Literature DB >> 30123102

Characterization of TaDREB1 in wheat genotypes with different seed germination under osmotic stress.

Meng Liu1, Zeng Wang1, Hong-Mei Xiao1, Yan Yang1.   

Abstract

BACKGROUND: The cis-acting element DRE/CRT plays an important role in activating gene expression responsive to osmotic stress, low temperature and high-salinity. DREB1/CBF genes encode DRE-binding proteins with the function as transcript activators. TaDREB1 was also found to be induced by osmotic stress.
METHODS: The dates of osmotic stress was assessed by seed germination drought resistance index; the full-length cDNA sequences of TaDREB1 gene were downloaded from NCBI datebase; identification of allelic variation and transcript expression were assessed by PCR and semi-quantitive RT-PCR analysis, respectively.
RESULTS: Total 13 new allele variations of TaDREB1 were identified in the germplasms tested in the paper, including 5 TaDREB1-A on chromosome 3AL, 4 TaDREB1-B on chromosome 3BL and 4 TaDREB1-D on chromosome 3DL. In each variety, there existed two loci of TaDREB1-D genes, named TaDREB1-D1 and TaDREB1-D2, both of which had the similar nucleotide sequence except an 11 bp insertion in the former. In wheat seeds under osmotic stress, we did not detect the transcript expression level of TaDREB1-A and TaDREB1-B, but that of TaDREB1-D.
CONCLUSIONS: The capacity of osmotic stress tolerance was closely correlated with the expression level and tendency of TaDREB1-D.

Entities:  

Keywords:  Expression characteristics; Nucleotide polymorphism; Osmotic stress resistance; TaDREB1

Mesh:

Substances:

Year:  2018        PMID: 30123102      PMCID: PMC6090928          DOI: 10.1186/s41065-018-0064-6

Source DB:  PubMed          Journal:  Hereditas        ISSN: 0018-0661            Impact factor:   3.271


Background

Drought is already widespread in many regions and one of the primary reason causing plant loss worldwide. [1]. Even in many irrigated regions, shortage of water supply allows only limited irrigation. Therefore, it is imperative to strengthen the study on osmotic stress resistance of wheat. Five multi-gene families belong to transcript factors [bZIP (mainly AREB/ABF), DREB (AP2/EREBP), MYB/MYC, NAC and WRKY)] have been reported to be associated with drought tolerance. A number of wheat genes for transcript factors (TabZIP1, TabZIP60, TaABRE3, TaDREB1, TaPIMP1, TaNAC29 and TAWRKY44) have been shown to exhibit the induced expression during exposure to drought stress, suggesting that these genes may be used for improving stress tolerance in wheat [2-9]. Dehydration-responsive element binding (DREB) proteins constitute a large family of transcription factors regulating some functional genes closely related to drought, high-salinity and low temperature [10, 11]. Arabidopsis genome has six DREB1/CBF genes, namely DREB1A/CBF3, DREB1B/CBF1, DREB1C/CBF2, DREB1D/CBF4, DDF1/DREB1F and DDF2/DREB1E [12]. DREB genes feature three conserved regions, an EREBP/AP2 DNA binding domain [13, 14], an N-terminal nuclear localization signal, and a conserved Ser/Thr-rich region adjacent to the EREBP/AP2 domain [15, 16]. The characteristics of above three regions determine the DREB characteristics [17]. Most of the functional studies on DREB transcription factors were focused on Arabidopsis thaliana before 2002, and then in wheat, rice, soybean, cotton and other plants [18-24]. DREB factors have been extensively characterized and grouped into several molecular classes based on similarities in the function or the amino acid sequence of the proteins they encode [24]. DREB1 and DREB2 are two main subgroups of the DREB subfamily, involved in two different signal transduction pathways under cold and dehydration, respectively [25]. DREB1 genes include DREB1-A, DREB1-B, DREB1-C,DREB1-D,DREB1-E and DREB1F [26]. TaDREB1 genes were located on chromosomes 3A, 3B and 3D [11], and isolated from a drought-induced cDNA library of wheat, which was found to be induced by low temperature, abscisic acid (ABA), salinity and drought [27]. The cDNA length of TaDREB1 is 1292 bp, including 837 bp open reading frame, 251 bp 5’-UTR and 204 bp 3’-UTR [18]. The study results showed that the heterogeneity of TaDREB1 gene haplotypes is inconsistent in drought-resistant materials or in drought-sensitive wheat materials, indicating the complexity of drought resistance. In addition, the nucleic acid polymorphisms of TaDREB1 gene are richer in wheat [26]. The present research aimed at identifying the seed germination resistance varieties under osmotic stress for wheat breeding program, searching the new allelic variation of TaDREB1, looking for SNPs, InDels and transcript expression level associated with seed germination tolerance under osmotic stress, and charactering the transcript expression level of TaDREB1-A, TaDREB1-B and TaDREB1-D in wheat varieties or lines with different values of GDRI (germination drought resistance index).

