA, 1:500 for IB, 1:100 for IHC), H2AX (7631, Cell Signaling Technology, 1:1000), IRF9 (76684, Cell Signaling Technology, 1:1000), eIF-2α (5324, Cell Signaling Technology, 1:1000), phosphorylated eIF-2α (3398, Cell Signaling Technology, 1:1000), JNK (9252, Cell Signaling Technology, 1:1000), phosphorylated JNK (9255, Cell Signaling Technology, 1:1000), PERK(3179, Cell Signaling Technology, 1:1000), CHOP (2895, Cell Signaling Technology, 1:1000), Ki-67 (9449 s, Cell Signaling Technology, 1:400), cleaved-caspase-3 (9664 s, Cell Signaling Technology, 1:1000 for IB, 1:500 for IHC), Caspase-3 (9662, Cell Signaling Technology, 1:1000), CD4 (25229, Cell Signaling Technology, 1:200), CD8 (98941, Cell Signaling Technology, 1:400), GAPDH (AP0063, Bioworld, USA, 1:10000), α-tubulin (ARG65693, Arigo Biolaboratories, China, 1:5000), β-tubulin (AP0064, Bioworld, 1:10000), M1 E1 and NS3 (produced by Beijing Protein Innovation, China, 1:2000). Anticancer compounds used in this study were purchased from Selleckchem.
Cell viability assays
Cells were seeded in 96-well plates at 3000 cells per well in 0.1 ml medium. After treatment, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was added to the cells (1 mg/ml final concentration), and the cells were allowed to grow at 37 °C for another 3 h. MTT-containing medium was removed, and the MTT precipitate was dissolved in 100 μl DMSO. The optical absorbance was determined at 490 nm using a microplate reader (iMark, Bio-Rad).
Drug screening
Forty-seven anticancer compounds were used to identify sensitizers of M1 virus in HCT-116 cells. Cells were seeded in 24-well plates at 4 × 104 per well in 0.5 ml medium and then treated with increasing doses of candidate agents in the presence or absence of M1 (1 PFU/cell). Cell viability was determined by an MTT assay 72 h later. Dose–response of the cancer cells in the presence (b) or absence (a) of M1 was analysed according to the cell viability. Areas under the curve (AUCs) were calculated using GraphPad Prism 6. Differences in the AUC are indicated by [area (a) − area (b)] area (b).
RNA interference
Specific and scramble siRNAs were obtained from Ribobio (Guangzhou, China). Cell medium was replaced with 10% foetal bovine serum in DMEM (without penicillin/streptomycin). SiRNAs were transfected using Lipofectamine RNAiMAX (13778-150, Thermo Fisher) with OPTI-MEM (31985070, Thermo Fisher).
Western blot analyses
Cells were lysed using the M-PER Mammalian Protein Extraction Reagent (Thermo Scientific), and sodium dodecyl sulphate–polyacrylamide gel electrophoresis was performed. Membranes were visualized on a ChemiDoc XRS + System (Bio-Rad) using Immobilon Western Chemiluminescent HRP Substrate (Millipore). Uncropped western blot images of data shown in Figs. 2–6 and Supplementary Fig. 1c can be found in Supplementary Figs. 6 and 7.
qRT-PCR
Total RNA was extracted using TRIzol (Life Technologies), and reverse transcription was performed from 3 μg total RNA using oligo(dt) and RevertAid Reverse Transcriptase (Thermo Scientific) according to the manufacturer’s recommendation. Quantitative PCR was performed with SuperReal PreMix SYBR Green (TIANGEN) using an Applied Biosystems 7500 Fast Real-Time PCR System (Life Technologies). All genes were normalized to β-actin. Amplification primers (Thermo Fisher) were as follows:DNA-PKcs sense (AGCTGGCTTGCGCCATTT),DNA-PKcs antisense (GGGCACACCACTTTAACAAGAC);M1 NS1 sense (GTTCCAACAGGCGTCACCATC), M1 NS1 antisense (ACACATTCTTGTCTAGCACAGTCC);M1 E2 sense (GTCACATACGGAAAGAGAGAACTG), M1 E2 antisense (CGGTCTATCCACTCCTCATACG);IFIT1 sense (AGAAGCAGGCAATCACAGAAAA),IFIT1 antisense (CTGAAACCGACCATAGTGGAAAT);IFIT2 sense (GACACGGTTAAAGTGTGGAGG),IFIT2 antisense (TCCAGACGGTAGCTTGCTATT);IFIT3 sense (AAAAGCCCAACAACCCAGAAT),IFIT3 antisense (CGTATTGGTTATCAGGACTCAGC);IFNL1 sense (GGAGGCATCTGTCACCTTCA),IFNL1 antisense (CCCTATGTCTCAGTCAGGGC);IRF9 sense (GCCCTACAAGGTGTATCAGTTG), IRF9 antisense (TGCTGTCGCTTTGATGGTACT);OASL sense (CCATTGTGCCTGCCTACAGAG),OASL antisense (CTTCAGCTTAGTTGGCCGATG);ACTB sense (GATCATTGCTCCTCCTGAGC),ACTB antisense (ACTCCTGCTTGCTGATCCAC).
