Development and characterization of simple sequence repeat markers for the invasive tetraploid waterweed Elodea nuttallii (Hydrocharitaceae).

PREMISE OF THE STUDY: To enhance the understanding of the recent invasion process of the clonal waterweed Elodea nuttallii (Hydrocharitaceae), analyses of population structure and genotypic diversity need to be undertaken, for which genetic markers are needed. METHODS AND
RESULTS: High-throughput sequencing of DNA enriched for microsatellites was used to develop 24 loci that were characterized in E. nuttallii, 21 of which were polymorphic, with the number of alleles ranging from two to 10. In two populations, expected heterozygosity ranged among loci between zero and 0.796. In the congener E. canadensis, all markers yielded PCR products, 19 of which were polymorphic, with two to nine alleles and expected heterozygosity ranging from zero to 0.690 in two populations.
CONCLUSIONS: The markers described should be useful for future studies of population structure and clonal diversity of E. nuttallii as well as E. canadensis in their native and invasive range.

Western waterweed (Elodea nuttallii (Planch.) H. St. John, Hydrocharitaceae) is a tetraploid, dioecious, submerged freshwater macrophyte native to North America that is invasive in Europe and Japan. In its invasive range, almost exclusively female plants have been found and the reproduction is primarily vegetative (Cook and Urmi‐König, 1985). In Europe, it was first found in 1939 in Belgium and has quickly spread to 19 other European countries (Cook and Urmi‐König, 1985; Hussner, 2012). Because it can form dense dominant stands, E. nuttallii constrains water flow in rivers and the recreational use of lakes. Furthermore, the aggressive growth of this species may influence abiotic factors, outcompete native plants, change the makeup of the aquatic vegetation, and thus impact fish occurrence (Carey et al., 2016). Because no effective, species‐specific management options are known (Zehnsdorf et al., 2015), more information about the species’ biology and population structure is urgently needed. The analysis of genetic variation and population structure can give insights into reproduction mode, dispersal patterns, and the invasion process in general and may allow the identification of source regions in the native range (e.g., Durka et al., 2005; Voss et al., 2012).

Microsatellite markers are available for E. canadensis Michx. (Huotari et al., 2010); however, cross‐species amplification in E. nuttallii had not been tested (T. Huotari and H. Korpelainen, University of Helsinki, Helsinki, Finland, personal communication). Moreover, 60% of these markers only amplified in E. canadensis samples from invasive but not from native populations (Huotari et al., 2011), and preliminary tests revealed no or nonreproducible amplification products in our samples from both E. canadensis and E. nuttallii. Additionally, the available markers have limited power to discriminate clones because of low number of alleles (mean number of alleles = 2.8; Huotari et al., 2011) and their limited number (N = 10). Therefore, we developed new markers specifically for E. nuttallii. We demonstrate their utility for native and invasive samples as well as trans‐species amplification in E. canadensis, thus allowing for comparative analyses of clonal variation between native and invasive range and among species.

METHODS AND RESULTS

Total genomic DNA from E. nuttallii collected in Großer Goitzschesee, Germany (51°37′12″N, 12°23′59″E), was isolated using the cetyltrimethylammonium bromide (CTAB) extraction procedure of Doyle (1991) and sent to GenoScreen (Lille, France). One microgram of DNA was used for the development of microsatellites through 454 GS‐FLX Titanium pyrosequencing (Roche Applied Science, Basel, Switzerland) of enriched DNA libraries following Malausa et al. (2011). Briefly, total DNA was mechanically fragmented and enriched for AG, AC, AAC, AAG, AGG, ACG, ACAT, and ATCT repeat motifs. Enriched fragments were subsequently amplified. PCR products were purified and quantified, and GsFLX libraries were then prepared following the manufacturer's protocols and sequenced on a GsFLX PTP (Roche Applied Science). Using QDD (Meglécz et al., 2010), adapters and vectors were removed, microsatellites were detected, their redundancy and association with mobile elements were tested, sequences with target microsatellites were selected, and primers were designed.

Among 2815 sequences comprising a microsatellite motif, 168 bioinformatically validated primer sets were designed on perfect motif microsatellites. We chose 41 primer pairs based on their motif, repeat number, and length of expected amplification product. We aimed to equally represent dinucleotide and trinucleotide repeats as well as short (90–140 bp), medium (140–190 bp), and long (190–250 bp) amplification products. Furthermore, microsatellites with high repeat numbers were favored because they often display a higher mutation rate.