Methods

Plant materials

Six spring wheat genotypes were used for cloning of TaDREB1-A, TaDREB1-B and TaDREB1-D genes, including three osmotic stress-resistant genotypes (08–1783, 08–1826 and 07–6239 with relative germination rate values of 55.98, 47.74 and 47.11%, respectively) and three osmotic stress-susceptible ones (08dongzhong 275, Zhangye 1 and 05 cm 178 with relative germination rate values of 1.27, 0.51 and 0%, respectively). Eighty Chinese spring wheat genotypes, with different osmotic stress tolerance from China Spring-sown Wheat Region (CSWR) were used for identifying the osmotic stress tolerance (Table 1). Mature seeds of 08–1783 and Zhangye 1 were used to extract RNA for analysis of mRNA transcription.
Table 1

Primer sequence used in this study

PrimerPrimer sequence(5′-3′)Fragment size (bp)Anneal temp.(°C)
DREB1-A1FCGGAACCACTCCCTCCATCTC110762
DREB1-A1RCGGTTGCCCCATTAGACGTCA
DREB1-A2FCTGGCACCTCCATTGCTGAC59963
DREB1-A2RAGTACATGAACTCAACGCACAGGACAAC
DREB1-BFCCCAACCCAAGTGATAATAATCT71658
DREB1-BRTTGTGCTCCTCATGGGTACTT
DREB1-D1FTCGTCCCTCTTCTCGCTCCAT119063
DREB1-D1RGCGGTTGCCCCATTAGACATCG
DREB1-D2FCTGGCACCTCCATTGCCGAT59664
DREB1-D2RAGTACATGAACTCAACGCACAGGACAAC
DREB UTCGTCCCTCTTCTCGCTCCATGG49366
DREB DGGGCATGGCG CCGCATGG
DREB1-AFATGAACAGGAAGAAGAAAGTGCGC59362
DREB1-ARTTCTCAAATCATTGCTCACT TCTTTC
DREB1-BFATGACCAGGAAGAAGAAAGTGCGC58560
DREB1-BRTCATTGCTCACTTCTTTTTTCACCTTAT
DREB1-DFATGAACAGGAAGAAGAAAGTGCGC45562
DREB1-DRTCCTTCCCATCAGAAGGATGTGAC
β-actin FGTTTCCTGGAATTGCTGATCGCAT41065
β-actin RCATTATTTCATACAGCAGGCAAGC
Primer sequence used in this study

Methods

Assay for seed germination drought tolerance

Osmotic stress was assessed based on seed germination drought resistance index (GDRI). Ears were harvested at dough-yellow ripening stage, hand-threshed and sterilized with HgCl2, and then placed in plastic petri dishes on filter paper with 6 mL of treatment solution (− 1.00 MPa) at room temperature, and distilled water was used as a control. Germinated seeds were counted and removed daily. The number of germinated seeds was investigated on the 2nd, 4th, 6th and 8th days (seeds with over 1 mm length of radicle were counted). The GDRI values was calculated according to the following formula: GDRI-germination drought resistance index of seeds per reparation. GIs-germination index of seeds under stress. GIc-germination index of seeds as control. nd2, nd4, nd6, nd8 -represents the number of seeds germinated on day 2, 4, 6 and 8, respectively. N-represents the total number of seeds. Then using the membership function method in fuzzy mathematic, the average germination index of wheat under osmotic stress was calculated to evaluate the difference of osmotic stress resistance among the varieties [28, 29]. Xj----the jth measured value of osmotic stress resistance index; Xjmax-----the maximum value of the jth osmotic stress resistance index. Xjmin------the minimum value of the jth osmotic stress resistance index. U(xj)--the membership function value of the jth index. Rj-----The correlation coefficient between the jth index and the comprehensive 106 osmotic stress resistance coefficient. R/ ∑ nj = 1rj ------As the indicator weight, indicating the importance of the jth index in all indicators. D---The evaluated value of each osmotic stress resistance indicator for each species under mannitol stress. If the measured index is positively correlated with the osmotic stress resistance of the genotypes, then formula (1) is used to calculate the membership function value, otherwise (2). Using D values to evaluate the osmotic stress resistance of the species, that is, D > 0.80 is for Level 1 (strong resistance), 0.50 < D < 0.80 is for Level 2 (resistance), 0.30 < D < 0.5 is for Level 3 (weak resistance), D < 0.30 is for Level 4 (sensitive). The entire osmotic stress resistance index was treated with Excel system.

