Svenja Zielke1, Nina Meyer2, Muriel Mari3, Khalil Abou-El-Ardat4,5,6, Fulvio Reggiori3, Sjoerd J L van Wijk1, Donat Kögel2, Simone Fulda7,8,9. 1. Institute for Experimental Cancer Research in Pediatrics, Goethe-University Frankfurt, Komturstr. 3a, 60528, Frankfurt, Germany. 2. Experimental Neurosurgery, Goethe-University Hospital, Theodor-Stern-Kai 7, 60590, Frankfurt, Germany. 3. Department of Cell Biology, University of Groningen, University Medical Center Groningen, A. Deusinglaan 1, 9713 AV, Groningen, Netherlands. 4. Department of Medicine II, Hematology/Oncology, Goethe University, Theodor-Stern-Kai 7, 60590, Frankfurt, Germany. 5. German Cancer Consortium (DKTK), Partner Site Frankfurt, Frankfurt, Germany. 6. German Cancer Research Center (DKFZ), Heidelberg, Germany. 7. Institute for Experimental Cancer Research in Pediatrics, Goethe-University Frankfurt, Komturstr. 3a, 60528, Frankfurt, Germany. simone.fulda@kgu.de. 8. German Cancer Consortium (DKTK), Partner Site Frankfurt, Frankfurt, Germany. simone.fulda@kgu.de. 9. German Cancer Research Center (DKFZ), Heidelberg, Germany. simone.fulda@kgu.de.
Abstract
Autophagy is a well-described degradation mechanism that promotes cell survival upon nutrient starvation and other forms of cellular stresses. In addition, there is growing evidence showing that autophagy can exert a lethal function via autophagic cell death (ACD). As ACD has been implicated in apoptosis-resistant glioblastoma (GBM), there is a high medical need for identifying novel ACD-inducing drugs. Therefore, we screened a library containing 70 autophagy-inducing compounds to induce ATG5-dependent cell death in human MZ-54 GBM cells. Here, we identified three compounds, i.e. loperamide, pimozide, and STF-62247 that significantly induce cell death in several GBM cell lines compared to CRISPR/Cas9-generated ATG5- or ATG7-deficient cells, pointing to a death-promoting role of autophagy. Further cell death analyses conducted using pharmacological inhibitors revealed that apoptosis, ferroptosis, and necroptosis only play minor roles in loperamide-, pimozide- or STF-62247-induced cell death. Intriguingly, these three compounds induce massive lipidation of the autophagy marker protein LC3B as well as the formation of LC3B puncta, which are characteristic of autophagy. Furthermore, loperamide, pimozide, and STF-62247 enhance the autophagic flux in parental MZ-54 cells, but not in ATG5 or ATG7 knockout (KO) MZ-54 cells. In addition, loperamide- and pimozide-treated cells display a massive formation of autophagosomes and autolysosomes at the ultrastructural level. Finally, stimulation of autophagy by all three compounds is accompanied by dephosphorylation of mammalian target of rapamycin complex 1 (mTORC1), a well-known negative regulator of autophagy. In summary, our results indicate that loperamide, pimozide, and STF-62247 induce ATG5- and ATG7-dependent cell death in GBM cells, which is preceded by a massive induction of autophagy. These findings emphasize the lethal function and potential clinical relevance of hyperactivated autophagy in GBM.
Autophagy is a well-described degradation mechanism that promotes cell survival upon nutrient starvation and other forms of cellular stresses. In addition, there is growing evidence showing that autophagy can exert a lethal function via autophagic cell death (ACD). As ACD has been implicated in apoptosis-resistant glioblastoma (GBM), there is a high medical need for identifying novel ACD-inducing drugs. Therefore, we screened a library containing 70 autophagy-inducing compounds to induce ATG5-dependent cell death in humanMZ-54 GBM cells. Here, we identified three compounds, i.e. loperamide, pimozide, and STF-62247 that significantly induce cell death in several GBM cell lines compared to CRISPR/Cas9-generated ATG5- or ATG7-deficient cells, pointing to a death-promoting role of autophagy. Further cell death analyses conducted using pharmacological inhibitors revealed that apoptosis, ferroptosis, and necroptosis only play minor roles in loperamide-, pimozide- or STF-62247-induced cell death. Intriguingly, these three compounds induce massive lipidation of the autophagy marker protein LC3B as well as the formation of LC3B puncta, which are characteristic of autophagy. Furthermore, loperamide, pimozide, and STF-62247 enhance the autophagic flux in parental MZ-54 cells, but not in ATG5 or ATG7 knockout (KO) MZ-54 cells. In addition, loperamide- and pimozide-treated cells display a massive formation of autophagosomes and autolysosomes at the ultrastructural level. Finally, stimulation of autophagy by all three compounds is accompanied by dephosphorylation of mammalian target of rapamycin complex 1 (mTORC1), a well-known negative regulator of autophagy. In summary, our results indicate that loperamide, pimozide, and STF-62247 induce ATG5- and ATG7-dependent cell death in GBM cells, which is preceded by a massive induction of autophagy. These findings emphasize the lethal function and potential clinical relevance of hyperactivated autophagy in GBM.
GBM represents the most aggressive malignant primary brain tumor with a median survival of 16 months after radio-chemotherapy[1,2]. Importantly, GBMs were shown to be highly resistant to caspase-dependent apoptosis[3,4]. As defects in apoptosis signaling contribute to tumorigenesis and chemoresistance, there is a high medical need for novel therapies[5]. Therefore, the induction of alternative forms of cell death, such as ACD has emerged as an attractive concept to trigger cell death in GBM[6].Macroautophagy (hereafter autophagy) is a catabolic process that involves the degradation of cytoplasmic components, including damaged organelles and protein aggregates in double-membraned autophagosomes that eventually fuse with lysosomes to allow cargo degradation[7]. To date, numerous autophagy-related (ATG) proteins have been characterized in yeast, many of which have known orthologs in mammals[8]. ATG proteins are required for virtually every step of autophagy and autophagosome biogenesis, starting with nucleation of the initial autophagosome precursor, the phagophore[9]. Subsequent membrane expansion, closure of the autophagosome as well as intralysosomal degradation depend on the concerted action of two ubiquitin-like conjugation systems, which include ATG5 and ATG7[10,11]. Well-described marker proteins for monitoring autophagy progression are members of the LC3/GABARAP protein family[12]. Soluble LC3/GABARAP is constitutively processed by ATG4 proteases and, upon onset of autophagy, becomes conjugated to the phosphatidylethanolamine (PE) present in autophagosomal membranes through the action of the two ubiquitin-like conjugation systems[8,13].The cellular outcome of autophagy induction is highly contextual. On the one hand, it is well-described that autophagy serves to adapt to stressful conditions, such as nutrient deprivation, oxidative damage or accumulation of misfolded proteins and, thus, promotes cellular survival[14-16]. On the other hand, there is growing evidence suggesting a cell death-promoting role of autophagy, referred to as type II cell death or ACD[17]. Enforced hyperactivation of autophagy has been described to trigger massive cellular self-digestion beyond the point of allowing cellular survival[18,19]. Moreover, autophagosomes can serve as signaling platforms that facilitate the activation and integration of different cell death pathways, such as necroptosis, through caspase-8 activation on autophagosomal membranes[20]. Furthermore, selective degradation of specific proteins, like the reactive oxygen species (ROS) scavenger catalase, can induce ACD as well[21].Several key criteria have been defined for bona fide ACD. First of all, the term ACD should be limited to cases of cell death that can be suppressed through either genetic or pharmacological inhibition of at least two members of the autophagic core machinery[22]. Second, the death process should be mediated via an enhanced autophagic flux instead of blocking autophagy at any of its stages[23].Intriguingly, in vitro and in vivo induction of ACD has been investigated as a potential therapeutic approach in apoptosis-resistant cancers[24-26]. Hence, the identification of novel ACD-inducing drugs in highly malignant GBM cells remains a promising strategy. In order to identify novel inducers of ACD, we screened a compound library containing 70 known autophagy-inducing drugs on parental as well as ATG5-deficient MZ-54 GBM cells.
