Literature DB >> 30081952

The MEP pathway in Babesia orientalis apicoplast, a potential target for anti-babesiosis drug development.

Lan He1,2,3, Pei He1,2, Xiaoying Luo1,2, Muxiao Li1,2, Long Yu1,2, Jiaying Guo1,2, Xueyan Zhan1,2, Guan Zhu4, Junlong Zhao5,6,7.   

Abstract

BACKGROUND: The apicomplexan parasite Babesia orientalis, the causative agent of water buffalo babesiosis in China, is widespread in central and south China, resulting in a huge economic loss annually. Currently, there is no effective vaccine or drug against this disease. Babesia bovis and Plasmodium falciparum were reported to possess an apicoplast which contains the methylerythritol phosphate (MEP) pathway inhibitable by fosmidomycin, suggesting that the pathway could serve as a drug target for screening new drugs. However, it remains unknown in B. orientalis.
METHODS: Primers were designed according to the seven MEP pathway genes of Babesia microti and Babesia bovis. The genes were cloned, sequenced and analyzed. The open reading frames (ORFs) of the first two enzyme genes, 1-deoxy-D-xylulose 5-phosphate synthase (BoDXS) and 1-Deoxy-D-xylulose 5-phosphate reductoisomerase (BoDXR), were cloned into the pET-32a expression vector and expressed as a Trx-tag fusion protein. Rabbit anti-rBoDXS and rabbit anti-rBoDXR antibodies were generated. Western blot was performed to identify the native proteins of BoDXS and BoDXR in B. orientalis. Fosmidomycin and geranylgeraniol were used for inhibition assay and rescue assay, respectively, in the in vitro cultivation of B. orientalis.
RESULTS: The seven enzyme genes of the B. orientalis MEP pathway (DXS, DXR, IspD, IspE, IspF, IspG and IspH) were cloned and sequenced, with a full length of 2094, 1554, 1344, 1521, 654, 1932 and 1056 bp, respectively. BoDXS and BoDXR were expressed as Trx-tag fusion proteins, with a size of 95 and 67 kDa, respectively. Western blot identified a 77 kDa band for the native BoDXS and a 49 kDa band for the native BoDXR. The drug assay results showed that fosmidomycin could inhibit the growth of B. orientalis, and geranylgeraniol could reverse the effect of fosmidomycin.
CONCLUSIONS: Babesia orientalis has the isoprenoid biosynthesis pathway, which could be a potential drug target for controlling and curing babesiosis. Considering the high price and instability of fosmidomycin, further studies should focus on the screening of stable and cheap drugs.

Entities:  

Keywords:  1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR); Apicoplast; Babesia orientalis; Fosmidomycin; Isoprenoid; Methylerythritol phosphate (MEP) pathway

Mesh:

Substances:

Year:  2018        PMID: 30081952      PMCID: PMC6090808          DOI: 10.1186/s13071-018-3038-7

