| Literature DB >> 30298009 |
Kang-Hoon Kim1,2, In-Seung Lee1,2, Ji Young Park1,2, Yumi Kim1,2, Eun-Jin An1,2, Hyeung-Jin Jang1,2.
Abstract
Taste receptors exist in several organs from tongue to colon and have diverse functions dependent on specific cell type. In enteroendocrine L-cells, stimulation of taste receptor signaling induces incretin hormones. Among incretin hormones, glucagon-like peptide-1 (GLP-1) induces insulinotropic action by activating GLP-1 receptor of pancreatic β-cells. However, GLP-1 mimetic medicines have reported clinical side effects, such as autoimmune hepatitis, acute kidney injury, pancreatitis, and pancreatic cancer. Here, we hypothesized that if natural components in ethnomedicines can activate agonistic action of taste receptor; they may stimulate GLP-1 and therefore, could be developed as safe and applicable medicines to type 2 diabetes mellitus (T2DM) with minimal side effects. Cucurbitacin B (CuB) is composed of triterpenoid structure and its structural character, that represents bitterness, can stimulate AMP-activated protein kinase (AMPK) pathway. CuB ameliorated hyperglycemia by activating intestinal AMPK levels and by inducing plasma GLP-1 and insulin release in diabetic mice. This hypoglycemic action was decreased in dorsomorphin-injected mice and α-gustducin null mice. Moreover, systemic inhibition study in differentiated NCI-H716 cell line showed that CuB-mediated GLP-1 secretion was involved in activation of AMPK through α-gustducin and Gβγ-signaling of taste receptors. In summary, we conclude that, CuB represents novel hypoglycemic agents by activation of AMPK and stimulation of GLP-1 in differentiated enteroendocrine L-cells. These results suggest that taste receptor signaling-based therapeutic agents within tremendously diverse ethnomedicines, could be applied to developing therapeutics for T2DM patients.Entities:
Keywords: AMPK; GLP-1; alpha-gustducin; cucurbitacin B; diabetes; enteroendocrine L-cells; taste receptor
Year: 2018 PMID: 30298009 PMCID: PMC6161541 DOI: 10.3389/fphar.2018.01071
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Sequence information for real-time quantitative PCR primer.
| Gene | Forward | Reverse |
|---|---|---|
| GCCACATCGCTCAGACACC | CCCAATACGACCAAATCCGT | |
| CTATGACATGGTCCTCGTGGAA | GATACTGTTGAACAGGTGAAGGCTT | |
| CATTTCCCTTTGGAGACACAAC | ATGAGCTTCTGTGTTGGAGTC |