Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.