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Many members of the Apicomplexa, including Plasmodium, Toxoplasma, Eimeria, Babesia and Theileria, contain a unique, relic, non-photosynthetic plastid-like organelle termed apicoplast [1]. The apicoplast is a semi-autonomous organelle which normally contains a 35 kbp circular genome. There are three pathways in the apicoplast of Plasmodium and Toxoplasma, including the methylerythritol phosphate (MEP) pathway for isoprenoid biosynthesis, FAS pathway and heme operate. In B. bovis and Babesia microti, the isoprenoid biosynthesis MEP pathway is the only metabolic pathway in the apicoplast [2, 3]. Isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) are two precursors to construct all the isoprenoids which are important for organisms. Isoprenoids comprise a large group of diverse intracellular metabolites with multiple cellular functions, including roles in membrane structure, cellular respiration and cell signaling [4]. In nature, there are two distinct biosynthetic routes to produce IPP and DMAPP: methylerythritol phosphate (MEP) pathway and a modified mevalonate (MVA) pathway. The mevalonic acid (MVA) pathway was thought to be the only IPP and DMAPP biosynthetic pathway for decades [5]. Mammals, including humans, use the MVA pathway that initiates from mevalonate, whilst eubacteria, cyanobacteria, plant chloroplasts and apicomplexan parasites exploit the methylerythritol phosphate (MEP) pathway that starts from pyruvate [6]. The MEP pathway is essential in eubacteria and protozoan but absent in humans and animals which could be the hosts of eubacteria and protozoan. The MEP pathway was discovered in the 1990s [7]. In this pathway, the reaction of all the steps are catalyzed by seven different enzymes, including 1-deoxy-D-xylulose 5-phosphate synthase (DXS), 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR or IspC), 4-diphosphocytidyl-2C-methyl-D-erythritol cytidylyltransferase (IspD), 4-diphosphocytidyl-2C-methyl-D-erythritol kinase (IspE), 2C-methyl-D-erythritol-2, 4-cyclodiphosphate synthase (IspF), 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (IspG) and 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate reductase (IspH) [6]. The second enzyme DXR catalyzes step II of the conversion of 1-deoxy-D-xylulose 5-phosphate (DOXP) to 2-C-methyl-D-erythritol 4-phosphate (MEP), which is a target for fosmidomycin [8]. Fosmidomycin, a broad-spectrum antimicrobial agent showing the clinical promise of antimalarial drug, inhibits the isoprenoid biosynthesis by suppressing the activity of P. falciparum DXR, a rate-limiting enzyme of the MEP pathway, and the parasites will die for lack of isoprenoids (by blocking the conversion of DOXP to 2-C-methyl-D-erythritol 4-phosphate). Fosmidomycin is currently under Phase II clinical trials in combination with clindamycin and piperaquine against malaria [8-10]. Babesia spp. are tick-borne intraerythrocytic protozoans and cause babesiosis globally. Babesia orientalis, a recently identified species epidemic in China, causes water buffalo babesiosis. The parasite is transovarially transmitted by Rhipicephalus haemaphysaloides which is the only reported vector of B. orientalis, and water buffalo is the only reported host. As a member of the family Babesiidae, B. orientalis has a similar life-cycle with other babesiid species, including a sexual stage within R. haemaphysaloides, followed by an asexual stage in water buffalo RBC. Babesiosis has become one of the most important water buffalo diseases in central and south China [11]. However, there is no commercial vaccine or drug available to cure the disease. While the MEP pathway plays a critical role in the parasites and is reported to be a potential drug target, little information is available on the MEP pathway in B. orientalis. In this study, we proved that B. orientalis has the MEP pathway, and fosmidomycin can inhibit the growth of B. orientalis. The results demonstrate that the MEP pathway could serve as a potential target for screening anti-babesiosis drugs.

Methods

Parasites

Babesia orientalis (Wuhan strain) was previously isolated from Wuhan city, Hubei Province, China, and preserved in liquid nitrogen in the State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, China. Three one-year-old water buffaloes were purchased from a Babesia-free area. The buffaloes were tested by Giemsa staining and loop-mediated isothermal amplification (LAMP) to confirm that they were Babesia free/negative [12]. One water buffalo was used as a negative control. The other two water buffaloes were splenectomized 2 weeks before infection, and subcutaneously injected with 4 ml of B. orientalis positive blood (1% parasitemia). Blood was collected when the parasitemia of the infected buffaloes reached 3%.

DNA extraction

Blood from the jugular vein of experimentally infected water buffaloes was collected in tubes containing EDTA (BD Vacutainer, USA). Genomic DNA was extracted from 200 μl of B. orientalis-infected blood using the QIAamp DNA Mini Kit (Qiagen, Shanghai, China) according to the manufacturer’s instructions. The DNA samples were used immediately or stored at -20 °C until use.

RNA extraction and cDNA synthesis

Total RNA was extracted from the purified B. orientalis merozoites by using the TRIZOL reagent (Invitrogen, Shanghai, China) and treated with RNase-free DNaseI (TaKaRa, Dalian, China). RNA concentration was measured by Nanodrop 2000. The cDNA was prepared from 1 μg of the total RNA using PrimeScriptTM RT reagent Kit with gDNA eraser (TaKaRa, Dalian, China) according to the manufacturer’s instructions.