Primer design

Based on the full-length cDNA sequence of TaDREB1 gene(AF303376), the primers were designed using DNAMAN software and were synthesized in Takara Biotechnology (Dalian) Co. Ltd. in China (Table 2).
Table 2

Values of GDRI in 80 spring wheat varieties and lines

NoVarieties and linesGDRI (2015)%GDRI (2016)%Average GDRI (%)D values
108–178322.5789.3955.981.00
207–586622.7774.1848.470.87
308–182629.7165.7847.740.85
407–623921.6672.5747.110.84
5Bayou 222.8368.2745.550.81
634–2066.7483.6945.220.81
7Linyou 222.9566.1744.560.80
808–17189.1677.4743.310.77
908–22949.5175.4242.460.76
1008–33487.876.9242.360.76
11Jinsui00951.6680.1140.880.73
12Qingchun376.0775.4640.770.73
13Bayou17.3873.6240.50.72
14Linyou 110.9968.5739.780.71
1573B60913.4763.0338.250.68
168916–4012.9463.4138.170.68
17Bi 1ama012.3962.4737.430.67
18Wu E32–113.0161.7137.360.67
19Yong2739070.2635.130.63
20Jiu99962.0863.5832.830.59
21Jinsui81457.5750.1428.860.52
2208dongzhong24557.2648.3327.80.50
23Qingchun55612.0743.3727.720.50
2405 cm2200.7553.4527.10.48
2505–11733.9246.7225.320.45
26Lafan88.9739.7524.360.44
2795y1611.4132.3421.880.39
28Zhongning310518.6232.6920.650.37
29Ganchun2011.5426.6719.10.34
30Ningchun104.3532.0918.220.33
31Bafeng116.7818.4317.60.31
32NingPS1841.0133.7617.390.31
33La2676–91.9232.8417.380.31
34Yemao16.3418.1817.260.31
35G4716.9215.7416.330.29
36Zhongguochun9.2922.4315.860.28
37C18455.7324.515.120.27
3808dongzhong67414.5525.1214.830.26
39Jiaoyuan35616.4710.9213.70.24
40Xiaobing324.1222.5913.350.24
4108–16990.6425.9313.280.24
4208dongzhong179111.5414.2212.880.23
4307–62283.0322.1912.610.23
44Ganchun22816.7712.390.22
45Bafeng33.1719.9311.550.21
4603 cm-338022.4611.230.20
47Qinghai 932022.3711.180.20
4808dongzhong18071.7618.3110.030.18
4905–53710.5217.038.770.16
50Luobupin16.190.888.540.15
51Wu M27–2016.678.330.15
52YK6–3251.4515.158.30.15
5308–3536.329.898.110.14
54Bafeng68.587.377.980.14
55Gelanni1.9613.917.930.14
5682,170–18.76.677.680.14
57Wu M4373.5711.767.670.14
58Yong 23526.118.787.450.13
5908dongzhong24178.85.287.040.13
6008dongzhong300810.712.426.560.12
61Ningzi08A751012.796.390.11
6208dongzhong5503.218.755.980.11
63y312.269.675.960.11
64Moyin454.767.035.90.11
6508dongzhong11467.693.965.830.10
66Lanyou50740.398.674.530.08
6708–34101.376.253.810.07
6808H4153.234.383.80.07
6907–67512.34.763.530.06
70Hetao306.973.480.06
71Zhangchun1106.253.130.06
72Yong 235605.692.840.05
7308H2740.343.561.950.03
74Jiusandasui77882.631.231.930.03
75Shentai10.962.21.580.03
7608dongzhong27502.531.270.02
7708dongzhong180902.51.250.02
78Ningchun352.3301.160.02
79Zhangye11.0200.510.01
8005 cm1780000.00
Values of GDRI in 80 spring wheat varieties and lines