These 41 primer pairs were ordered from Eurofins (Ebersberg, Germany) and were screened using the method of Schuelke (2000), i.e., adding CAG‐ or M13R‐tags to forward primers, adding GTTT‐tags to reverse primers (Brownstein et al., 1996), and using fluorescent‐labeled CAG and M13R primers. The PCR reaction contained 5 μL QIAGEN Multiplex PCR Master Mix (QIAGEN, Hilden, Germany), 1 μL of 2.5 μM tagged forward primer and 0.5 μM reverse primer, 1 μL of 2.5 μM fluorescent‐labeled CAG‐ or M13R‐tag, 2 μL of ultrapure water (Carl Roth GmbH, Karlsruhe, Germany), and 1 μL of DNA (~400 ng/μL). A touchdown protocol was used with cycles as follows: 95°C for 15 min; 20 cycles of 94°C for 30 s, 60°C for 30 s (decreasing 0.5°C per annealing cycle), and 72°C for 90 s; 20 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 90 s; and a final elongation step of 10 min at 72°C. PCR products (1 μL) were multiplexed into four mixes (Table 1) with 10 μL of Hi‐Di Formamide (Thermo Fisher Scientific, Waltham, Massachusetts, USA) for fragment length analysis on an ABI 3130xl genetic analyzer (Thermo Fisher Scientific) with GeneScan 500 LIZ Size Standard (Thermo Fisher Scientific). Genotyping was performed using GeneMapper Software 5 (Thermo Fisher Scientific), allowing for a maximum of four alleles, assuming tetraploidy (Cook and Urmi‐König, 1985; Di Nino, 2008).

Table 1

Characteristics of 24 microsatellite markers developed in Elodea nuttallii and cross‐species amplification in E. canadensis