Cloning of the seven enzyme genes of the MEP pathway

Primer pairs for the seven enzyme genes of the B. orientalis MEP pathway were designed based on the gene sequences of B. microti and B. bovis (Table 1). Complete sequences of the seven genes were amplified by conventional PCR from genomic DNA and cDNA separately. PCR products were purified and ligated into the cloning vector pDM19-T (TaKaRa, Dalian, China). Three positive colonies of each gene were sent for sequencing. The nucleotide sequences of the seven genes were submitted to GenBank.
Table 1

Primers used to amplify the seven MEP pathway enzyme genes of Babesia orientalis

PrimerSequence (5′-3′)Amplicon size (bp)
DXS-FATGGAGTTGTGTTGTAATC2094
DXS-RTTAGGATGCAAGGAATTGG
DXR-FATGAATGCAGCAGTGAGTTTTTATGgDNA 1554
DXR-RTTAGTATGTGAAGCATTAATATATGTGATAGcDNA 1371
IspD-FATGTCTGTCTGGTTGGTGCAATG1344
IspD-RTCACGGGAAGTATACCTCTTTTAG
IspE-FATGAGGCATCTCCATGTGTG1521
IspE-RTCAAGAGATTAGGTCTGGAAGAAG
IspF-FATGTTACTACGTTATCTTTCTATAACAG654
IspF-FTTATAAAGGATATTACTTGAGCTTC
IspG-FATGACATCGTCAGACACCTTTG1932
IspG-RTCACATGCTTCCACATCTGG
IspH-FATGGAGGAAAGACCGTTTACC1056
IspH-RTTATGTAGTTTTCCAGATTCCTATAATCG
Primers used to amplify the seven MEP pathway enzyme genes of Babesia orientalis

Sequence analysis

The amino acid sequence of BoDXR was aligned with the amino acid sequences from other organisms, including B. bovis, P. falciparum, Arabidopsis thaliana and Escherichia coli. The alignment was performed by using the program MAFFT v7 [13] and then edited in BioEdit. Phylogenetic analysis of the aligned sequences was conducted using the neighbor-joining algorithm in MEGA 6 [14].

Expression and identification of BoDXS and BoDXR

The open reading frame (ORF) of BoDXS was cloned into the pET-32a vector and expressed in E. coli BL21 (DE3). The recombinant protein was purified by affinity purification using a Ni-charged NTA column. Antisera against BoDXS were raised in rabbits. In order to identify the native DXS in B. orientalis, the lysates of erythrocytes prepared from B. orientalis and Babesia-free water buffaloes (the negative control) (0.5 mg per lane) were separated by 12% SDS-PAGE, transferred onto nitrocellulose membrane (Millipore, Shanghai, China) and probed separately with rabbit serum raised against rBoDXS and pre-immune serum (1:100 dilution). The membranes were washed with PBST, and then incubated with the secondary antibody (1:5000, goat anti-rabbit IgG HRP, Beyotime, Shanghai, China). The expression and identification of BoDXR were conducted as previously described for BoDXS.