CRT exposure
HCT-116 cells were exposed to vehicle, NU7441 (4 μM), M1 (MOI = 10) and NU7441/M1 combination for 24 h. After that, cells were harvested and stained with anti-CRTrabbit polyclonal antibody (1:100 dilution, Abcam, ab2907) on ice for 30 min. After wash with PBS, cells were stained with Alexa647 conjugated donkey anti-Rabbit IgG (H + L) secondary antibody (1:200 dilution) on ice for 30 min. After wash with PBS, all samples were kept on ice and analyzed by flow cytometry within 30 min.
ATP secretion
HCT-116 cells were exposed to vehicle, NU7441 (4 μM), M1 (MOI = 10) and NU7441/M1 combination for 24 h. After that, supernatant was collected and spun at 500×g, 5 min at 4 °C to remove the inclusion of cells or debris. ATP amounts were measured via ENLITEN® ATP Assay System (Promega) according to the kit instruction. Briefly, samples and standards (20 µl/well) are added into the plate on ice. Reconstituted rLuciferase/Luciferin Reagent (100 µl/well) are then added into each well rapidly. ATP-driven chemiluminescence signals are recorded with a luminescence microplate reader. ATP concentrations in samples are calculated with standard curves.
Neutral Comet assay
DNA double-strand breaks were measured and quantified by Single-cell Gel Electrophoresis using the CometAssay Kit (Trevigen). HCT-116 and BxPC-3 cells were seeded in 6-well plates and exposed to vehicle, NU7441 (1 μM), M1 (MOI = 1) or the combination for 36 and 48 h, respectively. Then cells were harvested by trypsinization, washed and resuspended in PBS solution. The cell suspension (105 cells/ml) was mixed with LMagarose at a ratio of 1:10 (v/v). This mixture was immediately pipette 50 µl onto the slides. After cell lysis at 4 °C for 1 h, electrophoresis was performed at 23 V for 45 min. Slides were fixed with 70% methanol, dried and stained with SYBR Gold (Invitrogen). Comets were analyzed by CaspLab software to obtain the average tail moment (TM). The comet parameter TM was defined as a measure of both the amount of total DNA in the tail and the length of tail[38]. At least 40 cells were scored for each sample. The data were analyzed by Kruskal–Wallis test.
Microarray analysis
Total RNA was extracted from 1 × 106 cells using the TRIzol reagent (Life Technologies, USA). Samples were sent to CapitalBio Technology for GeneChip Human Genome U133 Plus 2.0 Array (Affymetrix). The data were submitted to NCBI with the GEO accession number GSE92918. Functional analysis of differentially expressed genes was performed by DAVID (https://david.ncifcrf.gov/).
Transmission electron microscopy
HCT-116 cells were infected with M1 (1 PFU/cell) in the presence or absence of NU7441 (1 μM) for 36 h. Cells were collected by centrifugation at 1000 × g for 5 min at room temperature. Cell pellets were then resuspended, washed once with phosphate-buffered saline, pelleted at 1500 × g for 5 min and fixed on ice for 4 h in 0.1 M phosphate-buffered saline (pH 7.4) containing 2.5% glutaraldehyde and 2% paraformaldehyde. Samples were then submitted to the Zhongshan School of Medicine (Sun Yat-sen University) Electron Microscopy Facility for standard transmission electron microscopy ultrastructural analysis.
Mitochondrial membrane potential assay
Cells were plated in a 6-well plate and incubated with fluorescent probe (5 μM), 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide (JC-1, Sigma-Aldrich) for 20 min at 37 °C. The cells were then washed with DMEM and imaged using fluorescence microscopy (Olympus, Japan).
Apoptosis analysis
The apoptosis of cells was measured by Hoechst 33342 staining and Annexin V-FITC/PI assays according to the operating instructions. For Hoechst 33342 staining, ~106 cells were harvested and washed twice with cold PBS solution after treatment. Then, the cells were stained with Hoechst 33342 (1 mg/l) for 20 min at 37 °C and imaged by fluorescence microscopy.For flow cytometry analysis, the cells were suspended in 400 μl binding buffer and incubated with 5 μl of Annexin V-FITC at 37 °C for 15 min and 10 μl of PI at 37 °C for 5 min in the dark. The stained cells were immediately analysed by flow cytometry (Becton–Dickinson, USA). This assay discriminates intact (Annexin V−/PI−) from early apoptotic (Annexin V+/PI−). Flow cytometry gating strategy for determination of apoptotic cells is described in Supplementary Fig. 2.
