Literature DB >> 30143025

Identification of a putative methyltransferase gene of Babesia bigemina as a novel molecular biomarker uniquely expressed in parasite tick stages.

Gamila A R Bohaliga1, Wendell C Johnson2, Naomi S Taus1,2, Hala E Hussein1,3, Reginaldo G Bastos1, Carlos E Suarez2, Roberta O'Connor1, Massaro W Ueti4,5,6.   

Abstract

BACKGROUND: Bovine babesiosis is caused by apicomplexan pathogens of the genus Babesia such as B. bigemina and B. bovis. These tick-borne pathogens have a complex life-cycle involving asexual multiplication in vertebrate hosts and sexual reproduction in invertebrate vectors. In the tick midgut, extracellular Babesia parasites transform into gametes that fuse to form zygotes. Understanding the mechanisms that underlie formation of extracellular Babesia tick stages is an important step towards developing control strategies for preventing tick infection and subsequent parasite transmission.
RESULTS: We induced B. bigemina sexual stages in vitro by exposing parasites to Tris 2-carboxyethyl phosphine (TCEP). Subsequently, we identified a novel putative methyltransferase gene (BBBOND_0204030) that is expressed uniquely in all B. bigemina tick stages but not in blood stages. In vitro TCEP-exposed B. bigemina presented diverse morphology including parasites with long projections, round forms and clusters of round forms indicative of sexual stage induction. We confirmed the development of sexual stages by detecting upregulation of previously defined B. bigemina sexual stage marker genes, ccp2 and 3, and their respective protein expression in TCEP-induced B. bigemina cultures. Next, transcription analysis of in vitro TCEP-induced B. bigemina culture based on an in silico derived list of homologs of Plasmodium falciparum gamete-specific genes demonstrated differential expression of the gene BBBOND_0204030 in induced cells. Further examination of ex vivo infected ticks demonstrated that BBBOND_0204030 is transcribed by multiple stages of B. bigemina during parasite development in tick midgut, ovary and hemolymph. Interestingly, ex vivo results confirmed our in vitro observation that blood stages of B. bigemina do not express BBBOND_0204030 and validated the in vitro system of inducing sexual stages.
CONCLUSIONS: Herein we describe the identification of a B. bigemina gene transcribed exclusively by parasites infecting ticks using a novel method of inducing B. bigemina sexual stages in vitro. We propose that this gene can be used as a marker for parasite development within the tick vector. Together, these tools will facilitate our understanding of parasite-tick interactions, the identification of novel vaccine targets and, consequently, the development of additional strategies to control bovine babesiosis.

Entities:  

Keywords:  Babesia bigemina; In vitro induction; Parasite-specific tick stage genes; Rhipicephalus microplus; Sexual stages; TCEP

Mesh:

Substances:

Year:  2018        PMID: 30143025      PMCID: PMC6109354          DOI: 10.1186/s13071-018-3052-9

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Cattle tick fever is a globally distributed bovine apicomplexan disease that is transmitted by multiple ixodid tick species. Babesia bigemina and B. bovis are the main causative agents of cattle tick fever in tropical and subtropical regions. This disease has a negative economic impact on the cattle industry due to the cost of treatment, morbidity and mortality. Animals infected with B. bigemina develop high fever, lethargy, severe anemia, and hemoglobinuria. Animals that survive become persistently infected for life and are reservoirs for tick transmission [1]. Babesia bigemina is more prevalent than other Babesia parasites because it is transmitted by several tick species including Rhipicephalus microplus, R. annulatus, R. appendiculatus, R. evertsi, Boophilus decoloratus and B. geigyi, as well as multiple stages of these ticks, including nymph and adult stages [1-5]. Similar to Plasmodium spp., the causative agent of malaria, B. bigemina has a complex life-cycle, including asexual reproduction in the mammalian host and sexual reproduction in the tick host. The B. bigemina life-cycle in the mammalian host begins when infected nymphs or adults of the tick vector feed on a bovine. Tick vectors inoculate sporozoites during the blood meal and parasites invade erythrocytes. Within erythrocytes, parasites transform into trophozoites, and then merozoites which lyse the infected cells and invade new erythrocytes, perpetuating the cycle of asexual reproduction in the bovine host. Adult female ticks ingest B. bigemina blood stages during feeding on an infected animal. In the tick midgut, parasite sexual stages (gametes) are induced which fuse to form zygotes that invade midgut epithelial cells. Babesia kinetes are released into the hemolymph and transmitted to tick progeny, in what is known as transovarial transmission [1, 6]. There remain fundamental knowledge gaps regarding the role of B. bigemina tick stage genes involved in parasite development within the arthropod vector. The availability of arthropod-borne apicomplexan parasite genomes provides the opportunity to identify genes that contribute to parasite perpetuation within mammalian and arthropod vector hosts [7-10]. Those available genomes have facilitated the identification of genes and gene families that are conserved across the genera Plasmodium and Babesia, such as the cysteine motif-rich gene family, the ccp gene family and the hap2 gene. These conserved genes are expressed by Plasmodium spp. and Babesia spp. gametes during parasite development within the biological vectors [11-17]. In malaria, in vitro approaches have been used to test efficacy of drugs or vaccines to block parasite transmission [18]. One of the challenges in studying Babesia gametocytes is the lack of in vitro techniques to consistently induce gametogenesis which restricts evaluation of drugs or vaccines targeting parasite sexual stage proteins. Two studies have successfully induced B. bigemina sexual stages using xanthurenic acid, but both studies required ex vivo blood stages as starting materials [13, 19]. However, malaria gametogenesis can be induced from in vitro adapted parasites. This has been accomplished by using a reducing agent, dithiothreitol (DTT) which induces endoplasmic reticular stress resulting in morphological and transcriptional transformations leading to gametogenesis [20, 21]. Similar to DTT, Tris 2-carboxyethyl phosphine (TCEP) is a reductant [22]. A study of four stages of P. falciparum including sporozoites, merozoites, trophozoites, and gametocytes revealed that there are specific genes uniquely expressed by each stage in the life-cycle of malaria parasites [23]. Like Plasmodium, Babesia genes are expected to be expressed at specific life-cycle stages during infection of the mammalian host or tick vector. In this study, we describe the identification of a novel tick-stage specific protein encoded by gene BBBOND_0204030 using bioinformatic approaches and TCEP to induce B. bigemina sexual stages in vitro. Importantly, gene BBBOND_0204030 was expressed by in vitro induced B. bigemina sexual stages and in multiple in vivo parasite tick stages but not by blood stages.