Babesia orientalis in vitro cultivation and growth inhibition assay

Briefly, B. orientalis in the water buffalo erythrocytes was cultured in M199 media (Gibco Life Technologies, Shanghai, China) supplemented with 1% Albuman I (Gibco Life Technologies), 2% HB101 (Irvine Scientific, Shanghai, China), 1% L-glutamine (ATLANTA Biologicals, Shanghai, China), 2% Antibiotic/Antimycotic 100× (Corning, Shanghai, China) and 20% healthy water buffalo serum with 10% hematocrit (HCT) at 37 °C in a microaerophilous stationary phase (5% CO2, 2% O2, 93% N2). The cultures were sub-cultured every three days when the parasitemia reached 2–3%. Drug stock solutions of fosmidomycin (Sigma-Aldrich, Shanghai, Chain) and diminazene aceturate (Sigma-Aldrich, Shanghai, Chain) were prepared in sterile water. Geranylgeraniol (Sigma-Aldrich, Shanghai, Chain) stocks were prepared in 100% ethanol. For the growth inhibition assay, B. orientalis cultures (total volume, 150 μl/well) were grown in 96-well flat-bottomed plates containing fosmidomycin in culture media. In the rescue experiments, the parasites were divided into five separate treatment groups (5 μM fosmidomycin, 5 μM fosmidomycin plus 5 μM geranylgeraniol, 5 μM geranylgeraniol plus 0.4 μM diminazene aceturate, 0.4 μM diminazene aceturate, and 0.1% ethanol). Diminazene aceturate was used as a positive control drug and ethanol was used as a blank control. During the 72 h incubation of the plates, three smears were prepared from each well and the parasitemias were determined every 24 h by microscopy. Thin blood smears were air-dried, fixed with methanol, and stained with Giemsa (Sigma-Aldrich, Shanghai, China) according to the manufacturer’s instructions. The cultures were prepared in triplicate. The data were analyzed by GraphPad Prism 5 by one-way analysis of variance (ANOVA) followed by Turkey’s multiple comparison test. Error bars represent standard deviations.

Results and discussion

Characterization of the enzyme genes

According to the reported genome sequences of B. bovis and B. microti, the genomes encode all the seven components of the isoprenoid pathway, suggesting that the parasites have the MEP pathway [3, 15]. In this study, the seven enzyme genes of the B. orientalis MEP pathway were amplified from both gDNA and cDNA and sequenced. The full lengths of DXS, DXR, IspD, IspE, IspF, IspG and IspH were 2094, 1554, 1344, 1521, 654, 1932 and 1056 bp, respectively (Fig. 1). These results indicated that all seven genes of the MEP pathway exist in the genome of B. orientalis. The nucleotide sequences of the DXS, DXR, IspD, IspE, IspF, IspG and IspH were submitted to the GenBank database under the accession numbers MH429606, MH429607, MH429608, MH448076, MH429609, MH429610 and MH429611, respectively.
Fig. 1

PCR amplification of the seven enzymes of the B. orientalis MEP pathway. Lane M; marker. Lanes 1, 3, 5, 7, 9, 11 and 13 were amplified from B. orientalis DNA. Lane 1: BoDXS; Lane 3: BoDXR; Lane 5: BoIspD; Lane 7: BoIspE; Lane 9: BoIspF; Lane 11: BoIspG; Lane 13: BoIspH. Lanes 2, 4, 6, 8, 10, 12 and 14 were amplified from B. orientalis cDNA, respectively. Lane 2: BoDXS; Lane 4: BoDXR; Lane 6 BoIspD; Lane 8: BoIspE; Lane 10: BoIspF; Lane 12: BoIspG; Lane 14: BoIspH