PCR amplification and semi-quantitive RT-PCR analysis

For each varieties, 3 ~ 5 seeds were selected and cultured in a clean culture dish at 25 °C for 5 ~ 7 d. 1 ~ 2 g leaves were frozen by liquid nitrogen. Then genomic DNA was extracted by method of CTAB. The TaDREB1-A, TaDREB1-B and TaDREB1-D were amplified by specific primers (Table 1) in genotypes with different osmotic stress tolerance. PCR reaction was performed in a PTC-100 TMProgrammable Thermal Controller in a total volume of 15 μL, including 30 ng genomic DNA, 10 × PCR reaction Mix buffer 1.5 μL, 0.3 μM of each primer, 0.5 U of Taq DNA polymerase (TaKaRaCo., China). It was carried out using the following programs: initial denaturation at 94 °C for 5 min; 35 cycles of 72 °C for 30–90s, annealing at 58 °C~ 64 °C for 30 ~ 90s, 72 °C for 30 ~ 90s and a final extension at 72 °C for 10 min. The PCR products recovered by agarose gel were cloned into the cloning vector PMD19-T (TaKaRaCo., China). The sequencing was performed by Nanjing Kingsley Sequencing Co., Ltd. Sequencing data analysis was performed using DNAMAN software (https://www.lynnon.com/pc/framepc.html). Total RNA was extracted from the mature dry seeds treated with − 1.00 MPa mannitol for 0 h, 12 h, 24 h and 36 h, using TaKaRa Mini BEST plant RNA extraction kit (TaKaRa Co., China). The concentration and purity of the total RNA extracted was determined using a NanoDropND-2000C spectrophotometer. According to the manuscript, cDNA was synthesized with the reverse transcriptase kit RTaseM-MLV (TaKaRa Co., China). RT-PCR reaction was performed in a PTC-100 TMProgrammable Thermal Controller with a total volume of 15 μL, including 30 ng template cDNA, 1.5 μL10 × PCR reaction mix buffer, 0.3 μM of each primer, 0.5 U of Taq DNA polymerase(TaKaRaCo., China). PCR amplification were 94 °C for 5 min; 35 cycles of 72 °C for 30s, annealing at 62 °C for 30s, 72 °C for 30s and a final extension at 72 °C for 10 min. The PCR products were detected by 1% agarose gel.

Results

Identification of GDRI in 80 varieties and lines

The osmotic stress resistance during germination period of wheat seeds was tested by seed germination drought resistance index (GDRI). The GDRI values of the 80 genotypes showed consistence over the 2 years (R = 0.467, P = 0.000), with mean values and standard deviations were 6.99 ± 6.82 and 30.47 ± 26.84 in the year of 2015 and 2016, respectively (Table 1, Fig. 1).
Fig. 1

The trend of the seed germination osmotic stress index in 80 spring wheat varieties and lines

The trend of the seed germination osmotic stress index in 80 spring wheat varieties and lines The degree of osmotic stress resistance during seed germination period was evaluated by the D values of membership function method in fuzzy mathematics. The analysis of results showed that seven genotypes (08–1783, 07–5866, 08–1826, 07–6239, Bayou 2, 34–206 and Linyou 2) belong to the level 1 osmotic stress tolerance (0.8 < D < 1), accounting for 8.75%; Sixteen belong to the level 2 osmotic stress tolerance (0.5 < D < 0.8), accounting for 20.00%; Fifteen belong to the level 3 osmotic stress tolerance (0.5 < D < 0.3), according for 18.75%; And another 46 ones belong to the level 4 osmotic stress tolerance (sensitive, 0 < D < 0.3), according for 57.50% (Fig. 2).
Fig. 2

Distribution pattern of seed germination osmotic stress resistance of 80 spring wheat varieties and lines. Note: , 2, 3 (3), D value means the evaluated value of each drought resistance indicator for each species under mannitol stress; 0.8 < D < 1.0 is strong resistance, 0.8 > D > 0.5 is resistance, 0.5 > D > 0.3 is weak resistance, 0.3 > D > 0 is sensitive.

Distribution pattern of seed germination osmotic stress resistance of 80 spring wheat varieties and lines. Note: , 2, 3 (3), D value means the evaluated value of each drought resistance indicator for each species under mannitol stress; 0.8 < D < 1.0 is strong resistance, 0.8 > D > 0.5 is resistance, 0.5 > D > 0.3 is weak resistance, 0.3 > D > 0 is sensitive.