Locus	Primer sequences (5′–3′)a	Repeat motif	Fluorescent dye	PCR mix	Fragment analysis mix	E. nuttallii (N = 262)b				E. canadensis (N = 92)b				GenBank accession no.
						Allele size range (bp)	A	A max	P NA	Allele size range (bp)	A	A max	P NA
Enu01	F: CAGTCGGGCGTCATCAGGTGGAAGATGAGCCGTAAG	(GA)7	NED	e	4	119	1	1	0	119	1	1	0	MG272338
	R: GTTTGTCGAGTAGGCACGTCGAA
Enu04	F: GGAAACAGCTATGACCATTAGGCTCTCATGCCTTTCC	(TC)10	PET	b	1	121–129	4	3	0	123–129	3	1	1.1	MG272339
	R: GTTTCGGTAGTCAGCAGTGGTGGT
Enu05	F: CAGTCGGGCGTCATCAGATCTGGACCCAAAGCGAA	(TC)7	FAM	—	3	93–128	10	3	0	93–116	3	2	0	MG272340
	R: GTTTCAGATAGAGTGGTCTTCGCCA
Enu06	F: GGAAACAGCTATGACCATCCTTCTTGCTAGGGAAGAATATC	(TC)8	VIC	—	2	101–107	3	2	0	101–109	5	3	0	MG272341
	R: GTTTAGCCACTGCATCATGTCTTG
Enu07	F: CAGTCGGGCGTCATCAGGTAGGTAGTCGAACACCAACATA	(CT)8	VIC	a	1	106–114	4	3	0	110–114	3	3	0	MG272342
	R: GTTTCATATGTACACCGAGATTGCAC
Enu09	F: GGAAACAGCTATGACCATCGAGTTGGCACAAGTAGGGT	(TCT)9	VIC	—	4	108–126	7	4	0	108–129	6	4	0	MG272343
	R: GTTTCCTCCAAAGAAACGCAAATC
Enu10	F: CAGTCGGGCGTCATCAGAAGAGGTAGAACTCTACAATGAGGG	(GAG)7	NED	d	3	106–118	5	3	0.8	109–118	3	2	2.2	MG272344
	R: GTTTGGTCAGCACATGTCTCCTTTT
Enu12	F: CAGTCGGGCGTCATCAGCTCTCCTCCCTTCTTGT	(TTC)11	NED	c	2	104–128	9	4	0	104–119	4	3	0	MG272345
	R: GTTTGGGAAGACCCATACCTTGCT
Enu13	F: GGAAACAGCTATGACCATCTTTCCACCCAAGCCCTAC	(CTT)9	VIC	—	3	108–135	9	4	0	111–135	7	3	0	MG272346
	R: GTTTGACAGTCCGATGGTGAAGGT
Enu15	F: CAGTCGGGCGTCATCAGAGGTGTAGGGCTCTCAGTT	(TC)6	FAM	—	4	150–160	3	3	0	138–160	3	2	0	MG272347
	R: GTTTCTTTGGGGTCTAGGGAGGG
Enu19	F: CAGTCGGGCGTCATCATTACTAGCTTCGACACGCGA	(GA)6	NED	c	2	155–162	3	2	0.4	155–162	3	2	91.3	MG272348
	R: GTTTGGGAAGTGAGTTGAACGGAA
Enu20	F: GGAAACAGCTATGACCATAGCTTAGGGTTTGGTCCCAT	(CT)6	PET	d	3	156–164	5	3	0	156–158	2	1	89.1	MG272349
	R: GTTTAAGCATAAAAGCGAAAGCCA
Enu21	F: CAGTCGGGCGTCATCAGCAACTGCTCGTTCTTCCAT	(TC)6	NED	b	1	132–170	7	3	1.5	150–170	4	3	4.4	MG272350
	R: GTTTGAGGCTCTGGACTCCAATCA
Enu22	F: CAGTCGGGCGTCATCAGTCTCCTCCATTGATGCTCC	(TCC)7	FAM	f	1	141	1	1	0	141	1	1	5.4	MG272351
	R: GTTTCAAGAAAAGACCCCAAGGA
Enu24	F: CAGTCGGGCGTCATCACCACAGTTGGTCACTACTTCCA	(CTT)9	VIC	a	1	160	1	1	0	160	1	1	0	MG272352
	R: GTTTGAAGCTGCAGAAGAAACAAACA
Enu26	F: CAGTCGGGCGTCATCATATGTTTGGGCGATGTTTGA	(TTC)11	FAM	—	2	121–149	10	4	0	121–146	3	2	0	MG272353
	R: GTTTGTCGAGTGGGGTCTAAGG
Enu28	F: CAGTCGGGCGTCATCAGTCACGATCCCCTTCTTCAA	(TCT)6	NED	e	4	149–158	3	3	3.8	149–158	3	2	4.4	MG272354
	R: GTTTCCTTATGCAAAGGAGGAATCA
Enu30	F: GGAAACAGCTATGACCATGATCGGAGATGAGGGAATGA	(GA)8	PET	c	2	218–228	3	2	3.4	222	1	1	97.8	MG272355
	R: GTTTCGCCATAGGCACGATGAT
Enu35	F: CAGTCGGGCGTCATCAGAGTGAGGGATCGGGGATAG	(GGA)6	FAM	f	1	188–200	4	2	0.4	188–203	4	3	0	MG272356
	R: GTTTCTGCGACCATCCTACTGCTT
Enu36	F: GGAAACAGCTATGACCATAAACAACGAGAAGAAGCGGA	(GAA)7	PET	e	4	184–188	2	2	1.1	185	1	1	1.1	MG272357
	R: GTTTCGTAGCTCGTTCCATTTTCC
Enu37	F: CAGTCGGGCGTCATCACCATTTTCGTCCTTCTTCCA	(TTC)11	VIC	a	1	185–216	9	3	1.1	185–198	3	2	91.3	MG272358
	R: GTTTGACCTTCCTCCTTGGTG
Enu38	F: GGAAACAGCTATGACCATACGGACGTTGGACCTCTATG	(AGT)15	PET	b	1	180–219	9	3	0	183–216	9	4	0	MG272359
	R: GTTTGTGATTGCTCCTTTTGTGG
Enu39	F: CAGTCGGGCGTCATCACGATCGTCAGAGACCTCACA	(CTT)10	NED	d	3	214–232	7	4	3.0	220–232	5	3	0	MG272360
	R: GTTTATCACGTGAAATGCCAGTCA
Enu41	F: CAGTCGGGCGTCATCAGCGAGCAACGAGATGAATTT	(CTT)14	NED	b	1	230–257	8	4	2.0	223–254	9	4	3.3	MG272361
	R: GTTTAATTACATTGGCGCGGTATC

— = singleplex reaction; A = number of alleles; A max = maximal number of alleles detected per individual; N = number of individuals sampled; P NA = percentage homozygous null alleles.