PCR amplification of the seven enzymes of the B. orientalis MEP pathway. Lane M; marker. Lanes 1, 3, 5, 7, 9, 11 and 13 were amplified from B. orientalis DNA. Lane 1: BoDXS; Lane 3: BoDXR; Lane 5: BoIspD; Lane 7: BoIspE; Lane 9: BoIspF; Lane 11: BoIspG; Lane 13: BoIspH. Lanes 2, 4, 6, 8, 10, 12 and 14 were amplified from B. orientalis cDNA, respectively. Lane 2: BoDXS; Lane 4: BoDXR; Lane 6 BoIspD; Lane 8: BoIspE; Lane 10: BoIspF; Lane 12: BoIspG; Lane 14: BoIspH BoDXS is intronless, encoding 667 aa with a predicted size of 77 kDa. BoDXR contains a 184 bp intron because the sequence obtained from cDNA is shorter than that of gDNA. It is the only intron gene in B. orientalis MEP pathway. BoDXR ORF is 1371 bp long, encoding 456 aa with a predicted size of 49 kDa. The amino acid sequence of BoDXR was aligned with the sequences of B. bovis (XP_001612194), Plasmodium falciparum (AAD03739), Arabidopsis thaliana (NP_201085) and Escherichia coli (EGT67209) (Fig. 2). The results indicated that DXR is highly conserved between these organisms and most close to B. bovis. For a better understanding of BoDXR and its homologs from related apicomplexans, a neighbor-joining tree was constructed. The results showed that BoDXR was most closely related to DXR from B. bovis. Sequence analysis indicated that BoDXR contains a NADB Rossmann superfamily domain and two DOXP redisom C superfamily domains. The NADB domain is found in numerous dehydrogenases of metabolic pathways, and it is responsible for specifically binding a substrate and catalyzing the enzyme reaction. The DOXP redisom C domain is the DXR C-terminus, which is also found in the DXR enzyme of bacteria and plants. It catalyzes the formation of 2-C-methyl-D-erythritol 4-phosphate (MEP) from 1-deoxy-D-xylulose-5-phosphate (DOXP) in the presence of NADPH.
Fig. 2

Multiple alignment and phylogenetic analysis of DXR amino acid sequence of DXR. a Multiple alignment of DXR aa sequences. Bo, Babesia orientalis; Bb, Babesia bovis (XP_001612194); Pf, Plasmodium falciparum (AAD03739); At, Arabidopsis thaliana (NP_201085); Ec, Escherichia coli (EGT67209). Similar and identical residues are shaded. Black shading indicates a similarity in four or more than four species; gray shading indicates a similarity in three species. b Neighbor-joining phylogenetic tree based on DXR aa sequences. Organism names and sequence accession numbers are indicated

Multiple alignment and phylogenetic analysis of DXR amino acid sequence of DXR. a Multiple alignment of DXR aa sequences. Bo, Babesia orientalis; Bb, Babesia bovis (XP_001612194); Pf, Plasmodium falciparum (AAD03739); At, Arabidopsis thaliana (NP_201085); Ec, Escherichia coli (EGT67209). Similar and identical residues are shaded. Black shading indicates a similarity in four or more than four species; gray shading indicates a similarity in three species. b Neighbor-joining phylogenetic tree based on DXR aa sequences. Organism names and sequence accession numbers are indicated

Characterization of native BoDXS and BoDXR

The initial enzyme DXS and the rate-limited enzyme DXR are the most important enzymes of the MEP pathway. 1-deoxy-D-xylulose 5-phosphate (DOXP), the product of DXS, also participates in thiamine (vitamin B1) biosynthesis and/or pyridoxine (B6) synthesis [16, 17], indicating that DXS is not a committed member of the MEP pathway. However, DXS is the first enzyme of the MEP pathway, and it catalyzes pyruvate and glyceraldehydes-3-phosphate to DOXP in the apicoplast of apicomplexan parasites. The second enzyme DXR, which is considered as the first committed enzyme of the MEP pathway, synthesizes 2-C-methyl-D-erythritol 4-phosphate (MEP) by intramolecular rearrangement and reduction of DOXP [17]. For biochemical characterization of BoDXS and BoDXR enzymes, the corresponding genes were over-expressed in E. coli and purified by Ni-NTA affinity chromatography. The purified rBoDXS and rBoDXR revealed the two bands of 95 and 67 kDa on 10% SDS-PAGE, including an additional 18 kDa Trx-tag (Fig. 3). Antibodies were generated in rabbit for detecting the native BoDXS and BoDXR. After the reaction of the rabbit anti-rBoDXS serum and rabbit anti-rBoDXR serum with B. orientalis lysates, the specific bands of 77 and 49 kDa were yielded, but not in the reaction with the lysates of the healthy bovine erythrocytes or pre-immune rabbit serum (Fig. 4). The results indicated that B. orientalis contains the native enzymes DXS and DXR.
Fig. 3