Results
Loperamide, pimozide, and STF-62247 induce autophagy-dependent cell death in GBM cells
To identify novel inducers of ACD we screened the Enzo Screen-Well™ library containing 70 known autophagy-inducing drugs for cell death induction in wild-type (WT) MZ-54 GBM cells and ATG5 or ATG7 KO MZ-54 cells. Using next-generation sequencing we identified the heterozygous gain-of-function mutation ENSP00000391127:p.Arg248Trp within the TP53 gene of MZ-54 cells, which has been reported to render cells less sensitive towards apoptosis-inducing drugs[27,28]. We previously described the generation of CRISPR/Cas9 ATG5 KO cells derived from the MZ-54 cell line[29] (Fig. 1a). Of note, the ATG5-ATG12 conjugate was found to be absent not only in ATG5 KO, but also in ATG7 KO cells (depicted by asterisk), which is in line with the notion that ATG7 is required for the conjugation of ATG12 to ATG5 during autophagosome maturation[30]. Importantly, among the tested compounds we identified loperamide, pimozide, and STF-62247 to induce ATG5- and ATG7-dependent cell death in MZ-54 cells at various concentrations, as loperamide-, pimozide- or STF-62247-triggered cell death was significantly reduced in ATG5 or ATG7 KO compared to control cells (Fig. 1b–d). As a positive control, we used the antidepressant drug imipramine hydrochloride (IM) in combination with the anticoagulant drug ticlopidine (TIC), since this combination has previously been reported to induce ACD in GBM cells[24]. As expected, treatment with IM and TIC triggered cell death in a concentration-dependent manner in parental MZ-54 cells, which was significantly decreased in ATG5 or ATG7 KO MZ-54 cells (Fig. 1e). As a negative control, treating MZ-54 cells with the apoptosis-inducing compound ABT-737 and etoposide induced cell death in WT MZ-54 cells to a similar extent as in ATG5 or ATG7 KO cells (Suppl. Fig. S1)[31].
Fig. 1
Loperamide, pimozide, and STF-62247 induce autophagy-dependent cell death in GBM cells.
a Lysates from untreated MZ-54 WT, ATG5, and ATG7 KO cells were subjected to Western blotting with the indicated antibodies and vinculin as loading control. The asterisk indicates the absence of the ATG5-ATG12 conjugate in ATG7 KO cells. b–d MZ-54 WT, ATG5 KO, and ATG7 KO cells were treated with indicated concentrations of loperamide, pimozide, STF-62247, and IM/TIC for 48 h. Cell death was assessed by measuring the PI uptake as fraction of total nuclei determined by Hoechst counterstaining using high-content fluorescence microscopy. Data are presented as mean and SEM of 3−5 independent experiments performed in triplicate. Significances are calculated against WT cells treated with the same drug concentration. *p < 0.05, **p < 0.01, ***p < 0.001. UT untreated, LOP loperamide, PIMO pimozide, STF STF-62247, IM imipramine hydrochloride, TIC ticlopidine
Loperamide, pimozide, and STF-62247 induce autophagy-dependent cell death in GBM cells.
a Lysates from untreated MZ-54 WT, ATG5, and ATG7 KO cells were subjected to Western blotting with the indicated antibodies and vinculin as loading control. The asterisk indicates the absence of the ATG5-ATG12 conjugate in ATG7 KO cells. b–d MZ-54 WT, ATG5 KO, and ATG7 KO cells were treated with indicated concentrations of loperamide, pimozide, STF-62247, and IM/TIC for 48 h. Cell death was assessed by measuring the PI uptake as fraction of total nuclei determined by Hoechst counterstaining using high-content fluorescence microscopy. Data are presented as mean and SEM of 3−5 independent experiments performed in triplicate. Significances are calculated against WT cells treated with the same drug concentration. *p < 0.05, **p < 0.01, ***p < 0.001. UT untreated, LOP loperamide, PIMO pimozide, STFSTF-62247, IM imipramine hydrochloride, TIC ticlopidineKinetic analysis showed that all compounds induced cell death in a time-dependent manner (Fig. 2a–d, Suppl. Fig. S2). KO of ATG5 or ATG7 protected cells from loperamide-, pimozide- and IM/TIC-induced cell death after 48 h and from STF-62247-induced cell death after 48 h as well as 72 h (Fig. 2a–d).
Fig. 2
Loperamide, pimozide, and STF-62247 induce autophagy-dependent cell death of MZ-54 in a time-dependent manner.
a–d MZ-54 cells were treated with 17.5 µM loperamide, 15 µM pimozide, 40 µM STF-62247, and 20 µM IM/100 µM TIC for 24, 48, and 72 h. Cell death was assessed by measuring the PI uptake as fraction of total nuclei determined by Hoechst counterstaining using high-content fluorescence microscopy. Mean and SEM of 3−5 independent experiments performed in triplicate are shown. Significances are calculated versus WT cells. *p < 0.05, **p < 0.01, ***p < 0.001. LOP loperamide, PIMO pimozide, STF STF-62247, IM imipramine hydrochloride, TIC ticlopidine
Loperamide, pimozide, and STF-62247 induce autophagy-dependent cell death of MZ-54 in a time-dependent manner.
a–d MZ-54 cells were treated with 17.5 µM loperamide, 15 µM pimozide, 40 µM STF-62247, and 20 µM IM/100 µM TIC for 24, 48, and 72 h. Cell death was assessed by measuring the PI uptake as fraction of total nuclei determined by Hoechst counterstaining using high-content fluorescence microscopy. Mean and SEM of 3−5 independent experiments performed in triplicate are shown. Significances are calculated versus WT cells. *p < 0.05, **p < 0.01, ***p < 0.001. LOP loperamide, PIMO pimozide, STFSTF-62247, IM imipramine hydrochloride, TIC ticlopidineTogether, these findings indicate that autophagy contributes to cell death induced by loperamide, pimozide, and STF-62247, similarly to IM/TIC.To investigate whether the induction of autophagy-dependent cell death by loperamide, pimozide, and STF-62247 also occurs in other GBM cell lines we extended our experiments to additional GBM cell lines. Importantly, loperamide-, pimozide- and STF-62247-induced cell death was significantly reduced in ATG5 or ATG7 KO LN-229 or U343 GOS-3 cells compared to the corresponding parental cell lines (Suppl. Fig. S3). This underscores that loperamide, pimozide, and STF-62247 can induce autophagy-dependent cell death in GBM cells.