Forward primer sequences include CAG and M13R tags and reverse primers include GTTT PIG‐tails (in italics).

Geographic coordinates for the populations and voucher information are given in Appendix 1.

The 41 primers were tested for polymorphism on 40 individuals from eastern Germany, and 24 loci yielded PCR products in the expected size range (Table 1). Sequences containing these primers were deposited in the National Center for Biotechnology Information's GenBank database. The 24 markers were amplified in six multiplex and six singleplex reactions (Table 1). In case no PCR product was detected, at least two replicate analyses were performed; if no PCR product was found in the replicate analyses, the presence of a fixed null allele was assumed. Because of clonal reproduction and invasive spread, single populations harbored only a small amount of total allelic variation. Therefore, to assess genetic variation at the population level, we analyzed two well‐sampled invasive populations for both E. nuttallii and E. canadensis. For these, we report the number of genotypes (N gt) and used GenoDive version 2.0b23 (Meirmans and Van Tienderen, 2004) to calculate values of observed heterozygosity (H o) and expected heterozygosity (H e) correcting for unknown allele dosage of polyploids. To assess allelic variation at the species level, we included additional samples from other native and invasive sites, totaling 262 ramets from 53 sites in E. nuttallii and 92 ramets from 30 sites in E. canadensis (Appendix 1).

In E. nuttallii, 21 microsatellites were polymorphic, with the number of alleles ranging from two to 10 (average 5.3), totaling 127 alleles (Table 1). At population level, moderate levels of genetic diversity were found in two populations (mean H e = 0.350 and 0.376), but genotypic diversity was either very low (mean N gt = 1.04) or high (N gt = 3.67; Table 2).

Table 2

Genotypic and genetic variation of 24 newly developed microsatellites at population and overall level in two invasive populations each of Elodea nuttallii and E. canadensis.a

Locus	E. nuttallii						E. canadensis
	Cospudener See (N = 21)			Großer Goitzschesee (N = 43)			Gravel pit Kleinpösna (N = 27)			Parthe River (N = 11)
	N gt	H o	H e	N gt	H o	H e	N gt	H o	H e	N gt	H o	H e
Enu01	1	0	0.000	1	0	0.000	1	0	0.000	1	0	0.000
Enu04	1	0	0.000	4	0.095	0.343	1	0	0.000	1	0	0.000
Enu05	1	0	0.000	3	0.048	0.084	1	0	0.000	1	0	0.000
Enu06	1	0	0.000	2	0.024	0.015	2	0	0.074	2	0	0.533
Enu07	1	1	0.677	1	1	0.506	1	1	0.675	1	1	0.690
Enu09	1	1	0.677	7	1	0.715	1	0	0.000	1	0	0.000
Enu10	1	1	0.512	2	1	0.506	1	0	0.000	1	0	0.000
Enu12	1	1	0.677	9	1	0.720	1	1	0.509	1	1	0.526
Enu13	1	1	0.512	3	1	0.570	4	1	0.614	2	0.8	0.490
Enu15	1	1	0.512	7	0.667	0.616	1	0	0.000	1	0	0.000
Enu19	1	0	0.000	3	0.357	0.385	—	—	—	—	—	—
Enu20	1	1	0.512	2	0.857	0.485	—	—	—	—	—	—
Enu21	1	1	0.512	2	0.976	0.505	1	0	0.000	1	0	0.000
Enu22	1	0	0.000	1	0	0.000	1	0	0.000	1	0	0.000
Enu24	1	0	0.000	1	0	0.000	1	0	0.000	1	0	0.000
Enu26	1	1	0.759	12	1	0.796	1	0	0.000	1	0	0.000
Enu28	1	0	0.000	1	0	0.000	1	1	0.509	1	1	0.526
Enu30	1	0	0.000	2	0.095	0.060	—	—	—	—	—	—
Enu35	1	0	0.000	1	0	0.000	1	0	0.000	2	0.8	0.490
Enu36	1	1	0.512	2	0.619	0.378	1	0	0.000	1	0	0.000
Enu37	1	1	0.512	5	0.81	0.479	—	—	—	—	—	—
Enu38	2	1	0.677	4	0.952	0.604	1	1	0.675	2	1	0.689
Enu39	1	1	0.677	5	0.929	0.563	2	0.185	0.127	3	1	0.608
Enu41	1	1	0.677	8	0.929	0.688	1	1	0.675	1	1	0.690
Average	1.04	0.583	0.350	3.67	0.557	0.376	1.25	0.309	0.193	1.30	0.38	0.262