Expression and purification of rBoDXS and rBoDXR stained by coomassie brilliant blue. Lane M: molecular size marker; Lane 1: uninduced pET-32a-BoDXS; Lane 2: induced pET-32a-BoDXS; Lane 3: uninduced pET-32a-BoDXR; Lane 4: induced pET-32a-BoDXR; Lane 5: purified recombinant BoDXS fused with Trx-tag; Lane 6: purified recombinant BoDXR fused with Trx-tag

Fig. 4

Identification of native BoDXS and BoDXR enzymes in B. orientalis merozoite lysates. a Identification of native BoDXS. Lysates of B. orientalis-infected water buffalo erythrocytes and lysates of uninfected water buffalo erythrocytes were both probed with the serum from rabbit immunized with rBoDXS (Lane 1 and Lane 3, respectively) and the pre-immune rabbit serum (Lane 2 and Lane 4, respectively). b Identification of native BoDXR. Lysates of B. orientalis-infected water buffalo erythrocytes and lysates of uninfected water buffalo erythrocytes were both probed with the serum from rabbit immunized with rBoDXR (Lane 1 and Lane 3, respectively) and the pre-immune rabbit serum (Lane 2 and Lane 4, respectively)

Expression and purification of rBoDXS and rBoDXR stained by coomassie brilliant blue. Lane M: molecular size marker; Lane 1: uninduced pET-32a-BoDXS; Lane 2: induced pET-32a-BoDXS; Lane 3: uninduced pET-32a-BoDXR; Lane 4: induced pET-32a-BoDXR; Lane 5: purified recombinant BoDXS fused with Trx-tag; Lane 6: purified recombinant BoDXR fused with Trx-tag Identification of native BoDXS and BoDXR enzymes in B. orientalis merozoite lysates. a Identification of native BoDXS. Lysates of B. orientalis-infected water buffalo erythrocytes and lysates of uninfected water buffalo erythrocytes were both probed with the serum from rabbit immunized with rBoDXS (Lane 1 and Lane 3, respectively) and the pre-immune rabbit serum (Lane 2 and Lane 4, respectively). b Identification of native BoDXR. Lysates of B. orientalis-infected water buffalo erythrocytes and lysates of uninfected water buffalo erythrocytes were both probed with the serum from rabbit immunized with rBoDXR (Lane 1 and Lane 3, respectively) and the pre-immune rabbit serum (Lane 2 and Lane 4, respectively)

Fosmidomycin inhibits the growth of B. orientalis

The isoprenoid biosynthesis pathway generates isoprenoid precursors, and it is a promising chemotherapeutic target due to the difference between mammals and apicomplexan parasites in the seven enzymes of this pathway [8]. To date, the best characterized inhibitor of the MEP pathway in parasites is the phosphonic acid antibiotic fosmidomycin, a potential inhibitor of DXR by blocking the conversion of DOXP to 2-C-methyl-D-erythritol 4-phosphate [18]. Fosmidomycin is under Phase II clinical trials as a potential antimalarial chemotherapeutic agent in combination with clindamycin and piperaquine [8, 10]. The parasite Babesia is similar to Plasmodium in many aspects, and fosmidomycin was reported to be able to inhibit the intracellular growth of B. divergens at pharmacologically relevant concentrations [19]. However, there is no report about the inhibition of B. orientalis growth by fosmidomycin. In the present study, B. orientalis was cultured and treated separately with 5 μM fosmidomycin, 5 μM fosmidomycin plus 5 μM geranylgeraniol, 5 μM geranylgeraniol plus 0.4 μM diminazene aceturate, 0.4 μM diminazene aceturate, and 0.1% ethanol. Diminazene aceturate was used as a positive drug control. Ethanol was used as a control because geranylgeraniol was soluble in ethanol (treated concentration 0.1%). The parasitemias were examined by Giemsa staining and light microscopy every 24 h. The results indicated that fosmidomycin was effective in inhibition of B. orientalis growth after 24 h (Fig. 5), which is consistent with previous studies in Babesia bovis and Plasmodium falciparum [8, 15]. We found that both fosmidomycin and diminazene aceturate exhibited anti-babesiosis activity at 48 h and 72 h. The relative growth of fosmidomycin and negative controls were significant different at 48 h (ANOVA, F(3, 8) = 23.07, P = 0.0015) and 72 h treatment (ANOVA, F(3, 8) = 73.21, P < 0.0001). However, there was no notable difference between fosmidomycin plus geranylgeraniol and control groups (both negative control and 0.1% ethanol) (Fig. 6). The effects of fosmidomycin were reversed by medium supplemented with a downstream isoprenol geranylgeraniol, confirming that they are specific to isoprenoid blockade.
Fig. 5