Loperamide-, pimozide- or STF-62247-induced cell death does not primarily involve apoptosis, ferroptosis or necroptosis
To further understand the type of cell death induced by exposing MZ-54 cells to loperamide, pimozide, STF-62247, or IM/TIC cell death was assessed in the absence or presence of pharmacological inhibitors of apoptosis, ferroptosis, and necroptosis. Addition of the broad-range caspase inhibitor zVAD.fmk failed to protect MZ-54 cells from loperamide-, pimozide- or STF-62247-induced cell death and only partially rescued cells from IM/TIC-induced cell death, whereas it completely blocked ABT-737/etoposide-induced apoptosis used as a positive control for caspase-dependent cell death (Fig. 3a). Consistently, no caspase-3 activation was detected upon treatment with loperamide, pimozide, STF-62247 or IM/TIC in contrast to staurosporine (STS) as a positive control (Fig. 3b), indicating that loperamide, pimozide, STF-62247 and IM/TIC induced cell death largely in a caspase-independent manner. In addition, the ferroptosis inhibitor ferrostatin-1 (Fer-1) failed to block cell death by loperamide, pimozide, STF-62247, or IM/TIC, whereas it efficiently blocked cell death induced by the GPX4 inhibitor RSL3 (Fig. 3c) that was used as a positive control for ferroptosis[32]. Similarly, addition of the receptor-interacting protein kinase (RIPK)1 inhibitor necrostatin-1s (Nec-1s) failed to block cell death induced by loperamide, pimozide, STF-62247 or IM/TIC, whereas Nec-1s profoundly protected HT-29colon carcinoma cells from cell death induced by a combination of tumor necrosis factor (TNF)α, the Smac mimetic BV6 and zVAD.fmk (Fig. 3d), a well-described model of necroptosis[33]. Taken together, these findings indicate that apoptosis, ferroptosis and necroptosis are not the main execution pathways during loperamide-, pimozide- and STF-62247-induced cell death.
Fig. 3
Loperamide, pimozide- or STF-62247-induced cell death does not primarily involve apoptosis, ferroptosis, or necroptosis.
a, c, d MZ-54 cells were pretreated for 1 h with 20 µM zVAD.fmk (a), 5 µM Fer-1 (c) or 30 µM Nec-1s (d) followed by treatment with 17.5 µM loperamide, 15 µM pimozide, 40 µM STF-62247, 20 µM IM/100 µM TIC, 25 µM ABT-737/100 µM etoposide, 500 nM RSL3 or 1 ng/mL TNF + 0.5 µM BV6 for 48 h. Cell death was assessed by measuring the PI uptake as fraction of total nuclei determined by Hoechst counterstaining using high-content fluorescence microscopy. HT-29 cells served as positive control for induction of necroptotic cell death. b MZ-54 cells were treated with 3 µM STS, 15 µM loperamide, 15 µM pimozide, 40 µM STF-62247, or 20 µM IM/100 µM TIC for the indicated time points. Caspase-3 activity was determined by quantifying alterations in Ac-DEVD-AMC fluorescence. Mean and SEM of 3−4 independent experiments performed in triplicate are shown. *p < 0.05, **p < 0.01, ***p < 0.001. UT untreated, LOP loperamide, PIMO pimozide, STF STF-62247, IM imipramine hydrochloride, TIC ticlopidine, STS staurosporine
Loperamide, pimozide- or STF-62247-induced cell death does not primarily involve apoptosis, ferroptosis, or necroptosis.
a, c, d MZ-54 cells were pretreated for 1 h with 20 µM zVAD.fmk (a), 5 µM Fer-1 (c) or 30 µM Nec-1s (d) followed by treatment with 17.5 µM loperamide, 15 µM pimozide, 40 µM STF-62247, 20 µM IM/100 µM TIC, 25 µM ABT-737/100 µM etoposide, 500 nM RSL3 or 1 ng/mL TNF + 0.5 µM BV6 for 48 h. Cell death was assessed by measuring the PI uptake as fraction of total nuclei determined by Hoechst counterstaining using high-content fluorescence microscopy. HT-29 cells served as positive control for induction of necroptotic cell death. b MZ-54 cells were treated with 3 µM STS, 15 µM loperamide, 15 µM pimozide, 40 µM STF-62247, or 20 µM IM/100 µM TIC for the indicated time points. Caspase-3 activity was determined by quantifying alterations in Ac-DEVD-AMC fluorescence. Mean and SEM of 3−4 independent experiments performed in triplicate are shown. *p < 0.05, **p < 0.01, ***p < 0.001. UT untreated, LOP loperamide, PIMO pimozide, STFSTF-62247, IM imipramine hydrochloride, TIC ticlopidine, STSstaurosporine
Loperamide, pimozide, and STF-62247 induce dephosphorylation of mTORC1 and S6K
mTORC1 is a well-described negative regulator of autophagy[34]. It inhibits this pathway by phosphorylating few ATG proteins[35]. mTORC1 itself can be activated through phosphorylation at Ser2446 by protein kinase B (PKB), which leads to inhibition of autophagy[36,37]. Since this phosphorylation site acts as a switch controlling the activity and function of mTORC1, we investigated whether loperamide, pimozide, and STF-62247 induce dephosphorylation of mTORC1 at Ser2446, as this would allow for activation of autophagy[37]. Indeed, loperamide, pimozide, STF-62247, and IM/TIC markedly reduced phosphorylation of mTORC1, similar to the well-described autophagy inducer rapamycin[38] (Fig. 4). In addition, we assessed the phosphorylation status of ribosomal protein S6 kinase I (S6K), one of the downstream targets of mTORC1[39]. In line with the observed dephosphorylation of mTORC1, all compounds caused dephosphorylation of S6K (Fig. 4). Since rapamycin has been reported to induce autophagy by preventing phosphorylation of mTORC1 at Ser2446[34], we tested whether this drug could also induce autophagy-dependent cell death. Rapamycin, however, did not induce cell death in MZ-54 cells (Suppl. Fig. S4 A-C) at a concentration that inhibited phosphorylation of mTORC1 and S6K (Fig. 4). Together, this set of experiments indicates that loperamide, pimozide, and STF-62247 negatively regulate mTORC1, which in turn may lead to increased autophagy.
Fig. 4
Loperamide, pimozide, and STF-62247 induce dephosphorylation of mTOR and S6K.
MZ-54 WT cells were treated with 100 nM rapamycin, 100 ng/mL EGF, 20 µM IM/100 µM TIC, 17.5 µM loperamide, 15 µM pimozide, or 40 µM STF-62247 for the indicated time points followed by Western blotting with vinculin as loading control. UT untreated, EGF epidermal growth factor, IM imipramine hydrochloride, TIC ticlopidine, LOP loperamide, PIMO pimozide, STF STF-62247
Loperamide, pimozide, and STF-62247 induce dephosphorylation of mTOR and S6K.
MZ-54 WT cells were treated with 100 nM rapamycin, 100 ng/mL EGF, 20 µM IM/100 µM TIC, 17.5 µM loperamide, 15 µM pimozide, or 40 µM STF-62247 for the indicated time points followed by Western blotting with vinculin as loading control. UT untreated, EGFepidermal growth factor, IM imipramine hydrochloride, TIC ticlopidine, LOP loperamide, PIMO pimozide, STFSTF-62247In addition to mTORC1, also ROS are well-known upstream modulators of autophagy[40]. To test whether ROS formation contributes to loperamide, pimozide- and STF-62247-induced ACD we investigated the effect of different ROS scavengers, i.e. the water-soluble vitamin E-derivate trolox, the lipid-soluble vitamin E-derivate α-tocopherol (α-Toc) and reduced glutathione (GSH)[41,42]. The ROS-inducing compound RSL3 was used as a positive control for ROS-induced cell death[43]. Preincubation with α-Toc significantly rescued loperamide- and pimozide-induced cell death of MZ-54 WT and ATG7 KO cells, while trolox and GSH had no effect (Suppl. Fig. S5 A). Consistently, loperamide and pimozide markedly triggered ROS production, while STF-62247 slightly increased ROS levels in WT and ATG7 KO cells (Suppl. Fig. S5 B). These findings indicate that loperamide- and pimozide-induced ACD is associated with ROS formation.