Animal models
This study was approved by the Animal Ethical and Welfare Committee of Sun Yat-sen University. For the subcutaneous xenograft model, HCT-116 (5 × 106 cells/mouse) or BxPC-3 (1 × 107 cells/mouse) cells were inoculated subcutaneously into the hind-flanks of 4-week-old female BALB/c-nu/nu mice. After 3 days, palpable tumours had developed (~50 mm3), and mice were divided into four groups at random. M1 virus (2 × 106 PFU/day) was administered by tail vein injection and NU7441 (10 mg/kg/day) by intraperitoneal injection four times. Tumour length and width were measured as indicated, and the volume was calculated according to the formula (length × width2)/2. The tumour size and body weight were measured in a blinded manner.For immunocompetent mouse model, MC38 (1 × 106 cells/mouse) or Pan02 (5 × 105 cells/mouse) cells were inoculated subcutaneously into the hind-flanks of 4-week-old female C57BL/6 mice. After 7 days, palpable tumours had developed (~50 mm3), and mice were divided into four groups at random. M1 virus (2 × 106 PFU/day) was administered by tail vein injection and NU7441 (10 mg/kg/day) by intraperitoneal injection four times. Tumours were harvested 1 day after the last injection.
Immunohistochemistry assay
The expression of p-H2AX, Ki-67, cleaved caspase-3, CD4 and CD8 in the tumours was assessed by immunohistochemistry. Briefly, tumour sections (4 μm) were dewaxed in xylene, hydrated in decreasing concentrations of ethanol, immersed in 0.3% H2O2-methanol for 30 min, washed with phosphate-buffered saline, and probed with monoclonal antibodies or isotype controls at 4 °C overnight. After being washed, the sections were incubated with biotinylated goat anti-rabbit or anti-mouse IgG at room temperature for 2 h. Immunostaining was visualized with streptavidin/peroxidase complex and diaminobenzidine, and sections were counterstained with haematoxylin. The immunohistochemistry assay was made in a blinded manner for pathologists.
Isolation and culture of primary colon cells
Two primary colorectal tumour samples were purchased from CHI Scientific (USA). The other four colorectal tumour samples were obtained from consenting patients who underwent tumour resection in the first affiliated hospital of Sun Yat-sen University. Before isolation, the base of a 75 cm2 culture flask was pre-treated with rat tail collagen I (354236, Corning, USA) for 2 h at room temperature and then washed with PBS. Fresh colorectal tumour tissues were collected and soaked in DMEM containing 2% penicillin/streptomycin on ice. Isolation and culture of primary colon cells was performed according to the instructions of the HumanCancer PrimacellTM 6: colorectal tumour cells (3-0616, CHI Scientific, USA). Briefly, tumour tissue was cut into pieces around 1 mm3 and digested by a mixture of collagenase I, IV and trypsin enzyme in a 37 °C shaker at 180 rpm for 1–2 h. The digested tissue was filtered by 200 mesh stainless steel filter to remove the undigested cell tissues. Cells were collected by centrifugation at 1000 rpm for 5 min, and was resuspended by medium. Trypan blue staining assay was performed to determine the number of viable cells per ml. The viable cells were seeded into culture flasks coated with rat tail collagen. In presence of 1% penicillin/streptomycin, cells were maintained in DMEM/F12 medium supplemented with 10% FBS at 37 °C and 5% CO2. When cell confluency reached 90%, cells were seeded into 24-well plates, treated with NU7441 or M1, and assessed via MTT assay.The work was approved by an ethics review committee at Sun Yat-sen University (Guangzhou, China). The institutional review board of the first affiliated hospital of Sun Yat-sen University approved all the human studies, and informed consents were obtained from all participants.
Statistical analysis
All statistical analyses were performed using GraphPad Prism software. Comparisons between different groups were made using Student’s t test, ANOVA or Kruskal–Wallis test as appropriate in the in vitro study. Values of the tumour volume were analysed by repeated-measures one-way analysis of variance. The data reasonably met the assumptions of the tests. All error bars indicate SD. Differences were considered significant if the P value was less than 0.05.
Authors: Rozanne Arulanandam; Cory Batenchuk; Oliver Varette; Chadi Zakaria; Vanessa Garcia; Nicole E Forbes; Colin Davis; Ramya Krishnan; Raunak Karmacharya; Julie Cox; Anisha Sinha; Andrew Babawy; Katherine Waite; Erica Weinstein; Theresa Falls; Andrew Chen; Jeff Hamill; Naomi De Silva; David P Conrad; Harold Atkins; Kenneth Garson; Carolina Ilkow; Mads Kærn; Barbara Vanderhyden; Nahum Sonenberg; Tommy Alain; Fabrice Le Boeuf; John C Bell; Jean-Simon Diallo Journal: Nat Commun Date: 2015-03-30 Impact factor: 14.919
Authors: Hiroshi Nakashima; Johanna K Kaufmann; Pin-Yi Wang; Tran Nguyen; Maria-Carmela Speranza; Kazue Kasai; Kazuo Okemoto; Akihiro Otsuki; Ichiro Nakano; Soledad Fernandez; William F Goins; Paola Grandi; Joseph C Glorioso; Sean Lawler; Timothy P Cripe; E Antonio Chiocca Journal: J Clin Invest Date: 2015-10-20 Impact factor: 14.808
Authors: Yan Zhao; Huw D Thomas; Michael A Batey; Ian G Cowell; Caroline J Richardson; Roger J Griffin; A Hilary Calvert; David R Newell; Graeme C M Smith; Nicola J Curtin Journal: Cancer Res Date: 2006-05-15 Impact factor: 12.701