Identification of allelic variation of TaDREB1 gene

The specific primers of DREB1-A1, DREB1-A2, DREB1-B, DREB1-D1 and DREB1-D2 were used to amplify the TaDREB1-A1, TaDREB1-B1 and TaDREB1-D1, respectively, in six genotypes (including three osmotic stress-resistant materials and three osmotic stress-sensitive ones). Total 13 new allele variations of TaDREB1-A1, TaDREB1-B1 and TaDREB1-D1 were found and named according to the 2005 Supplement of the Wheat Gene Catalogue [30] in the study, i.e. TaDREB1-A11, TaDREB1-A12, TaDREB1-A13, TaDREB1-A14 and TaDREB1-A15 on chromosome 2AL; TaDREB1-B11, TaDREB1-B12, TaDREB1-B13 and TaDREB1-B14 on chromosome 2BL; TaDREB1-D11, TaDREB1-D12, TaDREB1-D21 and TaDREB1-D22 on chromosome 2DL. Compared with TaDREB1-A (GenBank accession number: DQ195070.1), 38 SNPs were found in the full sequence of TaDREB1-A1, the frequency of SNPs being 2.27%. Among these, 4 SNPs were observed in 5’UTR, 7 SNPs located in the first exons, 23 SNPs found in introns, and the other SNPs were found in the second exons of all alleles of TaDREB1-A1 except TaDREB1-A14. The mutation in 939 bp site is non-synonymous from hydrophobic weak glycine (G) to hydrophobic strong aspartic acid (D), while the mutations in other 3 sites are synonymous. Three base deletions were detected, among which 1 single base T is missed at position 40 bp in 5’UTR of all TaDREB1-A1 variations, and other 2 bp TT deletions occurred at position 453 bp, in introns of all TaDREB1-A1 variations except TaDREB1-A14. 3 insertions were found at position 540 bp (T), 608 bp (CTG), 629 bp (CT) in introns of all TaDREB1-A1 variations except TaDREB1-A14 (Additional file 1: Figure S1). 33SNPs were found in the full sequence of TaDREB1-B1, the frequency of SNPs was 4.78%. Among them, 6 SNPs were found in 5’UTR, twenty-seven SNPs were located in exons of TaDREB1-B11 and TaDREB1-B12. One T is inserted at 485 bp site of coding region. T-A, E-D, G-R, T-I, A-P, K-N, E-R, V-I, S-E, N-Q changes were found in the protein sequences. Most of the amino acid mutations were detected in TaDREB1-A13 genotypes, and the hydrophilicity is enhanced after the amino acid mutation. Lysine (k) is missed. The changes were not consistent with the osmotic stress resistance of the wheat genotypes (Additional file 2: Figure S2). Two genes of TaDREB1-D existed simultaneously on D chromosome of all genotypes, named TaDREB1-D1 amplified with the primer set DREB1-D1F/R and TaDREB1-D2 amplified with the primer set DREB1-D2F/R. TaDREB1-D1 and TaDREB1-D2 had the similar nucleotide sequence except a 11 bp insertion in the former. In addition, two alleles of TaDREB1-D1 were identified, named TaDREB1-D11 and TaDREB1-D12, and also two alleles of TaDREB1-D2 were identified, named TaDREB1-D21 and TaDREB1-D22. TaDREB1-D11 had the same sequence with TaDREB1-D (GenBank accession number: DQ195068.1), while eight SNPs were detected in TaDREB1-D12, of which 6 SNPs presented at position 1205 bp (G-A), 1264 bp (C-G), 1282 bp (A-G), 1340 bp (A-G), 1429 bp(C-A) and 1490 bp (A-G), respectively. Among the SNPs, three mutations changed the amino acids from A (1.8) to A (4.4), H (− 3.2) to R (− 4.5) and A (1.8) to E (− 3.5), respectively. The hydrophilicity of amino acids changed was generally enhanced. Another 2 SNPs were detected in 3’UTR of TaDREB1-D12. Moreover, TaDREB1-D21 had the same sequence with TaDREB1-D11 (DQ195068.1) except a 11 bp deletion (CCCATGCGGCG) at position of 481 bp–491 bp in intron; And TaDREB1-D22 had the same sequence with TaDREB1-D12 except a 11 bp deletion (CCCATGCGGCG) at position of 481 bp–491 bp in intron and a 3 bp (ATT) insertion at positon 1645-1647 bp in 3 ‘UTR (Additional file 3: Figure S3). However, several SNPs were found between TaDREB1-D21 and TaDREB1-D22, the same as between TaDREB1-D11 and TaDREB1-D12.