Loperamide, pimozide, and STF-62247 induce robust hallmarks of autophagy in GBM cells
To confirm that loperamide, pimozide, and STF-62247 indeed trigger autophagy in MZ-54 cells, we initially assessed LC3B lipidation as a well-characterized marker for autophagy[44]. Indeed, all three compounds as well as the combination of IM and TIC induced a strong increase in lipidated LC3B-II levels compared to untreated cells or cells treated with the apoptosis stimulus ABT-737/etoposide that was used as a negative control (Fig. 5a). Kinetic analysis revealed that LC3B lipidation upon treatment with loperamide, pimozide, STF-62247, and IM/TIC occurred in a time-dependent manner (Suppl. Fig. S6). Strong induction of autophagy occurred 3−6 h after the addition of loperamide, pimozide, and STF-62247 as well as 24 h after adding IM/TIC (Suppl. Fig. S6). Moreover, we confirmed that loperamide, pimozide, and STF-62247 enhanced LC3B lipidation in LN-229 and U343 cells as well (Suppl. Fig. S7).
Fig. 5
Loperamide, pimozide, and STF-62247 induce robust hallmarks of autophagy in GBM cells.
a MZ-54 cells were treated with 20 µM IM/100 µM TIC, 17.5 µM loperamide, 15 µM pimozide, 40 µM STF-62247, and 25 µM ABT-737/50 µM etoposide for 24 h followed by detection of vinculin, ATG7, ATG5, and LC3B protein levels by Western blotting with vinculin as loading control. b MZ-54 cells were treated as indicated in a for 24 h and the formation of LC3B puncta was imaged using anti-LC3B immunofluorescence staining. Representative images over 25 microscopic views per sample are shown. c Quantification of mean LC3B puncta per cell upon the indicated treatment. Mean and SEM of 3−6 independent experiments performed for 25 sites per sample are shown. Scale bar = 30 µm. Significances after drug treatment of WT, ATG5, and ATG7 KO cells are calculated versus untreated cells of the corresponding cell line. **p < 0.01, ***p < 0.001. UT untreated, IM imipramine hydrochloride, TIC ticlopidine, LOP loperamide, PIMO pimozide, STF STF-62247, ABT ABT-737, ETO etoposide
Loperamide, pimozide, and STF-62247 induce robust hallmarks of autophagy in GBM cells.
a MZ-54 cells were treated with 20 µM IM/100 µM TIC, 17.5 µM loperamide, 15 µM pimozide, 40 µM STF-62247, and 25 µM ABT-737/50 µM etoposide for 24 h followed by detection of vinculin, ATG7, ATG5, and LC3B protein levels by Western blotting with vinculin as loading control. b MZ-54 cells were treated as indicated in a for 24 h and the formation of LC3B puncta was imaged using anti-LC3B immunofluorescence staining. Representative images over 25 microscopic views per sample are shown. c Quantification of mean LC3B puncta per cell upon the indicated treatment. Mean and SEM of 3−6 independent experiments performed for 25 sites per sample are shown. Scale bar = 30 µm. Significances after drug treatment of WT, ATG5, and ATG7 KO cells are calculated versus untreated cells of the corresponding cell line. **p < 0.01, ***p < 0.001. UT untreated, IM imipramine hydrochloride, TIC ticlopidine, LOP loperamide, PIMO pimozide, STFSTF-62247, ABTABT-737, ETOetoposideUpon induction of autophagy, LC3 and GABARAP family proteins associated with expanding phagophores and autophagosomes appear as distinct puncta-like cytoplasmic accumulations which can be assessed by immunofluorescence[12,45]. Therefore, we monitored the induction of autophagy by immunofluorescent staining of endogenous LC3B puncta. Notably, treatment of WT MZ-54 cells with loperamide, pimozide, STF-62247 or IM/TIC stimulated a strong accumulation of LC3B compared to a diffuse staining pattern of LC3B in untreated control cells (Fig. 5b). ABT-737/etoposide treatment was used as a negative control (Fig. 5b). Quantification revealed a significant increase in LC3B puncta upon treatment with loperamide, pimozide, STF-62247 or IM/TIC compared to untreated control cells (Fig. 5c). In contrast, LC3B punctate formation was almost completely blocked in ATG5 or ATG7 KO MZ-54 cells, as expected (Fig. 5c). This set of experiments strongly suggests that loperamide, pimozide, and STF-62247 trigger canonical autophagy in GBM cells.
Loperamide and pimozide induce ultrastructural hallmarks of autophagy in GBM cells
To further characterize autophagic changes upon exposure to IM/TIC, loperamide or pimozide, we performed a detailed ultrastructural analysis using electron microscopy. In contrast to the untreated control, treatment with IM/TIC, loperamide or pimozide induced massive formation of heteromorphous degradative compartments (DGC), which include lysosomes, amphisomes (i.e. autophagosomes fused with endosomes) and autolysosomes (Fig. 6a–e). In most cases, these DGC contained electron-dense material that likely reflects the presence of cytoplasmic material being degraded. In addition, we also observed a significant increase in autophagosomes per cell section upon treatment with IM/TIC, loperamide and pimozide (Fig. 6b, c, e). Notably, the increase of DGC was shown to be more pronounced than the increase in autophagosomes, pointing to a rapid fusion of autophagosomes with lysosomes that is indicative of an enhanced autophagic flux. Together, this ultrastructural analysis highlights that treatment with IM/TIC, loperamide and pimozide triggers morphological hallmarks of autophagy.
Fig. 6
Loperamide and pimozide induce ultrastructural hallmarks of autophagy in GBM cells.
a–d MZ-54 WT cells were left untreated (a, UT) or treated with 20 µM IM/100 µM TIC (b, IM/TIC), 17.5 µM loperamide (c, LOP) or 15 µM pimozide (d, PIMO) for 48 h before being processed for electron microscopy. A, autophagosome; D, degradative compartment; E, endosome (early or late); G, Golgi apparatus; M, mitochondria; N, nucleus; PM, plasma membrane. Scale bar = 1 µm. e The average number of autophagosomes and degradative compartments per cell section was determined as described in Materials and Methods. Significances are calculated versus untreated cells. **p < 0.01, ***p < 0.001. UT untreated, IM imipramine hydrochloride, TIC ticlopidine, LOP loperamide, PIMO pimozide
Loperamide and pimozide induce ultrastructural hallmarks of autophagy in GBM cells.
a–d MZ-54 WT cells were left untreated (a, UT) or treated with 20 µM IM/100 µM TIC (b, IM/TIC), 17.5 µM loperamide (c, LOP) or 15 µM pimozide (d, PIMO) for 48 h before being processed for electron microscopy. A, autophagosome; D, degradative compartment; E, endosome (early or late); G, Golgi apparatus; M, mitochondria; N, nucleus; PM, plasma membrane. Scale bar = 1 µm. e The average number of autophagosomes and degradative compartments per cell section was determined as described in Materials and Methods. Significances are calculated versus untreated cells. **p < 0.01, ***p < 0.001. UT untreated, IM imipramine hydrochloride, TIC ticlopidine, LOP loperamide, PIMO pimozide
Loperamide, pimozide and STF-62247 enhance the autophagic flux in GBM cells
An increase in autophagosomes can be related either to an increased autophagic flux or to a block of the autophagosomal-lysosomal fusion[46]. To address this point we treated MZ-54 cells with loperamide, pimozide, STF-62247 and IM/TIC in the absence and presence of bafilomycin A1 (BafA1). Since BafA1 inhibits the acidification of lysosomes and thus the degradation of the autophagosomal cargoes including the members of the LC3 protein family, enhanced LC3B-II levels upon treatment with BafA1 reflect enhanced stimulation of the autophagic flux[47]. Notably, treatment with loperamide, pimozide, STF-62247 or IM/TIC caused enhanced LC3B lipidation upon addition of BafA1 compared to treatment in the absence of BafA1 (Fig. 7a), pointing to an increase in the autophagic flux.