Methods

In vitro induction of B. bigemina sexual stages

Culture adapted B. bigemina was used for inducing sexual stages in vitro. In brief, B. bigemina-infected erythrocytes were grown in HL-1 medium (Lonza, Walkersville, MD, USA) supplemented with 40% normal bovine serum, 10 mM 3-[N-tris (hydroxymethyl) methylanino]-2-hydroxypropanesulfonic acid (Sigma-Aldrich, St. Louis, MO, USA), and antibiotic/antimitotic (Sigma-Aldrich), pH 7.2, with 5% packed cell volume of bovine red blood cells. To increase parasitemia, cultures were incubated at 37 °C in 5% CO2 and expanded without addition of erythrocytes as previously described [24]. When the parasitemia exceeded 10%, B. bigemina sexual stages were induced by adding either TCEP (Thermo Fisher Scientific, Grand Island, NY, USA) or DTT (Thermo Fisher Scientific, Fair Lawn, NJ, USA) [20, 21]. TCEP and DTT stock concentrations were at 500 mM for both reagents. The final concentration of reducing agents in induction medium was 0, 10, 20, 25, 30 or 40 mM and contained equal volumes of solvent. Induction medium was balanced to pH 7.2 by the addition of 5 M HCl. Cultures were incubated for 1 h at 26 or 37 °C with or without 5% CO2. Cultures were then washed once with fresh medium to remove excess of reducing agent and centrifuged at 2655× g for 3 min. Parasites were cultured in fresh medium with or without 100 μM xanthurenic acid (Sigma-Aldrich) and incubated for up to 24 h at 26 or 37 °C with or without 5% CO2. Smears were made from all cultures at 3, 6, 15 and 24 h post-induction and stained with Hema 3 stain (Thermo Fisher Scientific, Waltham, MA, USA) to analyze the formation of sexual stages. To estimate cell viability, B. bigemina non-induced and TCEP-induced cultures were incubated in two different condition at 37 °C with or without 5% CO2 for 24 h. Parasites were collected and washed 3 times with 1× phosphate buffered saline (PBS), suspended in 1× PBS and mixed with equal volume of 6-carboxyfluorescein diacetate (6-CFDA) [25] final concentration in 1× PBS 20 μg/ml (Calbiochem-Behring, La Jolla, CA, USA). Cells were incubated at room temperature for 15 min and washed once with 1× PBS. Cells pellets were suspended in 1× PBS and one drop of ProLong Gold anti-fade reagent with DAPI (Invitrogen, Eugene, OR, USA) was added to each sample under a coverslip. All samples were visualized under a Leica microscope (Buffalo Grove, IL, USA) using LAS-X software.

Scanning electron microscopy

Morphology of Babesia bigemina sexual stages was analyzed for greater detail using scanning electron microscopy. In brief, B. bigemina-induced cultures were centrifuged at 400× g for 1 min to differentially pellet erythrocytes. Supernatant was recovered into new tubes and extra-erythrocytic B. bigemina sexual stages collected by centrifugation at 3000× g for 15 min. Sexual stage parasite pellets were washed three times in 1× PBS. Samples were fixed in 2% paraformaldehyde, 2% glutaraldehyde, 0.1 M phosphate buffer and incubated overnight at 4 °C. Samples were rinsed twice with distilled water and post-fixed overnight in 2% osmium tetroxide. After water rinses, samples were dehydrated with an ethanol series (30–100%). Final drying used hexamethyldisilazane (HMDS). Samples were suspended in HMDS, pipetted onto a coverslip attached to an aluminum scanning electron microscopy (SEM) stub and placed in a vacuum desiccator overnight prior to gold coating [26]. Samples were imaged on an FEI SEM Quanta 200F at the Franceschi Microscopy and Imaging Center, Washington State University, Pullman, WA, USA.

Reverse transcriptase real-time quantitative PCR (RT-qPCR) of B. bigemina sexual stage marker genes

To test the expression level of defined sexual stage B. bigemina ccp2 (BBBOND_0203950) and ccp3 (BBBOND_0312400) genes in cultures induced with TCEP, RT-qPCR was performed [12]. Non-induced and TCEP-induced parasite cultures were collected at 0, 6, 15 and 24 h post-induction and washed once with 1× PBS at 2655× g for 15 min, and the pellets suspended in Trizol (Thermo Fisher Scientific, Waltham, MA, USA) for total RNA isolation. Total RNA was isolated and treated with DNase-Free (Thermo Fisher Scientific, Waltham, MA, USA). Five-hundred nanograms of total RNA was utilized for cDNA synthesis using a Superscript IІI™ cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s protocol. Primer sets for B. bigemina ccp2-3 and actin were designed based on B. bigemina genomic sequences and listed in Table 1 [27]. The RT-qPCR was performed in a CFX96™ Real-Time PCR Detection System and reactions were performed in triplicate in 20 μl using 10 μl SsoFast™ EvaGreen® Supermix (Bio-Rad, Hercules, CA, USA), 1 μl of 500 nM of each primer set, 6 μl of nuclease free water and 2 μl of a 1:10 dilution of cDNA as template. The cycling conditions consisted of an enzyme activation step of 95 °C for 30 s followed by 40 cycles of 95 °C denaturation for 5 s and annealing/extension at 55 °C for 5 s. The B. bigemina actin gene (BBBOND_0107357) was used as a reference gene and the transcription level of ccp genes was calculated relative to time zero (non-induced) parasites, using the formula: relative expression (sample) = 2 [C, where time zero was used as Cq control. We used Bio-Rad CFX Manager Software version 3.1 to analyze the RT-qPCR data. Amplification efficiency and melt curve analyses were performed to evaluate analytical sensitivity and specificity of the RT-qPCR for each gene of interest. Standard PCR for B. bigemina actin (BBBOND_0107357) was performed to demonstrate the presence of amplifiable cDNA in all samples tested.
Table 1