Expression characterization of TaDREB1-A, TaDREB1-B, and TaDREB1-D in two genotypes with different seed germination osmotic stress tolerances

In order to define the expression patterns of the three homologues and their relationship with osmotic stress tolerance, semi-quantitative RT-PCR analysis was carried out to determine the expression levels of , , and in two wheat genotypes differing in seed germination osmotic stress tolerance, using the ACTIN gene as an internal control. The results showed that the transcriptions of TaDREB1-A and TaDREB1-B genes were not detected in dry seeds and seeds treated with − 1.00 MPa mannitol for 12, 24 and 36 h via agarose gel electrophoresis. However, the expression level of TaDREB1-D had the tendency to increase gradually and then decrease when treated with − 1.00 MPa mannitol for 0 h, 12 h, 24 h and 36 h. Higher transcript expression level was detected in seeds treated by mannitol than in dry seeds. The highest transcript expression level came from osmotic stress-resistant line 08–1783 for 24 h treatment and from osmotic stress-sensitive variety Zhangye 1 after 12 h treatment (Fig. 3).
Fig. 3

Expression of TaDREB1 Gene in Different osmotic stress Resistance and Different osmotic stress-treated Wheat Seeds by RT-PCR.M: DL-2000 DNA marker; Lanes 1–4: lines of 08–1783 (GDRI% = 55.98) (dry seeds treated with − 1.00 MPa mannitol for 0 h, 12 h, 24 h and 36 h); Lanes 5–8:variety of Zhangye 1 (GDRI% = 0.51)) (dry seeds treated with − 1.00 MPa mannitol for 0 h, 12 h, 24 h and 36 h).

Expression of TaDREB1 Gene in Different osmotic stress Resistance and Different osmotic stress-treated Wheat Seeds by RT-PCR.M: DL-2000 DNA marker; Lanes 1–4: lines of 08–1783 (GDRI% = 55.98) (dry seeds treated with − 1.00 MPa mannitol for 0 h, 12 h, 24 h and 36 h); Lanes 5–8:variety of Zhangye 1 (GDRI% = 0.51)) (dry seeds treated with − 1.00 MPa mannitol for 0 h, 12 h, 24 h and 36 h).

Discussion

osmotic stress is the most significant environmental stress in agriculture worldwide, so the improvement of grain yield under water limitation is increasingly targeted in plant breeding program. Seed germination osmotic stress resistance is important for wheat cultivation, especially in seeding stage. TaDREB play an important role in response to drought stress [2]. Compared with the result studied by Wei et al. [11], much rich allelic variations were founded in our study. From the 6 genotypes tested, a total of 13 gene variations (TaDREB1-A11, TaDREB1-A12, TaDREB1-A13, TaDREB1-A14, TaDREB1-A15, TaDREB1-B11, TaDREB1-B12, TaDREB1-B13, TaDREB1-B14, TaDREB1-D11, TaDREB1-D12, TaDREB1-D21 and TaDREB1-D22) were identified, indicating that much richer allelic TaDREB1variations existed in common wheat. However, no relationship was found between the SNPs and GDRI for the time being. In addition, two TaDREB1-D genes was detected in each of the 6 wheat genotypes tested, named TaDREB1-D1 and TaDREB1-D2; And two alleles of TaDREB1-D1 (TaDREB1-D11 and TaDREB1-D12) and two alleles of TaDREB1-D2 (TaDREB1-D21 and TaDREB1-D22) were identified. It was interesting to find that TaDREB1-D21 had the same sequence with TaDREB1-D11 (DQ195068.1) except a 11 bp deletion (CCCATGCGGCG) at position of 481 bp–491 bp in intron; And TaDREB1-D22 had the same sequence with TaDREB1-D12 except a 11 bp deletion (CCCATGCGGCG) at position of 481 bp–491 bp in intron and a 3 bp (ATT) insertion at positon 1645-1647 bp in 3 ‘UTR (Additional file 3: Figure S3). However, several SNPs were found between TaDREB1-D21 and TaDREB1-D22, the same as between TaDREB1-D11 and TaDREB1-D12. The base similarity between TaDREB1-D11 and TaDREB1-D21 (or between TaDREB1-D12 and TaDREB1-D22) was higher than between the two alleles of TaDREB1-D1 (or between the two alleles of TaDREB1-D2). Besides, TaDREB1-D11 and TaDREB1-D21 always appeared together in the same genotype, so as for TaDREB1-D12 and TaDREB1-D22. The results indicated that the duplication of TaDREB1-D gene occurred after the SNP mutations, and the copy of TaDREB1-D11 and TaDREB1-D12 (TaDREB1-D21 and TaDREB1-D22) was independent in different genotypes or environments. Higher transcript expression level of TaDREB1-D presented in seeds treated with mannitol, but no transcript product detected in TaDREB1-A and TaDREB1-B, the results showed that TaDREB1-D was more important to seed germination under osmotic stress than TaDREB1-A and TaDREB1-B. There were some reports that some genes homologies to DREB1 were weakly induced by osmotic stress [10, 19, 31], so same resulit were founded in TaDREB1-A and TaDREB1-B because of no transcript product detected in agrose gel. In addition, according to the complicated function of DREB in Arabidopsis thaliana, rice, soybean, cotton and other plants [18-23] Bohnert et al. 1995 and the transcript expression character of TaDREB1-D, more work needs to clarify the function of TaDREB1-D in further experiment. When seeds were treated with − 1.00 MPa mannitol, the time of the highest transcript expression level of TaDREB1-D presented at 24 h in the line with osmotic stress resistance, but the highest transcript expression level of TaDREB1-D presented at 12 h in the variety with osmotic stress sensitivity. If the time that the highest transcript expression level of TaDREB1-D appeare in more genotypes with different osmotic stress tolerance and relate with seed germonation tolerance under osmotic stress, it could be used as a potential marker to identify the genotypes with more seed germination drought resistance in breeding program, and then to breed the stable and high yield varieties in dry farming conditions. It is necessary to characterize genetic resources based on osmotic stress adaptation, determine suitable genotypes, and use them to improve the wheat resistance. In the germplasms tested, 7 genotypes belong to level 1 osmotic stress tolerance were identified, (08–1783, 07–5866, 08–1826, 07–6239, Bayou 2, 34–206 and Linyou 2), which can be used as the parents in wheat breeding program for seed germination osmotic stress resistance.