Fig. 7
Loperamide, pimozide, and STF-62247 enhance the autophagic flux in MZ-54 cells.
a MZ-54 cells were treated with 20 µM IM/100 µM TIC, 17.5 µM loperamide, 15 µM pimozide, and 40 µM STF-62247 for 8, 2, 4 and 3 h, respectively. BafA1 was added 4 h before cell harvesting at a final concentration of 40 nM. Western blotting was performed with the indicated antibodies and vinculin as loading control. For quantification, LC3-II band intensities were normalized to vinculin band intensities. b Schematic representation of the GFP-LC3B-RFP-LC3BΔG autophagy flux sensor. Upon expression, the GFP-LC3B-RFP-LC3BΔG fusion protein is cleaved by the ATG4 proteases after which GFP-LC3B becomes conjugated to PE and localizes to autophagosomes which eventually fuse with lysosomes, inducing degradation of GFP-LC3B. RFP-LC3BΔG remains in the cytosol, where it serves as internal control. Scheme adapted from Kaizuka et al.[48]
c Stable GFP-LC3B-RFP-LC3BΔG-expressing MZ-54 WT or ATG7 KO cells were treated as indicated in a for 16 h followed by Western blotting with vinculin as loading control. d, e Stable GFP-LC3B-RFP-LC3BΔG-expressing MZ-54 WT (d) or ATG7 KO cells (e) were treated with 20 µM IM/100 µM TIC, 15 µM loperamide, 15 µM pimozide or 40 µM STF-62247 for the indicated time points followed by flow cytometry. BafA1 was added 4 h before the measurement at a final concentration of 40 nM. Mean and SEM of three independent experiments performed in triplicate are shown. f Fluorescence microscopy of stable GFP-LC3B-RFP-LC3BΔG-expressing MZ-54 WT, ATG5 KO and ATG7 KO cells was performed after 16 h of treatment with 20 µM IM and 100 µM TIC, 17.5 µM loperamide, 15 µM pimozide, and 40 µM STF-62247. Scale bar = 50 µm. Significances are calculated versus untreated cells of the same cell line. *p < 0.05, **p < 0.01, ***p < 0.001. UT untreated, IM imipramine hydrochloride, TIC ticlopidine, LOP loperamide, PIMO pimozide, STF STF-62247
Loperamide, pimozide, and STF-62247 enhance the autophagic flux in MZ-54 cells.
a MZ-54 cells were treated with 20 µM IM/100 µM TIC, 17.5 µM loperamide, 15 µM pimozide, and 40 µM STF-62247 for 8, 2, 4 and 3 h, respectively. BafA1 was added 4 h before cell harvesting at a final concentration of 40 nM. Western blotting was performed with the indicated antibodies and vinculin as loading control. For quantification, LC3-II band intensities were normalized to vinculin band intensities. b Schematic representation of the GFP-LC3B-RFP-LC3BΔG autophagy flux sensor. Upon expression, the GFP-LC3B-RFP-LC3BΔG fusion protein is cleaved by the ATG4 proteases after which GFP-LC3B becomes conjugated to PE and localizes to autophagosomes which eventually fuse with lysosomes, inducing degradation of GFP-LC3B. RFP-LC3BΔG remains in the cytosol, where it serves as internal control. Scheme adapted from Kaizuka et al.[48]
c Stable GFP-LC3B-RFP-LC3BΔG-expressing MZ-54 WT or ATG7 KO cells were treated as indicated in a for 16 h followed by Western blotting with vinculin as loading control. d, e Stable GFP-LC3B-RFP-LC3BΔG-expressing MZ-54 WT (d) or ATG7 KO cells (e) were treated with 20 µM IM/100 µM TIC, 15 µM loperamide, 15 µM pimozide or 40 µM STF-62247 for the indicated time points followed by flow cytometry. BafA1 was added 4 h before the measurement at a final concentration of 40 nM. Mean and SEM of three independent experiments performed in triplicate are shown. f Fluorescence microscopy of stable GFP-LC3B-RFP-LC3BΔG-expressing MZ-54 WT, ATG5 KO and ATG7 KO cells was performed after 16 h of treatment with 20 µM IM and 100 µM TIC, 17.5 µM loperamide, 15 µM pimozide, and 40 µM STF-62247. Scale bar = 50 µm. Significances are calculated versus untreated cells of the same cell line. *p < 0.05, **p < 0.01, ***p < 0.001. UT untreated, IM imipramine hydrochloride, TIC ticlopidine, LOP loperamide, PIMO pimozide, STFSTF-62247To accurately corroborate the effects of these compounds on the autophagic flux we used the dual GFP/RFP-LC3B autophagy flux sensor system that has been described recently[48]. This system is based on the expression of the GFP-LC3B-RFP-LC3BΔG fusion protein, composed of green fluorescent protein (GFP) fused to WT LC3B and red fluorescent protein (RFP) fused to the LC3BGly120 mutant (Fig. 7b). Upon ectopic expression, this fusion protein is intracellularly cleaved by the ATG4 proteases into equimolar ratios (Fig. 7b). GFP-LC3B localizes to autophagosomes and eventually becomes partly degraded in autolysosomes upon induction of autophagy. However, the mutated RFP-LC3BΔG cannot be conjugated to autophagosomes and remains cytosolic without being turned over by autophagy, thus serving as internal control (Fig. 7b). We therefore assessed GFP and RFP protein levels by Western blotting upon the induction of autophagy by loperamide, pimozide, and STF-62247. Importantly, all three compounds led to a decrease of GFP protein levels, whereas RFP levels remained stable (Fig. 7c). In contrast, both GFP and RFP levels remained stable upon compound treatment of ATG7 KO cells (Fig. 7c).To confirm these findings we quantified GFP/RFP ratios by flow cytometry. This analysis showed that loperamide, pimozide, STF-62247, and IM/TIC did indeed reduce the GFP/RFP fluorescence ratio in WT MZ-54 cells, reflecting an enhancement of the autophagic flux (Fig. 7d). Consistently, the addition of BafA1 prevented the decrease of the GFP/RFP ratio by preventing lysosomal degradation of GFP-LC3B (Fig. 7d). In contrast, ATG7 KO MZ-54 cells expressing the GFP/RFPLC3B sensor did not display differences in GFP/RFP ratios upon treatment with any of the compounds (Fig. 7e).Next, we validated these findings by fluorescence microscopy. Indeed, treatment of WT GFP/RFPLC3B reporter-expressing cells with loperamide, pimozide, STF-62247, and IM/TIC led to a strong accumulation of distinct cytoplasmic GFP-positive puncta, likely representing expanding phagophores or autophagosomes, and an overall visible decrease of GFP fluorescence, whereas RFP fluorescence remained stable (Fig. 7f).In addition, fluorescence microscopy was performed on MZ-54 cells stably expressing LC3B fused to mRFP and GFP. Upon induction of autophagy, this mRFP-GFP-LC3B fusion protein localizes to autophagosomes and their precursor structures and emits yellow fluorescence[49]. As soon as this fusion protein reaches the lysosomal lumen, the GFP fluorescence becomes quenched due to the acidic environment, leading to a net stabilization of red fluorescence signals[49]. Therefore, accumulation of red fluorescent signals indicates an induction of the autophagic flux[49]. Indeed, treatment with loperamide, pimozide, STF-62247, or IM/TIC led to a marked accumulation of yellow and red puncta, representing autophagosomes and autolysosomes, respectively (Suppl. Fig. S8 A-B). As expected, addition of BafA1 inhibited the formation of autolysosomes (Suppl. Fig. S8 A-B). Together, these findings confirm that loperamide, pimozide, and STF-62247 induce autophagy-dependent cell death by enhancing the autophagic flux.