Primer sets of B. bigemina homologs of P. falciparum gamete-specific genes

GeneForward primer (5'-3')Reverse primer (5'-3')Amplicon size (bp)
BBBOND_0204030GAGGAAATCGATGGGACGTATGGGTACTCCATGTGACGTTTAGG496
BBBOND_0204030 (nested PCR)ACATCTCTGCGTCTTGCATAAGGACTGTATGTATGCCCTTCAG204
BBBOND_0310420GAGCAGGTGGCGACATATTCCTTGATACCGTTTCCCATAGAG330
BBBOND_0110620GTCGAGAAAGGCCAGGATAAATGTGTCATGGGAGGGTTTG382
BBBOND_0308930CGAGGGCGCTACTCTATTCCACTGATGTTTCGTGGCTTAC267
BBBOND_0200260ATGTCGAAGGATTCCACTGCCTTGCGAGAGGATGGTGTG208
BBBOND_0311670GAAGCCTGAGTGGAACCTAAAGCGGAGGTGGGATTCATATT343
BBBOND_0208380TCGTCGCGTGGAATTCATAGTGTTCACCGCCTCGAAATAG449
BBBOND_0305250GCGAGTACTGCGGCATTTACTGAAGCCAAGCTGAGGTG295
BBBOND_0307580CGAAGATCCTCGTGCTGATAATGAGCGGGTTGTATAGGTACTTG386
BBBOND_0310760TGCTTCACCTGCGGCAATCAGATGTGCTCCTGGTTCC204
BBBOND_0311270ATCTGCAAGTTCTGGGAGAAGCATGTAGCCCTGCTGTTGATA477
BBBOND_0203950 (CCp2)TCCACAACAAGCAACTCCGCTTTGTAGGTAGAGTCAGC168
BBBOND_0312400 (CCp3)GAGTCCTCCGTGTAGATGAACGAAGCTTACTTGCTACGACAAC141
BBBOND_0307410 (HAP2)GCTGAAGACGAAGGTGAGGAGCGATGATCTGGGTGACG164
BBBOND_0107357 (actin)ATCGCCGTTTACACTTCACGGCCCCTTCCTCCTCGTAATC131
Primer sets of B. bigemina homologs of P. falciparum gamete-specific genes

Fixed immunofluorescence assay of B. bigemina sexual stage maker proteins

To determine B. bigemina sexual stage formation, fixed immunofluorescence assays (IFA) were performed as previously described [12, 28]. In brief, non-induced and induced B. bigemina cultures were collected and pelleted at 3000× g for 15 min at 4 °C. Cells were washed twice with 1× PBS at 3000× g for 15 min at 4 °C and pellets suspended in 3% BSA in 1× PBS. These cells were used to make smears on glass slides which were fixed in cold acetone for 1 min. The slides were blocked with 1× PBS containing 10% goat normal serum (PBS-NGS) and incubated for 30 min at 37 °C in a humidity chamber. Slides were rinsed with ddH2O and air dried. In a previous study, we generated and characterized anti-CCp2 and anti-CCp3 primary antisera [12]. The antibodies were diluted 1:20 in PBS-NGS and applied to individual wells. Slides were placed in a humidity chamber for 30 min at 37 °C. Slides were then rinsed once with ddH2O and washed three times for 10 min with cold 1× PBS. The slides were incubated for 30 min with goat anti-rabbit Alexa Fluor 647 conjugated secondary antibody diluted 1:1000 in PBS-NGS at 37 °C. All samples were washed twice in 1× PBS, once with ddH2O and air dried. Finally, one drop of ProLong Gold anti-fade reagent with DAPI (Invitrogen) was added to each sample under a coverslip. Identically produced negative controls were performed using pre-immune (PI) rabbit serum as the primary antibody. All samples were visualized under a Leica microscope using LAS-X software.

In silico identification of B. bigemina sexual stage genes

To identify B. bigemina homologs of P. falciparum gamete-specific genes, bioinformatic analysis was performed based on amino acid identity [23, 27] using NCBI Blastp (https: //blast.ncbi.nlm.nih.gov/Blast.). Clustal omega analysis (http://www.ebi.ac.uk/Tools/msa/clustalo/) was used to evaluate the percent amino acid identity of proteins. Protein domains conserved between B. bigemina and P. falciparum homologs were determined using the Simple Modular Architecture Research Tool (http://smart.embl-heidelberg.de/).