— = no amplification; H e = expected heterozygosity corrected for allele dosage; H o = observed heterozygosity; N = number of individuals sampled; N gt = number of genotypes.

Geographic coordinates for the populations and voucher information are given in Appendix 1.

Cross‐species amplification in E. canadensis was successful, revealing 19 polymorphic loci with two to nine alleles per locus (average 3.6) and 87 alleles in total (Table 1). However, four loci had high null allele frequencies. At population level, low levels of both genetic diversity (mean H e = 0.193 and 0.262; Table 2) and genotypic diversity (mean N gt = 1.25 and 1.30) were found in two populations. In both species, the number of alleles detected per individual and locus ranged between one and four, as expected for a tetraploid species (Table 1).

CONCLUSIONS

The microsatellite markers developed for E. nuttallii were also proved to be useful in E. canadensis. Allelic diversity was generally higher in invasive populations of E. nuttallii compared to invasive populations of E. canadensis. This suggests that different processes may drive the invasion of these two morphologically and ecologically highly similar species. The new markers will be useful for further analysis of clonal diversity and genetic structure of E. nuttallii and E. canadensis and, in particular, to investigate their European invasion history.

Species	Country, municipality/state, waterbody	Geographic coordinates	No. of ramets	Vouchera
E. canadensis Michx.	Germany, Bavaria, Chiemsee	47°52′21″N, 12°27′36″E	1	EMT_41
E. canadensis	Germany, Bavaria, Ferchensee	47°26′19″N, 11°12′49″E	1	EMT_42
E. canadensis	Germany, Bavaria, Froschhauser See	47°41′13″N, 11°13′28″E	1	EMT_37
E. canadensis	Germany, Bavaria, Moosach	48°23′38″N, 11°43′27″E	1	EMT_38
E. canadensis	Germany, Bavaria, Starnberge See	47°54′45″N, 11°18′25″E	1	EMT_43
E. canadensis	Germany, Lower Saxony, Hauptkanal	52°53′20″N, 8°58′53″E	1	EMT_28
E. canadensis	Germany, North Rhine‐Westphalia, Diersfordter Waldsee	51°41′46″N, 6°31′54″E	1	EMT_70
E. canadensis	Germany, North Rhine‐Westphalia, Tenderingsee	51°35′43″N, 6°43′30″E	1	EMT_67
E. canadensis	Germany, Saxony, Delinkateich	51°24′25″N, 14°45′00″E	1	EMT_11
E. canadensis	Germany, Saxony, gravel pit Kleinpösna	51°18′43″N, 12°31′51″E	27	EMT_130
E. canadensis	Germany, Saxony, Kleinliebenau	51°22′01″N, 12°13′31″E	1	EMT_328
E. canadensis	Germany, Saxony, Kulkwitzer See	51°17′52″N, 12°15′14″E	1	EMT_51
E. canadensis	Germany, Saxony, Cospudener See	51°17′06″N, 12°21′38″E	1	EMT_323
E. canadensis	Germany, Saxony, Leipzig	51°19′41″N, 12°17′27″E	2	EMT_324
E. canadensis	Germany, Saxony, Nangteich	51°24′30″N, 14°45′01″E	1	EMT_329