Discussion
As ACD has been described as a possible therapeutic approach in GBM, the identification of agents that trigger ACD has attracted considerable interest[6,24,26,29,50,51]. Using CRISPR/Cas9-derived ATG5 and ATG7-deficient models, we identified loperamide, pimozide, and STF-6224 as three novel candidates that induce biochemical and cellular hallmarks of autophagy and autophagy-dependent cell death in several GBM cell lines.Several lines of evidence confirm the induction of autophagy and subsequent cell death by these compounds. First, biochemical and cellular characteristics of autophagy as well as cell death induced by loperamide, pimozide or STF-6224 were significantly reduced by depletion of ATG5 or ATG7 expression. Second, we demonstrated that loperamide, pimozide, and STF-62247 induced an increase in the autophagic flux of MZ-54 cells that was potentiated by inhibition of lysosomal maturation and reduced by loss of ATG5 or ATG7 expression. Third, loperamide- and pimozide-treated MZ-54 cells were characterized by distinct and prominent ultrastructural hallmarks of autophagy, which are generally considered as a gold standard for the analysis of autophagy[23]. Fourth, we demonstrated that cell death induced by loperamide, pimozide, and STF-62247 was not primarily mediated via apoptosis, necroptosis or ferroptosis, as typical pharmacological inhibitors of these cell death modalities largely failed to prevent cell death. Therefore, cell death induced by loperamide, pimozide, and STF-62247 is dependent on autophagy and can be classified as ACD[17,23,52].STF-62247 has previously been discovered in a small molecule-based screen to induce ACD in renal carcinoma cells[53]. By performing a screen in a yeast KO collection, a network of vesicular trafficking between the endoplasmic reticulum (ER), the trans-Golgi network and lysosomes was suggested as a target of STF-62247[53]. Consistent with this hypothesis, several studies highlighted the relevance of the trans-Golgi network for autophagosome formation and the initiation of autophagy[54,55].While both loperamide and pimozide have previously been reported to stimulate autophagy in a high-throughput fluorescence microscopy-based screen of H4 GBM cells[56], our study is the first to show that loperamide and pimozide trigger ACD. Loperamide is a Food and Drug Administration (FDA)-approved piperidine derivate that inhibits voltage-gated L-type calcium (Ca2+) channels[57]. Pimozide is an FDA-approved diphenylbutylpiperidine that targets D2 dopaminergic receptors[58]. It is used in the clinic for the treatment of schizophrenia, but also as an experimental anticancer drug[59,60]. Interestingly, it has been demonstrated that pimozide is a potent inhibitor of low voltage-gated T-type Ca2+ channels[61].In several studies, Ca2+ channel antagonists have been associated with autophagy regulation; however, their exact effects on autophagy are still being controversially discussed[62]. For instance, an increase in intracellular Ca2+ has been shown to inhibit mTORC1 signaling through Ca2+/calmodulin-dependent protein kinase 2 (CAMKK2/CaMKKβ) and AMP-activated protein kinase (AMPK), leading to accumulation of autophagosomes[63]. On the other hand, an inhibitory role of enhanced intracellular Ca2+ levels on autophagy has been reported as well. Increases in Ca2+ activate calpains and adenylate cyclase, leading to increased levels of 3′-5′-cyclic adenosine monophosphate (cAMP)[64]. cAMP stimulates inositol triphosphate (IP3) production that activates inositol 1,4,5-triphosphate receptors (ITPRs) on the ER membranes to secrete Ca2+, resulting in autophagy inhibition by maintaining enhanced mTORC1 activity[65]. Moreover, Ca2+ release from the ER and the subsequent decrease in intra-ER Ca2+ levels were shown to promote misfolding of the lysosomal proton pump vATPase, leading to impaired lysosomal acidification and autophagy[66,67]. According to this scenario, inhibition of Ca2+ channels through loperamide and pimozide may enhance autophagy indirectly through a release from autophagy inhibition. Interestingly, apart from enhancing autophagy through lowering IP3 levels, inhibition of voltage-gated channels has also been shown to induce autophagy through inhibition of calpain-mediated cleavage of ATG5[68].Moreover, our study suggests that loperamide, pimozide, and STF-62247 regulate autophagy through dephosphorylation of mTORC1, a master regulator of autophagy[69]. This is consistent with recent findings showing that STF-62247 inhibits mTORC1[70]. Loperamide and pimozide may lead to a decrease in intracellular Ca2+ levels through inhibition of voltage-gated Ca2+ channels. Interestingly, a rise of intracellular Ca2+ has been reported to promote binding of Ca2+-bound calmodulin (CALM) to PIK3C3/VPS34, resulting in mTORC activation and autophagy suppression[71]. In line with these findings, we observed that loperamide- and pimozide-induced autophagy is accompanied by dephosphorylation and inactivation of mTORC1. Furthermore, several studies highlighted a role for ROS in autophagy induction[15,40]. For instance, it was shown that ROS formation can contribute to ACD while antioxidants can reverse autophagy, suggesting that ROS formation precedes autophagy under certain circumstances[40,72].So far, there have been few studies on selective mediators of ACD. Recently, glucocerebrosidase (GBA1) has been identified by a signalome-wide shRNA-based cell viability screen as a critical mediator of autophagic self-consumption and ACD[25]. Yu et al. reported that autophagy promotes cell death by selective digestion of the ROS scavenger catalase[21]. A study by Karch et al. demonstrated that the BCL-2 family members BAX and BAK are essential for serum starvation-induced ACD in mouse embryonic fibroblasts (MEFs) by increasing lysosomal membrane permeability[73]. Moreover, TP53 has previously been shown to regulate sphingosine kinase 1 (SPHK1)-induced ACD in colon carcinoma cells[74].In recent years, several scenarios have been developed to explain how increased autophagy can lead to cell death. The simplest explanation is a threshold effect of autophagy: in this model, extensive and prolonged hyperactivation of autophagy triggers cellular self-digestion via the autophagosomal-lysosomal pathway beyond the point that allows cell survival[18,19,75]. Indeed, our present study shows that loperamide, pimozide, and STF-62247 induced a strong accumulation of LC3B-positive autophagosomes and autolysosomes prior to cell death over a period of 48 h, hence supporting the hypothesis of a threshold effect which possibly turns autophagy into a detrimental process. However, it remains subject to future investigations to identify the pathways and factors that are responsible for ACD upon treatment with loperamide, pimozide and STF-62247.An important prerequisite for the delivery of compounds to brain tumors is their transfer through the blood−brain barrier, which tightly regulates the passage of soluble molecules from the blood to the brain[76]. Pimozide is used in the clinic for treatment of schizophrenia[59], loperamide was shown to be delivered to the brain when loaded to polysorbate 80-coated poly(butyl cyanoacrylate) nanoparticles[77] and STF-62247 may well pass the blood−brain barrier due to its hydrophobic nature and small size. This suggests that all three compounds may be able to reach the brain compartment.In summary, we have identified in the present study that loperamide, pimozide, and STF-62247 induce ACD in GBM cells. Essentially, until now two of these compounds, i.e. loperamide and pimozide, have not been reported to induce ACD in any cellular model system. Thus, our study emphasizes the critical role of autophagy and ACD in GBM cells and provides novel options for the treatment of these apoptosis-resistant tumors.