Reverse transcriptase PCR (RT-PCR) of B. bigemina homologs of P. falciparum gamete-specific genes

To identify qualitative changes in transcript expression profiles associated with B. bigemina sexual transformation, transcripts from TCEP-induced culture were compared against transcripts from non-induced cultures. At 24 h post-induction, samples were collected and washed once with 1× PBS at 2655× g for 15 min, and the pellets suspended in Trizol for total RNA isolation. Total RNA isolation and DNase-Free treatment were performed as described above. One-hundred nanograms of total RNA was utilized for cDNA synthesis using a Superscript IІI™ cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s protocol. Synthesized cDNA was used in RT-PCR to detect B. bigemina transcripts. Primer sets for B. bigemina homologs of P. falciparum gamete-specific genes are listed in Table 1 and were designed based on B. bigemina genomic sequences [27]. RT-PCR reactions were conducted in 20 μl containing 2 μl synthesized cDNA, 1 μl of 10 μM of each primer set, 6 μl nuclease-free water and 10 μl RedTaq (Sigma-Aldrich). The amplification conditions consisted of 3 min denaturation at 95 °C, 35 repeated cycles of 30 s denaturation at 95 °C, 30 s annealing at 62 °C and 30 s extension at 72 °C, with a final 7 min extension at 72 °C. Amplicons were resolved using 1% agarose gel electrophoresis. All PCR products were sequenced to determine gene specificity. Nested PCR was used to evaluate the transcription of BBBOND_0204030 in non-induced and TCEP-induced parasite cultures. Primer sets for BBBOND_0204030 are listed in Table 1. The first run of nested PCR condition with the set of external primers was 3 min of denaturation at 95 °C, 35 repeated cycles of 30 s for denaturation at 95 °C, 30 s for annealing at 62 °C and 30 s for extension at 72 °C, with a final 7 min extension at 72 °C. The second run of nested PCR condition with the set of internal primers was 3 min of denaturation at 95 °C, 35 repeated cycles of 30 s for denaturation at 95 °C, 30 s for annealing at 57.2 °C and 30 s for extension at 72 °C, with a final 7 min extension at 72 °C. Amplicons were resolved using 2% agarose gel electrophoresis.

Babesia bigemina infection of adult female R. microplus ticks

A splenectomized Holstein calf, four months of age and tested to be bovine babesiosis-free by nested PCR and competitive enzyme-linked immunosorbent assay, was infected with a B. bigemina Mexico strain isolated from a naturally infected calf in Mexico [29, 30]. The La Minita strain of R. microplus ticks, originated from cattle on pasture in Starr County, Texas, was used for the acquisition of B. bigemina. We have previously demonstrated this R. microplus colony efficiently acquires parasites from B. bigemina infected calves and form kinetes in the tick hemolymph [28]. In brief, about 40,000 R. microplus larvae were applied under a cloth back patch on the splenectomized calf. After 14 days, when approximately 1% of ticks had molted to adults, B. bigemina-infected erythrocytes were inoculated intravenously into the calf to synchronize tick acquisition feeding with an ascending B. bigemina parasitemia. Engorged female ticks were collected 7–9 days post-B. bigemina infection, rinsed in tap water, and placed into tissue culture plates in airtight containers with saturated KNO3 solution at 26 °C and 92% relative humidity and incubated to allow formation of B. bigemina sexual stages and kinetes in the tick midgut and hemolymph, respectively. Incubated female ticks were examined daily for B. bigemina infection as previously described [31].

Detection of stage-specific B. bigemina transcripts

Babesia bigemina-infected ticks were identified by removing the distal leg segment of engorged female ticks, dropping exuding hemolymph onto slides and staining with Giemsa. The slides were examined by light microscopy for the presence of B. bigemina kinetes as previously described [31]. Infected female ticks were dissected daily from day 0 through day 6 post-incubation. Tick midgut, hemolymph and ovaries were collected in Trizol (Thermo Fisher Scientific, Waltham, MA, USA) and stored at -80 °C. Total RNA was extracted from tick tissues, treated with DNase-Free, cDNA synthesized, and RT-PCR was performed as described before. All PCR products were sequenced to confirm the origin of the amplicon.

Statistical analysis

Bio-Rad CFX Manager Software version 3.1 was used to analyze gene expression levels in a pairwise manner. The results were expressed as the mean ± SEM. P value < 0.05 was considered statistically significant.

Results

In vitro exposure of B. bigemina to TCEP

Babesia bigemina cultures were treated either with TCEP or DTT for 1 h and washed into medium with or without xanthurenic acid. Cultures were incubated at two different temperatures in the presence or absence of 5% CO2. Morphological changes were observed with 20, 25, 30 and 40 mM TCEP and 40 mM DTT at 26 °C and at 20 and 25 mM TCEP and 40 mM DTT at 37 °C in (Table 2) and CO2 was required for sexual stage formation [32]. The presence of xanthurenic acid had no effect on the induction of sexual stages. The induced parasites initially underwent morphological changes inside infected RBCs where they enlarged and occupied most of the RBC volume at 3 h. In addition to enlarged size, parasites began to make projections while still inside the erythrocytes. Parasites became extracellular at 6 and 15 h post-induction, yielding morphologically distinct populations: parasites with long projections and large, round parasite stages. The extracellular parasites began to aggregate after 24 h (Fig. 1). Staining with 6-carboxyfluorescein diacetate demonstrated the viability of induced sexual stages (Additional file 1: Figure S1). Scanning electron microscopy was performed to reveal greater detailed visualization of B. bigemina sexual stage morphological changes in induced parasites. Extracellular merozoites showed a round form with a size of ~1.5 μm in panels 1 and 2 (Fig. 2a) similar to a previous study [33]. Induced sexual stages had a size of ~ 2 μm. Cells with several long projections or round aggregation forms were observed (Fig. 2b). Induced aggregating forms are shown in Fig. 2b (panels 4 and 6). Parasites depicted in panels 3, 5, 7 and 8 also displayed dramatic shape and surface architecture modifications when compared to non-induced parasites [33, 34].
Table 2

Treatment conditions to induce B. bigemina sexual stages. All cultures were in the presence of 5% CO2. Bold indicates sexual stage induction