E. canadensis	Germany, Saxony, Parthe	51°22′09″N, 12°24′47″E	11	EMT_266
E. canadensis	Germany, Saxony‐Anhalt, Hasselvorsperre	51°42′33″N, 10°49′51″E	1	EMT_50
E. canadensis	Germany, Saxony‐Anhalt, Mulde	51°40′51″N, 12°17′41″E	2	EMT_249
E. canadensis	Germany, Saxony‐Anhalt, Raßnitzer See	51°22′0″N, 12°4′41″E	5	EMT_87
E. canadensis	Norway, Buskerud, Tyrifjorden	59°57′51″N, 9°59′47″E	1	EMT_317
E. canadensis	Austria, Salzkammergut, Grundlsee	47°37′58″N, 13°51′52″E	1	EMT_39
E. canadensis	Peru, Cusco, Oropesa	−13°33′37″N, −71°51′40″E	1	EMT_338
E. canadensis	Purchased online (Nymphaion)		6	EMT_347
E. canadensis	Slovenia, Podravska, Ptujsko jezero	46°23′14″N, 15°54′25″E	1	EMT_307
E. canadensis	USA, Alaska, Alexander Lake	61°44′38″N, −150°53′31″E	1	EMT_61
E. canadensis	USA, Maryland, Conococheague Creek	39°41′38″N, −77°48′34″E	2	EMT_308
E. canadensis	USA, New York, Collins Lake	42°49′38″N, −73°57′15″E	6	EMT_284
E. canadensis	USA, New York, Lake Ontario	43°18′43″N, −77°43′13″E	9	EMT_285
E. canadensis	USA, New York, Niagara River	43°06′26″N, −78°58′41″E	1	EMT_300
E. canadensis	USA, Pennsylvania, Erie See	42°07′41″N, −80°08′33″E	1	EMT_303
E. nuttallii (Planch.) H. St. John	Germany, Baden‐Württemberg, Bodensee	47°44′59″N, 9°07′54″E	3	EMT_359
E. nuttallii	Germany, Baden‐Württemberg, Brigach	47°59′51″N, 8°27′48″E	1	EMT_32
E. nuttallii	Germany, Baden‐Württemberg, Donau	47°54′57″N, 8°34′9″E	2	EMT_30
E. nuttallii	Germany, Baden‐Württemberg, Kapuzinergraben	48°17′26″N, 7°47′46″E	3	EMT_354
E. nuttallii	Germany, Baden‐Württemberg, Rhein	48°12′26″N, 7°39′31″E	14	EMT_356
E. nuttallii	Germany, Bavaria, Chiemsee	47°51′49″N, 12°24′58″E	1	EMT_40
E. nuttallii	Germany, Bavaria, Ilm	48°25′58″N, 11°23′55″E	1	EMT_35
E. nuttallii	Germany, Bavaria, Kleine Vils	48°29′8″N, 12°18′18″E	1	EMT_36
E. nuttallii	Germany, Bavaria, Starnberge See	47°54′53″N, 11°17′41″E	3	EMT_34
E. nuttallii	Germany, Berlin, Tegeler See	52°35′33″N, 13°15′44″E	1	EMT_274
E. nuttallii	Germany, North Rhine‐Westphalia, Baldeneysee	51°23′56″N, 7°02′56″E	1	EMT_208
E. nuttallii	Germany, North Rhine‐Westphalia, Hürther Waldsee	50°52′26″N, 6°50′36″E	1	EMT_64
E. nuttallii	Germany, North Rhine‐Westphalia, Kemnader See	51°25′20″N, 7°16′00″E	4	EMT_213
E. nuttallii	Germany, North Rhine‐Westphalia, Lippe	51°41′43″N, 7°50′28″E	1	EMT_254
E. nuttallii	Germany, North Rhine‐Westphalia, Rotbach	51°34′24″N, 6°47′40″E	1	EMT_237
E. nuttallii	Germany, Rhineland‐Palatinate, Dreifelder Weiher	50°35′27″N, 7°49′33″E	1	EMT_66
E. nuttallii	Germany, Rhineland‐Palatinate, Laacher See	50°24′48″N, 7°16′20″E	1	EMT_69
E. nuttallii	Germany, Rhineland‐Palatinate, Rhein	49°17′9″N, 8°27′21″E	2	EMT_65
E. nuttallii	Germany, Rhineland‐Palatinate, Schäferweiher	50°33′40″N, 7°44′01″E	1	EMT_68