Materials and methods
Cell lines and chemicals
The humanglioma cell lines MZ-54[26,29], LN-229, and U343 GOS-3 as well as the humancolon carcinoma cell line HT-29 were cultured in DMEM GlutaMAX medium (Life Technologies, Inc., Eggenstein, Germany) supplemented with 10% fetal calf serum (FCS) (Life Technologies, Inc., Eggenstein, Germany) and 1% penicillin/streptomycin (Life Technologies, Inc., Eggenstein, Germany) at 37 °C and 5% CO2. Cells were regularly tested for mycoplasma infection. Cells were authenticated by STR profiling at DSMZ (Sammlung von Mikroorganismen und Zellkulturen GmbH). Imipramine hydrochloride, ticlopidine, Fer-1, pimozide, epidermal growth factor (EGF), α-Toc, (±)-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (trolox) and puromycin were purchased from Sigma-Aldrich (St. Louis, Missouri, USA). Loperamide hydrochloride, rapamycin and STS were purchased from Enzo Life Sciences (Lausen, Switzerland). STF-62247 was purchased from Santa Cruz Biotechnology, Inc. (Dallas, Texas, USA), RSL3 from InterBioScreen (InterBioScreen ltd., Russia), etoposide from TEVA GmbH (Ulm, Germany), ABT-737 from Selleck Chemicals (Houston, Texas, USA) and G418 and reduced GSH from Carl Roth (Karlsruhe, Germany). The caspase inhibitor zVAD.fmk was purchased from Bachem (Heidelberg, Germany) and Nec-1s from Biomol (Hamburg, Germany). The Smac mimetic BV6 was kindly provided by Genentech Inc. (South San Francisco, CA, USA). Recombinant humanTNFα was purchased from Biochrom (Berlin, Germany).
Generation of ATG5/7 CRISPR/Cas9 KO cells
To generate ATG5 and ATG7 KO cells, guide RNAs for ATG5 (MZ-54ATG5 KO: TCAGGATGAGATAACTGAAA and CCTCTAATGCTACCACTCAG, U343 ATG5 KO: AAGATGTGCTTCGAGATGTG and CCTCTAATGCTACCACTCAG) and ATG7 (MZ-54ATG7 KO: AATAATGGCGGCAGCTACGG and AAAGCTGACACTATACTGG, LN-229ATG7 KO: AATAATGGCGGCAGCTACGG and AAGCTGACACTATACTGG) were cloned into SpCas9(BB)-2A-GFP (PX458) or pSpCas9(BB)-2A-Puro (PX459) V2.0 from Feng Zhang (Addgene plasmids #48138 and #62988, respectively) by using BbsI according to standard cloning procedures[78]. Plasmids were verified using DNA sequencing. Lipofectamine 3000 was used to transfect both ATG5 and ATG7 sgRNAs into the corresponding GBM cells (DNA/Lipofectamine 3000 ratio 1:1.5) according to the manufacturer’s instructions. 72 h after transfection, SpCas9(BB)-2A-GFP-transfected cells were sorted into a 24-well plate with an FACS Aria II cell sorter (BD Biosciences). 48 h after transfection, cells transfected with pSpCas9(BB)-2A-Puro were selected with 1 µg/mL puromycin. Next, single cell dilution into 96-well plates was performed using conditioned medium containing 50% sterile-filtered medium from cultured cells and 50% fresh medium for 72 h in order to ensure growth under single cell conditions. ATG5 and ATG7 KO colonies were expanded and confirmed by PCR analysis and western blot.
Screening of autophagy-inducing compounds
Parental MZ-54 cells as well as ATG5 KO cells were seeded at 6500 cells/96-well followed by treatment with autophagy-inducing compounds of the Enzo Screen-Well™ library (Enzo Life Sciences, Lausen, Switzerland). Compounds were added to final concentrations between 100 nM and 100 µM. Cell death was assessed after 48 h by fluorescence-based microscope analysis of propidium iodide (PI) uptake using Hoechst 33342 and PI double staining (Sigma-Aldrich, St. Louis, Missouri, USA) as well as ImageXpress Micro XLS Widefield High-Content Analysis System and MetaXpress Software according to the manufacturer’s instructions (Molecular Devices Sunnyvale, CA, USA).
Generation of pMRX-IP-GFP-LC3B-RFP-LC3BΔG-expressing cells and determination of autophagic flux
Parental MZ-54 and ATG5/7 KO cells were transfected with pMRX-IP-GFP-LC3B-RFP-LC3B∆G (Addgene plasmid # 84572, a gift from Noboru Mizushima[48]) by using Lipofectamine 2000 according to the manufacturers’ instructions. 48 h after transfection, cells were selected with 1 µg/mL puromycin for 7 days. For determination of autophagic flux, cells were seeded on Greiner black micro-clear 96-well plates at 10,000 cells/well and imaged with the ImageXpress Micro XLS Widefield High-Content fluorescence microscope (Molecular Devices Sunnyvale, CA, USA) by using the 60× objective and the FITC and Texas Red filter system for imaging of GFP-LC3B and RFP-LC3B∆G, respectively. Image analysis was performed with ImageJ (v1.51t).
Generation of mRFP-GFP-LC3B-expressing cells and measurement of the autophagic flux
Parental MZ-54 and MZ-54ATG5/7 KO cells were transfected with the mRFP-GFP-LC3B plasmid (Addgene #21074) by using Lipofectamine 3000 according to the manufacturer’s instructions. 48 h after transfection, cells were selected with 1 mg/mL G418. For determination of the autophagic flux, cells were seeded into chamber slides without selection of antibiotic at 12,000 cells/well, treatment was performed as indicated and cells were fixed with 4% paraformaldehyde for 10 min followed by ice-cold methanol for 5 min. After washing with 0.1% triton-X in phosphate-buffered saline (PBS), cover glasses were fixed with mounting medium containing DAPI (Dianova, Hamburg, Germany). Microscope images were taken with the Nikon Eclipse TE2000-S microscope and NIS Elements AR 3.2 software (Nikon Instruments Europe BV, Amsterdam, Netherlands) with 60× magnification.
Assessment of the autophagic flux by flow cytometry
To determine autophagic flux by FACS, cells stably expressing pMRX-IP-GFP-LC3B-RFP-LC3BΔG were pelletized and resuspended in 50 µL of PBS. Measurements were performed with an FACS Accuri flow cytometer according to the manufacturer’s instructions (BD Biosciences, Heidelberg, Germany). For calculation of GFP/RFP ratios, the mean fluorescence intensity (MFI) ratio of GFP and RFP of untreated WT and ATG7 KO cells was set to 100%. MFI ratios of compound-treated samples were then normalized to the corresponding control cell line.