ConditionInducerConcentrations (mM)
26 °CTCEP010 20 25 30 40
TCEP+ XA010 20 25 30 40
37 °CTCEP010 20 25 3040
TCEP+ XA010 20 25 3040
26 °CDTT010202530 40
DTT+ XA010202530 40
37 °CDTT010202530 40
DTT+ XA010202530 40

Abbreviations: TCEP, Tris 2-carboxyethyl phosphine; DTT, dithiothreitol; XA, xanthurenic acid

Fig. 1

Development of B. bigemina sexual stages. Non-induced blood culture (time 0) (a) and in vitro TCEP-induced sexual stages (b) at 26 °C and 5% CO2 (multiple time-points). Scale-bar: 5 μm

Fig. 2

Scanning electron micrographs: a Non-induced blood culture (merozoite). Panels 1 and 2 show the morphologies observed. b In vitro TCEP-induced sexual stages. Panels 3–8 show different parasite morphologies observed at 24 h post-induction. Scale-bars: 2 μm

Treatment conditions to induce B. bigemina sexual stages. All cultures were in the presence of 5% CO2. Bold indicates sexual stage induction Abbreviations: TCEP, Tris 2-carboxyethyl phosphine; DTT, dithiothreitol; XA, xanthurenic acid Development of B. bigemina sexual stages. Non-induced blood culture (time 0) (a) and in vitro TCEP-induced sexual stages (b) at 26 °C and 5% CO2 (multiple time-points). Scale-bar: 5 μm Scanning electron micrographs: a Non-induced blood culture (merozoite). Panels 1 and 2 show the morphologies observed. b In vitro TCEP-induced sexual stages. Panels 3–8 show different parasite morphologies observed at 24 h post-induction. Scale-bars: 2 μm

Expression of B. bigemina sexual stage genes after in vitro TCEP exposure

We compared the transcription levels of B. bigemina sexual stage marker genes ccp2 and ccp3 between cultures induced with 20 mM TCEP at 37 °C in 5% CO2 to non-induced cultures. Expression of ccp2 and ccp3 was found to be significantly upregulated in TCEP-induced cultures (P < 0.001) as compared to time zero (non-induced) parasites. The expression of ccp2 was maximal by 6 h and gradually reduced over subsequent time points (Fig. 3a). ccp3 expression was also maximal in 6 h cultures but experienced a sharp decline after 15 h of cultures (Fig. 3b). The results represent the means of three experiments, each containing three technical replicates. In addition to the ccp genes, we examined the expression of B bigemina hap2 (BBBOND_0307410) in TCEP-induced parasites and found it was upregulated at 6, 15 and 24 h (Additional file 2: Figure S2) as previously demonstrated [13]. Additionally, we confirmed polypeptide expression of CCp2 and CCp3 by IFA using a set of previously characterized polyclonal antibodies [12]. Consistent with a previous study of induced B. bigemina sexual stages [12], the results demonstrated that in vitro TCEP-induced parasites expressed both CCp2 and CCp3 proteins but non-induced blood stages did not express either protein (Fig. 4a, b).
Fig. 3

Relative expression of B. bigemina ccp2 (a) and ccp3 (b) by TCEP-induced sexual stages is compared with non-induced B. bigemina blood stages. The means of three experiments, each containing three technical replicates are shown. ***P < 0.001

Fig. 4

Immunofluorescence assays demonstrating the expression of CCp 2 (a) and CCp3 (b) in in vitro TCEP-induced B. bigemina sexual stages. Scale-bars: 5 μm

Relative expression of B. bigemina ccp2 (a) and ccp3 (b) by TCEP-induced sexual stages is compared with non-induced B. bigemina blood stages. The means of three experiments, each containing three technical replicates are shown. ***P < 0.001 Immunofluorescence assays demonstrating the expression of CCp 2 (a) and CCp3 (b) in in vitro TCEP-induced B. bigemina sexual stages. Scale-bars: 5 μm In silico bioinformatic analysis was performed to identify B. bigemina homologs of P. falciparum gamete-specific genes. Using this approach, 13 B. bigemina homologs of P. falciparum gamete-specific genes were identified that contained conserved domains such as methyltransferase, tubulin-tyrosine ligase (TTL), kinesin, ribosomal _L20, tim10/DDP family zinc finger (zf-Tim10_DDP), 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase (IspD), U1 zinc finger (zf-U1), sedlin, N-terminal conserved region (Sedlin_N), RNA polymerases N/8 kDa subunit (RNA_pol_N) and zinc finger C-x8-C-x5-C-x3-H type (ZnF_C3H1) and LCCL domain with P. falciparum [23]. The amino acid identities of these homologs ranged between 18–58%. Accession numbers, amino acid identities and functional annotation for B. bigemina homologs of P. falciparum gamete-specific proteins are provided in Table 3.
Table 3

Protein identity between B. bigemina homologs of P. falciparum gamete-specific proteins

Protein nameB. bigemina accession numberP. falciparum accession numberIdentity (%)Function annotation
BBBOND_0204030XP_012767431.1XP_001348700.231.63Hypothetical protein conserved
BBBOND_0310420XP_012769325.1XP_002808689.123.97Tubulin-tyrosine ligase family protein
BBBOND_0110620XP_012766950.1XP_001348145.227.91Kinesin putative
BBBOND_0308930XP_012769176.1XP_001348883.152.07Ribosomal protein L20, putative
BBBOND_0200260XP_012767055.1XP_001351587.148.75Mitochondrial import inner membrane translocase subunit Tim13 partial mRNA
BBBOND_0311670XP_012769450.1XP_002808921.118.252-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
BBBOND_0208380XP_012767870.1XP_001351380.127.94Hypothetical protein, conserved
BBBOND_0305250XP_012768808.1XP_001349398.138.21U1 zinc finger family protein, putative
BBBOND_0307580XP_012769040.1XP_001350054.137.04Sedlin, N-terminal conserved region family protein, putative
BBBOND_0310760XP_012769359.1XP_001348995.157.97RNA polymerases N / 8 kDa subunit family protein, putative
BBBOND_0311270XP_012769410.1XP_001351786.131.47Zinc finger C-x8-C-x5-C-x3-H type domain containing protein, putative
BBBOND_0203950 XP_012767423.1 XP_00161582931.74LCCL domain-containing protein CCP2, putative
BBBOND_0312400 XP_012769523.1 XP_00134824036.83LCCL domain containing protein, putative
Protein identity between B. bigemina homologs of P. falciparum gamete-specific proteins