Conclusions

In summy, our study was intended to identify the seed germination resistance varieties, search the new allelic variation of TaDREB1, and character the transcript expression level of TaDREB1-A, TaDREB1-B and TaDREB1-D in wheat varieties or lines with different values of GDRI. The results indicated that seven genotypes belong to the level 1 osmotic stress tolerance, which might be used in wheat breeding for drought resistence; thirteen new allele variations of were identified in the germplasms tested, in addition, TaDREB1-D1 and TaDREB1-D2 existed in each variety; In wheat seeds under osmotic stress, no transcript expression level of TaDREB1-A and TaDREB1-B were detected, but that of TaDREB1-D, and the capacity of osmotic stress tolerance was closely correlated with the expression level and tendency of TaDREB1-D. Figure S1. Sequence comparison of the TaDREB1-A11, TaDREB1-A12,TaDREB1-A13,TaDREB1-A14,TaDREB1-A15 and TaDREB1-A (DQ195070 .1), SNPs shown with boldface letters. (DOCX 40 kb) Figure S2. Sequence comparison of the TaDREB1-B11, TaDREB1-B12,TaDREB1-B13,TaDREB1-B14 and TaDREB1-B (DQ195069 .1), SNPs shown with boldface letters. (DOCX 19 kb) Figure S3. Sequence comparison of the TaDREB1-D11, TaDREB1-D12,TaDREB1-D21,TaDREB1-D22 and TaDREB1-D (DQ195068.1), insertions are shadowed, SNPs shown with boldface letters. (DOCX 23 kb)
  28 in total

1.  Characterization of the transcriptional activator CBF1 from Arabidopsis thaliana. Evidence for cold denaturation in regions outside of the DNA binding domain.

Authors:  E Kanaya; N Nakajima; K Morikawa; K Okada; Y Shimura
Journal:  J Biol Chem       Date:  1999-06-04       Impact factor: 5.157

Review 2.  Recent advances in engineering plant tolerance to abiotic stress: achievements and limitations.

Authors:  Basia Vinocur; Arie Altman
Journal:  Curr Opin Biotechnol       Date:  2005-04       Impact factor: 9.740

3.  The Arabidopsis HOS1 gene negatively regulates cold signal transduction and encodes a RING finger protein that displays cold-regulated nucleo--cytoplasmic partitioning.

Authors:  H Lee; L Xiong; Z Gong; M Ishitani; B Stevenson; J K Zhu
Journal:  Genes Dev       Date:  2001-04-01       Impact factor: 11.361

4.  DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression.

Authors:  Yoh Sakuma; Qiang Liu; Joseph G Dubouzet; Hiroshi Abe; Kazuo Shinozaki; Kazuko Yamaguchi-Shinozaki
Journal:  Biochem Biophys Res Commun       Date:  2002-01-25       Impact factor: 3.575

5.  An EREBP/AP2-type protein in Triticum aestivum was a DRE-binding transcription factor induced by cold, dehydration and ABA stress.