E. nuttallii	Germany, Saxony, Berzdorfer See	51°06′13″N, 14°58′35″E	1	EMT_45
E. nuttallii	Germany, Saxony, Chausseeteich	51°24′38″N, 14°47′19″E	2	EMT_268
E. nuttallii	Germany, Saxony, Cospudener See	51°15′37″N, 12°20′19″E	21	EMT_252
E. nuttallii	Germany, Saxony, gravel pit Kleinliebenau	51°22′08″N, 12°11′59″E	3	EMT_337
E. nuttallii	Germany, Saxony, gravel pit Kleinpösna	51°18′35″N, 12°31′45″E	23	EMT_104
E. nuttallii	Germany, Saxony, Heideteich	51°24′36″N, 14°45′33″E	2	EMT_23
E. nuttallii	Germany, Saxony, Leipzig	51°15′45″N, 12°21′21″E	2	EMT_321
E. nuttallii	Germany, Saxony, Mulde	51°31′40″N, 12°36′28″E	1	EMT_275
E. nuttallii	Germany, Saxony, Mylau	50°37′12″N, 12°16′33″E	1	EMT_331
E. nuttallii	Germany, Saxony, Parthe	51°21′40″N, 12°24′28″E	9	EMT_266
E. nuttallii	Germany, Saxony, Unterer Oberteich	51°24′36″N, 14°47′17″E	3	EMT_21
E. nuttallii	Germany, Saxony, Weiße Elster	51°12′19″N, 12°18′16″E	20	EMT_234
E. nuttallii	Germany, Saxony, Weiße Schöps	51°22′57″N, 14°44′01″E	1	EMT_335
E. nuttallii	Germany, Saxony, Winterteich	51°23′16″N, 14°51′42″E	1	EMT_267
E. nuttallii	Germany, Saxony, Zwenkauer See	51°12′57″N, 12°21′15″E	12	EMT_261
E. nuttallii	Germany, Saxony‐Anhalt, Elbe	52°02′01″N, 1°52′39″E	4	EMT_256
E. nuttallii	Germany, Saxony‐Anhalt, Großer Goitzschesee	51°37′12″N, 12°23′59″E	43	EMT_185
E. nuttallii	Germany, Saxony‐Anhalt, Mulde	51°35′44″N, 12°30′03″E	7	EMT_204
E. nuttallii	Germany, Saxony‐Anhalt, Muldestausee	51°37′16″N, 12°25′01″E	15	EMT_201
E. nuttallii	Germany, Saxony‐Anhalt, Raßnitzer See	51°21′59″N, 12°4′59″E	19	EMT_76
E. nuttallii	Germany, Saxony‐Anhalt, Saale	51°34′52″N, 11°48′46″E	1	EMT_242
E. nuttallii	Germany, Saxony‐Anhalt, Seelhausener See	51°35′19″N, 12°26′27″E	9	EMT_56
E. nuttallii	Peru, Cusco, Oropesa	−13°33′37″N, −71°51′40″E	1	EMT_340
E. nuttallii	Purchased online (Nymphaion)		4	EMT_343
E. nuttallii	Slovenia, Podravska, Drava	46°24′17″N, 16°08′59″E	1	EMT_306
E. nuttallii	Slovenia, Oresje	45°53′11″N, 15°16′07″E	1	EMT_305
E. nuttallii	USA, Alaska, Potter Marsh	61°03′47″N, −149°47′55″E	1	EMT_60
E. nuttallii	USA, Maryland, Potomac River	39°36′27″N, −77°58′08″E	1	EMT_310
E. nuttallii	USA, New York, Collins Lake	42°49′38″N, −73°57′15″E	1	EMT_284.2
E. nuttallii	USA, New York, Lake Ontario	43°21′22″N, −77°56′16″E	1	EMT_298
E. nuttallii	USA, New York, Niagara River	43°03′36″N, −78°58′41″E	2	EMT_301
E. nuttallii	USA, Pennsylvania, Lake Erie	42°07′41″N, −80°08′25″E	1	EMT_302
E. nuttallii	USA, Pennsylvania, Quaker Lake	41°58′39″N, −75°55′08″E	2	EMT_314
E. nuttallii	USA, Virginia, Gunston Cove	38°40′30″N, −77°09′20″E	3	EMT_311

Vouchers are deposited at the Helmholtz Centre for Environmental Research, Permoserstraße 15, 04318 Leipzig, Germany.