Expression of BBBOND_0204030 in in vitro TCEP-induced B. bigemina sexual stages

Comparative RT-PCR analysis using total RNA isolated from B. bigemina non-induced and in vitro TCEP-induced cultures was performed to determine whether stage-specific markers can be identified among the 13 candidate B. bigemina homologs to conserved P. falciparum sexual stage genes. Expression of several B. bigemina homologs were detected in non-induced and induced cultures (Fig. 5); however, expression of BBBOND_0204030 was exclusive to induced cultures. This observation was confirmed by nested PCR analysis (Additional file 3: Figure S3). PCR products for all genes were sequenced, and amplicons were found to be more than 98% identical with the reference B. bigemina genome [27]. The newly generated sequences were submitted to the GenBank database under the accession numbers MH536857-MH536870.
Fig. 5

Detection of B. bigemina homologs of P. falciparum gamete-specific gene transcripts in in vitro TCEP-induced and non-induced blood cultures. BBBOND_0107357 (actin) was used as a reference gene. RT- and RT+ indicate the absence or presence of reverse transcriptase

Detection of B. bigemina homologs of P. falciparum gamete-specific gene transcripts in in vitro TCEP-induced and non-induced blood cultures. BBBOND_0107357 (actin) was used as a reference gene. RT- and RT+ indicate the absence or presence of reverse transcriptase

BBBOND_0204030 is uniquely expressed in vivo by B. bigemina tick stages

Gene expression results of the selected B. bigemina tick stage candidate genes demonstrated that 12 of 13 genes were transcribed in both B. bigemina blood and tick stages at various time-points after incubation in gut, ovary, and hemolymph samples. As already stated, gene BBBOND_0204030 was not transcribed by blood stages but was detected in all stages of B. bigemina infected tick gut, ovary and hemolymph (Fig. 6). These results were consistent with the in vitro observation described above. The PCR products were sequenced, and the amplicon identities confirmed.
Fig. 6

Detection stock of B. bigemina homologs of P. falciparum gamete-specific gene transcripts. Blood, midguts day 0 to 6 post-incubation of engorged female ticks, hemolymph, ovaries day 0 to 6 post-incubation of engorged female ticks indicated above lanes. BBOND_0107357 (actin) was used as a reference gene.

Detection stock of B. bigemina homologs of P. falciparum gamete-specific gene transcripts. Blood, midguts day 0 to 6 post-incubation of engorged female ticks, hemolymph, ovaries day 0 to 6 post-incubation of engorged female ticks indicated above lanes. BBOND_0107357 (actin) was used as a reference gene.