Determination of cell death
Cell death was measured by fluorescence-based microscope analysis of PI uptake using Hoechst 33342 and PI double staining (Sigma-Aldrich, St. Louis, Missouri, USA) and the ImageXpress Micro XLS Widefield High-Content Analysis System and MetaXpress Software according to the manufacturer’s instructions (Molecular Devices Sunnyvale, CA, USA).
Immunofluorescence analyses
For immunofluorescence staining of LC3B, MZ-54 cells were seeded at 10,000 cells/96-well. For immunofluorescence, cells were fixed with 3.7% paraformaldehyde for 10 min, followed by a washing step with PBS and permeabilization with 0.1% Triton-X diluted in PBS for 10 min. After washing with PBS, cells were blocked with an antibody dilution buffer (ADB) containing 0.9% NaCl, 10 mM TrisHCl pH 7.5, 5 mM EDTA and 1 mg/mL BSA for 10 min. Cells were incubated with an antibody against LC3B (Thermo Fisher, PA1-46286) diluted 1:350 in ADB for 1 h. After three washing steps with 0.1% Tween-20 diluted in PBS (PBS-T), cells were incubated with Cy3TM AffiniPure donkey-a-rabbit IgG (Jackson Immuno Research Laboratories, Inc.) diluted 1:800 in ADB for 30 min. After three washing steps with PBS-T, Hoechst 33342 was added to the cells diluted 1:15,000 in PBS followed by image acquisition with the ImageXpress Micro XLS Widefield High-Content Analysis System (Molecular Devices Sunnyvale, CA, USA) by using the 60× objective and the DAPI and TRITC filter system for acquisition of Hoechst-stained nuclei and Cy3TM-stained LC3B, respectively. Image analysis was performed using ImageJ 1.51t.
Caspase activity assay
For measurement of caspase-3-like activity, 30,000 cells were seeded per 24-well. Cells were lysed in lysis buffer containing 10 mM HEPES, pH 7.4, 42 mM KCl, 5 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol (DTT), 1 μg/mL pepstatin A, 1 μg/mL leupeptin, 5 μg/mL aprotinin, 0.5% 3-(3-cholamidopropyldimethylammonio)-1-propane sulfonate (CHAPS). 50 μl of cell lysate were added to 150 µL reaction buffer (25 mM HEPES, 1 mM EDTA, 0.1% CHAPS, 10% sucrose, 3 mM DTT, pH 7.5) containing the fluorigenic substrate Ac-DEVD-AMC (Enzo Life Sciences, Lausen, Switzerland) at a final concentration of 10 μM. 7-Amino-4-methylcoumarin (AMC) fluorescence was monitored for 2 h using a Spark multimode microplate reader (Tecan Group AG, Männedorf, Switzerland). Changes in fluorescence measured over 2 h were normalized to the total protein content of the lysate. Caspase activity was expressed as change in fluorescence units per μg protein and hour.
Electron microscopy
For conventional transmission electron microscopy, MZ-54 WT cells were treated with the indicated concentrations of the compounds. After 48 h, an equal volume of double strength fixatives (4% paraformaldehyde, 4% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4)) was added to the cells for 20 min at room temperature, prior to fixing the cells with one volume of 2% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4) for 2 h at room temperature. Cells were then scraped and embedded as previously described[79]. Ultra-thin 70-nm sections were cut using the Leica EM UC7 ultra microtome (Leica Microsystems, Wetzlar, Germany) and stained with uranyl acetate and lead citrate as previously described[79]. Cell sections were analyzed using a CM100bio TEM (FEI, Eindhoven, Netherlands). The average number of autophagosomes and degradative compartments (amphisomes, lysosomes and autolysosomes) per cell section was determined by counting these compartments through 120 cell sections per condition, randomly selected from five independent grids.
Western blot analysis
Western blot analysis was performed as described previously using RIPA buffer (50 mM Tris-HCl, pH 8, 1% Triton-X, 0.5% sodium deoxycholate, 150 mM sodium chloride and 2 mM magnesium chloride) supplemented with Pierce Nuclease (Thermo Fisher, Waltham, MA, USA)[80]. The following antibodies were used: monoclonal rabbit anti-ATG7, rabbit anti-ATG5, rabbit anti-phospho mTOR (Ser2446), rabbit anti-mTOR, rabbit anti-phospho S6 Ribosomal Protein (Ser240/244), mouse anti-S6 Ribosomal Protein (54D2) (Cell Signaling, Beverly, MA, USA), mouse anti-vinculin (Sigma, Germany) and rabbit anti-LC3B (Thermo Fisher, Waltham, MA, USA). Goat anti-mouse and goat anti-rabbit conjugated to horseradish peroxidase (Santa Cruz Biotechnology, Santa Cruz, CA, USA) as well as enhanced chemiluminescence (Amersham Biosciences, Freiburg, Germany) were used for detection. Representative blots of at least two independent experiments are shown. Quantification of band intensities was performed using ImageJ 1.51t.
Determination of ROS production
To analyze ROS production, medium was discarded, and cells were stained for 30 min at 37 °C with 5 μM CM-H2DCFDA (Invitrogen). Subsequently, cells were trypsinized and centrifuged for 10 min at 4 °C. Supernatant was discarded and cells were resuspended in phenol red-free RPMI medium (Life Technologies, Inc.) and immediately analyzed by flow cytometry.
Statistical analysis
Results are expressed as mean ± SEM. Statistical analysis was performed with SigmaPlot (v12.5). Statistical significance of two group data was analyzed by Student’s t test (two-tailed). If samples did not pass either the Shapiro−Wilk Normality Test or the Equal Variance test, statistical significance was analyzed by Mann−Whitney Rank Sum Test. p values were interpreted as follows: *p < 0.05; **p ≤ 0.01; ***p ≤ 0.001.Supplemental Material
Authors: David N Louis; Arie Perry; Guido Reifenberger; Andreas von Deimling; Dominique Figarella-Branger; Webster K Cavenee; Hiroko Ohgaki; Otmar D Wiestler; Paul Kleihues; David W Ellison Journal: Acta Neuropathol Date: 2016-05-09 Impact factor: 17.088
Authors: Nadia Bouhamdani; Andrew Joy; David Barnett; Kevin Cormier; Daniel Léger; Ian C Chute; Simon Lamarre; Rodney Ouellette; Sandra Turcotte Journal: Int J Cancer Date: 2017-05-25 Impact factor: 7.396
Authors: Sandra Turcotte; Denise A Chan; Patrick D Sutphin; Michael P Hay; William A Denny; Amato J Giaccia Journal: Cancer Cell Date: 2008-07-08 Impact factor: 31.743
Authors: Santosh K Dasari; Shani Bialik; Smadar Levin-Zaidman; Vered Levin-Salomon; Alfred H Merrill; Anthony H Futerman; Adi Kimchi Journal: Cell Death Differ Date: 2017-06-02 Impact factor: 15.828
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: Louis Chonco; Tomás Landete-Castillejos; Gemma Serrano-Heras; Martina Pérez Serrano; Francisco Javier Pérez-Barbería; Carlos González-Armesto; Andrés García; Carlos de Cabo; Jose Manuel Lorenzo; Chunyi Li; Tomás Segura Journal: Sci Rep Date: 2021-01-08 Impact factor: 4.379