Authors:  Y-G Shen; W-K Zhang; S-J He; J-S Zhang; Q Liu; S-Y Chen
Journal:  Theor Appl Genet       Date:  2002-11-15       Impact factor: 5.699

6.  Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element.

Authors:  M Ohme-Takagi; H Shinshi
Journal:  Plant Cell       Date:  1995-02       Impact factor: 11.277

7.  Variation in dehydration tolerance, ABA sensitivity and related gene expression patterns in D-genome progenitor and synthetic hexaploid wheat lines.

Authors:  Yumeto Kurahashi; Akihiro Terashima; Shigeo Takumi
Journal:  Int J Mol Sci       Date:  2009-06-18       Impact factor: 6.208

8.  Expression of TaWRKY44, a wheat WRKY gene, in transgenic tobacco confers multiple abiotic stress tolerances.

Authors:  Xiatian Wang; Jian Zeng; Ying Li; Xiaoli Rong; Jiutong Sun; Tao Sun; Miao Li; Lianzhe Wang; Ying Feng; Ruihong Chai; Mingjie Chen; Junli Chang; Kexiu Li; Guangxiao Yang; Guangyuan He
Journal:  Front Plant Sci       Date:  2015-08-11       Impact factor: 5.753

9.  TaNAC29, a NAC transcription factor from wheat, enhances salt and drought tolerance in transgenic Arabidopsis.

Authors:  Quanjun Huang; Yan Wang; Bin Li; Junli Chang; Mingjie Chen; Kexiu Li; Guangxiao Yang; Guangyuan He
Journal:  BMC Plant Biol       Date:  2015-11-04       Impact factor: 4.215

10.  Wheat Transcription Factor TaAREB3 Participates in Drought and Freezing Tolerances in Arabidopsis.

Authors:  Jingyi Wang; Qian Li; Xinguo Mao; Ang Li; Ruilian Jing
Journal:  Int J Biol Sci       Date:  2016-01-01       Impact factor: 6.580

View more
  6 in total

1.  Editorial: Drought Threat: Responses and Molecular-Genetic Mechanisms of Adaptation and Tolerance in Wheat.

Authors:  Dev Mani Pandey; Yin-Gang Hu; Yuri Shavrukov; Narendra Kumar Gupta
Journal:  Front Plant Sci       Date:  2022-06-30       Impact factor: 6.627

2.  Physiological, Biochemical and Molecular Response of Different Winter Wheat Varieties under Drought Stress at Germination and Seedling Growth Stage.

Authors:  Rosemary Vuković; Ivna Štolfa Čamagajevac; Ana Vuković; Katarina Šunić; Lidija Begović; Selma Mlinarić; Ramona Sekulić; Nikolina Sabo; Valentina Španić
Journal:  Antioxidants (Basel)       Date:  2022-03-31

Review 3.  Transcription Factors in Plant Stress Responses: Challenges and Potential for Sugarcane Improvement.

Authors:  Talha Javed; Rubab Shabbir; Ahmad Ali; Irfan Afzal; Uroosa Zaheer; San-Ji Gao
Journal:  Plants (Basel)       Date:  2020-04-10

4.  Shaping Durum Wheat for the Future: Gene Expression Analyses and Metabolites Profiling Support the Contribution of BCAT Genes to Drought Stress Response.

Authors:  Valentina Buffagni; Filippo Vurro; Michela Janni; Mariolina Gullì; Arturo A Keller; Nelson Marmiroli
Journal:  Front Plant Sci       Date:  2020-07-03       Impact factor: 5.753

5.  Genome-Wide Identification and Analysis of bZIP Gene Family and Resistance of TaABI5 (TabZIP96) under Freezing Stress in Wheat (Triticum aestivum).

Authors:  Yi Liang; Jingqiu Xia; Yunshuang Jiang; Yuzhuo Bao; Huichan Chen; Duojia Wang; Da Zhang; Jing Yu; Jing Cang
Journal:  Int J Mol Sci       Date:  2022-02-21       Impact factor: 5.923

6.  A Group I WRKY Gene, TaWRKY133, Negatively Regulates Drought Resistance in Transgenic Plants.

Authors:  Meicheng Lv; Wen Luo; Miaomiao Ge; Yijun Guan; Yan Tang; Weimin Chen; Jinyin Lv
Journal:  Int J Mol Sci       Date:  2022-10-10       Impact factor: 6.208

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.