Discussion

In this study, we used B. bigemina sexual stages induced in vitro and identified BBBOND_0204030, a putative methyl-transferase, as a marker of tick-stage development. Methyl transferases are membrane-bound enzymes in the endoplasmic reticulum that transfer a methyl group from S-adenosyl-l-methionine to thiol, amino, or catechol acceptor molecules [35]. Protein methyltransferases are essential for epigenetic regulation of gene expression through methylation of histones and non-histone proteins such as transcription factors. In malaria, the homologous gene, PF14_0526, contains a methyltransferase domain that plays a fundamental role in parasite development and differentiation [35]. We found that BBBOND_0204030 was transcribed by multiple stages of B. bigemina during parasite development in tick midgut, ovary and hemolymph. Given the expression of BBBOND_0204030 in each tick compartment examined, the protein may play a central role in regulating genes essential for the parasites survival and development in the tick. BBBOND_0204030 transcripts were not found in blood stages of B. bigemina. To the best of our knowledge, there is no description of a B. bigemina gene transcribed exclusively during tick infection. We propose that BBBOND_0204030 can be used as a marker to indicate life-cycle transition of B. bigemina within tick vectors. The dissection and characterization of mechanisms leading to gamete formation are difficult to perform in the complex milieu of the engorged female tick midgut. Thus, using TCEP to induce B. bigemina sexual stages in vitro will facilitate the study of gene and protein expression contributing to the understanding of molecular mechanisms involved in the parasite life-cycle and the development of novel transmission blocking vaccines. Examining previously defined sexual stage-specific B. bigemina genes ccp2 and ccp3, we confirmed sexual stage formation by detecting upregulated transcription levels and protein expression by RT-qPCR and IFA, respectively [12]. When sexual stages were induced in vitro, ccp2 and ccp3 displayed a distinct expression pattern that included a 6–8-fold increase within 6 h of induction and subsequent decline. In contrast, the expression of both genes from ex vivo samples extended over the course of five days. It is possible that with in vitro induction, all parasites, simultaneously exposed to the induction stimulus, respond as a synchronous group, allowing the expression pattern to be revealed. In contrast, parasites in the tick are exposed over a long feeding period. As a result, in vivo induction of sexual stages would be expected to occur non-synchronously and the rise and fall of ccp expression would be masked. In addition to ccp2 and ccp3, expression of hap2, a gene found to be important in B. bovis sexual stage development [16], was upregulated at 6 h but, unlike the expression pattern of the ccp genes, remained elevated at 15 and 24 h after TCEP induction (Additional file 2: Figure S2), consistent with a previous study [13]. Babesia bigemina has a complex life-cycle that includes the development of multiple stages in the mammalian host and tick vector [1, 6]. The disparate environments provide stress to the parasites that can induce differential gene and protein expression. Within the biological vector, Babesia sexually reproduce, undergo several morphological changes, and interact with multiple cell types and tissues including tick midgut, ovaries, hemolymph and salivary glands before transmission to animals [1, 6]. In this study we used TCEP to consistently induce culture adapted B. bigemina sexual stages in vitro and found that CO2 was a critical parameter [32]. TCEP-induced cultures contained several apparent forms of B. bigemina sexual stages including parasites with long projections, round forms and clusters of round forms as previously described for sexual stages found in tick midgut [1, 6]. The shapes and forms were similar to previously described sexual stages induced in vitro from ex vivo blood by either xanthurenic acid or addition of homogenized engorged female R. microplus tick midgut [16, 19, 34]. Xanthurenic acid failed to induce sexual stages from our B. bigemina strain using in vitro culture source material. One possible explanation is that not all strains of B. bigemina respond to the mild stress caused by xanthurenic acid. TCEP and DTT are both reducing agents and may have the same function in triggering endoplasmic reticulum stress that causes activation of Plasmodium transcriptional factors [20, 21]. Studies have shown that disruption of P. falciparum metabolic pathways resulted in the accumulation of S-adenosyl-L-homocysteine in infected erythrocytes with an upregulation of parasite transcriptional factors important in gametogenesis [20, 21]. Due to the consistent ability of TCEP to induce B. bigemina from our in vitro adapted cultures, this induction system represents an alternative gametogenesis technique for B. bigemina strains that fail to respond to xanthurenic acid treatment. We were able to detect morphological and transcriptional changes 6 h post-exposure with various concentrations of TCEP in the presence of CO2. The addition of xanthurenic acid did not impact TCEP induction of B. bigemina sexual stages in our experiments. Xanthurenic acid was previously identified in mosquito guts as an agent capable of inducing sexual stage differentiation of the Plasmodium parasite [36, 37]. However, it remains unknown whether xanthurenic acid is present and/or plays a similar role in the tick vectors of B. bigemina. It is likely that there is a distinct midgut milieu composition between Anopheles mosquitoes and Rhiphicephalus ticks. To further characterize TCEP-induced B. bigemina sexual stages, we searched for homologous malaria gametogenesis gene markers. In silico analysis identified thirteen B. bigemina homologs of P. falciparum gamete-specific genes. From these 13 identified genes, 12 were transcribed in both non-induced and TCEP-induced in vitro cultures. This observation may indicate the presence of developmentally arrested sexual forms in the blood, similar to malaria [38]. To demonstrate if the 13 B. bigemina genes shared an expression profile between both in vitro and in vivo conditions, we also analyzed the pattern of expression of these genes in blood from a splenectomized calf experimentally infected with B. bigemina and in different tissues from acquisition fed ticks. Importantly, transcript analysis of B. bigemina infected blood and multiple tick organs demonstrated an identical expression profile of these 13 genes as compared to both non-induced and in vitro TCEP-induced cultures. There appeared to be differences in transcription levels of the 12 genes not uniquely expressed by tick stages between the different stages we examined. Further characterization of the magnitude of these differences will require additional RT-qPCR studies that are not within the scope of this report.

Conclusions

In this study, we identified BBBOND_0204030 as a marker for parasite development within the tick vector. Additionally, we describe the use of TCEP to consistently induce B. bigemina sexual stages in vitro. TCEP in vitro induction will fundamentally enhance the study of gene and protein expression during B. bigemina sexual stage development with the potential to impact the control of parasite transmission. In vitro induction using TCEP of B. bigemina sexual stages and the discovery of a tick stage-specific gene marker, together with our recent ability to manipulate the genome of B. bigemina, will expand the toolbox available for closing important research gaps regarding parasite-tick interactions that limit the development of novel control strategies against these devastating tick-borne parasites of cattle. Figure S1. Babesia bigemina non-induced and TCEP-induced parasites viability were determined with 6-CFDA. Non-induced blood culture (a) and in vitro TCEP-induced sexual stages (b) at 37 °C and 5% CO2. Scale-bar: 5 μm. (TIF 267 kb) Figure S2. Relative expression of Babesia bigemina hap2 by TCEP-induced sexual stages is compared with non-induced B. bigemina blood stages. The means of three experiments, each containing three technical replicates are shown. *P < 0.001. (TIF 98 kb) Figure S3. Detection methyltransferase gene (BBBOND_0204030) transcript of Babesia bigemina in in vitro TCEP-induced cultures using nested PCR. BBBOND_0107357 (actin) was used as a reference gene. RT- and RT+: indicate the absence or presence of reverse transcriptase. (TIF 145 kb)
  33 in total

1.  Validation of a competitive enzyme-linked immunosorbent assay for detection of antibodies against Babesia bovis.

Authors:  Will L Goff; John B Molloy; Wendell C Johnson; Carlos E Suarez; Ignacio Pino; Abdelkebir Rhalem; Hamid Sahibi; Luigi Ceci; Grazia Carelli; D Scott Adams; Travis C McGuire; Donald P Knowles; Terry F McElwain
Journal:  Clin Vaccine Immunol       Date:  2006-09-06

2.  Ultrastructure of Babesia bigemina gametes obtained in "in vitro" erythrocyte cultures.

Authors:  M F Ribeiro; J H Patarroyo
Journal:  Vet Parasitol       Date:  1998-03-31       Impact factor: 2.738

Review 3.  Babesiosis of cattle.

Authors:  R Bock; L Jackson; A de Vos; W Jorgensen
Journal:  Parasitology       Date:  2004       Impact factor: 3.234

4.  Transovarial transmission efficiency of Babesia bovis tick stages acquired by Rhipicephalus (Boophilus) microplus during acute infection.

Authors:  Jeanne M Howell; Massaro W Ueti; Guy H Palmer; Glen A Scoles; Donald P Knowles
Journal:  J Clin Microbiol       Date:  2006-12-13       Impact factor: 5.948

5.  A genome-sequence survey for Ascogregarina taiwanensis supports evolutionary affiliation but metabolic diversity between a Gregarine and Cryptosporidium.

Authors:  Thomas J Templeton; Shinichiro Enomoto; Wei-June Chen; Chin-Gi Huang; Cheryl A Lancto; Mitchell S Abrahamsen; Guan Zhu
Journal:  Mol Biol Evol       Date:  2009-09-24       Impact factor: 16.240

6.  Cryopreservation of Babesia bigemina for in vitro cultivation.

Authors:  C A Vega; G M Buening; S D Rodriguez; C A Carson; K McLaughlin
Journal:  Am J Vet Res       Date:  1985-02       Impact factor: 1.156

7.  A proteomic view of the Plasmodium falciparum life cycle.

Authors:  Laurence Florens; Michael P Washburn; J Dale Raine; Robert M Anthony; Munira Grainger; J David Haynes; J Kathleen Moch; Nemone Muster; John B Sacci; David L Tabb; Adam A Witney; Dirk Wolters; Yimin Wu; Malcolm J Gardner; Anthony A Holder; Robert E Sinden; John R Yates; Daniel J Carucci
Journal:  Nature       Date:  2002-10-03       Impact factor: 49.962

8.  Comparative genomic analysis and phylogenetic position of Theileria equi.

Authors:  Lowell S Kappmeyer; Mathangi Thiagarajan; David R Herndon; Joshua D Ramsay; Elisabet Caler; Appolinaire Djikeng; Joseph J Gillespie; Audrey Ot Lau; Eric H Roalson; Joana C Silva; Marta G Silva; Carlos E Suarez; Massaro W Ueti; Vishvanath M Nene; Robert H Mealey; Donald P Knowles; Kelly A Brayton
Journal:  BMC Genomics       Date:  2012-11-09       Impact factor: 3.969

9.  Differential expression of three members of the multidomain adhesion CCp family in Babesia bigemina, Babesia bovis and Theileria equi.

Authors:  Reginaldo G Bastos; Carlos E Suarez; Jacob M Laughery; Wendell C Johnson; Massaro W Ueti; Donald P Knowles
Journal:  PLoS One       Date:  2013-07-03       Impact factor: 3.240

10.  Proteomic analysis of the Plasmodium male gamete reveals the key role for glycolysis in flagellar motility.

Authors:  Arthur M Talman; Judith H Prieto; Sara Marques; Ceereena Ubaida-Mohien; Mara Lawniczak; Mark N Wass; Tao Xu; Roland Frank; Andrea Ecker; Rebecca S Stanway; Sanjeev Krishna; Michael J E Sternberg; Georges K Christophides; David R Graham; Rhoel R Dinglasan; John R Yates; Robert E Sinden
Journal:  Malar J       Date:  2014-08-13       Impact factor: 2.979

View more
  6 in total

1.  A Transfected Babesia bovis Parasite Line Expressing eGFP Is Able to Complete the Full Life Cycle of the Parasite in Mammalian and Tick Hosts.

Authors:  Wendell C Johnson; Hala E Hussein; Janaina Capelli-Peixoto; Jacob M Laughery; Naomi S Taus; Carlos E Suarez; Massaro W Ueti
Journal:  Pathogens       Date:  2022-05-27

2.  A Comparative Genomic Study of Attenuated and Virulent Strains of Babesia bigemina.

Authors:  Bernardo Sachman-Ruiz; Luis Lozano; José J Lira; Grecia Martínez; Carmen Rojas; J Antonio Álvarez; Julio V Figueroa
Journal:  Pathogens       Date:  2021-03-08

3.  Initiated Babesia ovata Sexual Stages under In Vitro Conditions Were Recognized by Anti-CCp2 Antibodies, Showing Changes in the DNA Content by Imaging Flow Cytometry.

Authors:  Thu-Thuy Nguyen; Minh-Anh Dang-Trinh; Luna Higuchi; Juan Mosqueda; Hassan Hakimi; Masahito Asada; Junya Yamagishi; Rika Umemiya-Shirafuji; Shin-Ichiro Kawazu
Journal:  Pathogens       Date:  2019-07-17

Review 4.  Unravelling the cellular and molecular pathogenesis of bovine babesiosis: is the sky the limit?

Authors:  Carlos E Suarez; Heba F Alzan; Marta G Silva; Vignesh Rathinasamy; William A Poole; Brian M Cooke
Journal:  Int J Parasitol       Date:  2019-01-26       Impact factor: 3.981

5.  Immunization against a Conserved Surface Polysaccharide Stimulates Bovine Antibodies with Opsonic Killing Activity but Does Not Protect against Babesia bovis Challenge.

Authors:  Naomi S Taus; Colette Cywes-Bentley; Wendell C Johnson; Gerald B Pier; Lindsay M Fry; Michelle R Mousel; Massaro W Ueti
Journal:  Pathogens       Date:  2021-12-09

6.  Epigenomic Landscape of Lyme Disease Spirochetes Reveals Novel Motifs.

Authors:  Jenny Wachter; Craig Martens; Kent Barbian; Ryan O M Rego; Patricia Rosa
Journal:  mBio       Date:  2021-06-22       Impact factor: 7.867

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.