Fosmidomycin and geranylgeraniol treated parasites arrest during in vitro cultivation of B. orientalis. The parasites were treated separately with fosmidomycin (FSM), fosmidomycin plus geranylgeraniol (GG-ol), diminazene aceturate (DA), diminazene aceturate plus geranylgeraniol, and ethanol (control). Negative control without any treatment was also included. The parasitemias were determined by Giemsa staining every 24 h. PPE, percent parasitized erythrocytes

Fig. 6

Efficacy of fosmidomycin on the growth of B. orientalis. In vitro cultured B. orientalis were treated separately with fosmidomycin (FSM), fosmidomycin plus geranylgeraniol (GG-ol), diminazene aceturate (DA), and diminazene aceturate plus geranylgeraniol. The growth of parasites was evaluated every 24 h for each treatment. 0.1% ethanol was used as the control. *P < 0.05, **P < 0.01, ***P < 0.001

Fosmidomycin and geranylgeraniol treated parasites arrest during in vitro cultivation of B. orientalis. The parasites were treated separately with fosmidomycin (FSM), fosmidomycin plus geranylgeraniol (GG-ol), diminazene aceturate (DA), diminazene aceturate plus geranylgeraniol, and ethanol (control). Negative control without any treatment was also included. The parasitemias were determined by Giemsa staining every 24 h. PPE, percent parasitized erythrocytes Efficacy of fosmidomycin on the growth of B. orientalis. In vitro cultured B. orientalis were treated separately with fosmidomycin (FSM), fosmidomycin plus geranylgeraniol (GG-ol), diminazene aceturate (DA), and diminazene aceturate plus geranylgeraniol. The growth of parasites was evaluated every 24 h for each treatment. 0.1% ethanol was used as the control. *P < 0.05, **P < 0.01, ***P < 0.001 Plasmodium falciparum was reported to utilize the non-mevalonate isoprenoid biosynthesis in the apicoplast which is essential to the parasites [8, 20, 21]. Our previous work demonstrated that B. orientalis contains an apicoplast with a 34 kpb circular genome [22], but whether the isoprenoid biosynthesis pathway exists in this parasite remains unknown. In this study, the inhibitory effect of fosmidomycin and the rescue effect of geranylgeraniol on B. orientalis indicated the presence of the substrate of this pathway, further suggesting that the MEP pathway is functional and required for the intraerythrocytic growth of B. orientalis merozoites, which is similar to that of B. bovis and P. falciparum [15, 21]. The effectiveness of fosmidomycin may be attributed to the presence of a new permeability pathway of erythrocytes, which allows the transport of fosmidomycin across the cell membrane to effectively inhibit the growth of apicomplexan parasites including Plasmodium and Babesia which reside within erythrocytes [19, 23]. The MEP pathway was also reported in Theileria parva, but fosmidomycin showed no inhibitory effect even at a high concentration of 400 μM [24].

Conclusions

In the present study, we cloned and sequenced the seven enzyme genes of the MEP pathway in B. orientalis. The native proteins of BoDXS and BoDXR were also identified, which demonstrated that the parasite contains the initial enzyme and the rate-limited enzyme of the MEP pathway. Additionally, the growth of B. orientalis could be inhibited by fosmidomycin while the effects of fosmidomycin could be reversed by medium supplemented with geranylgeraniol. These results indicated the existence of the isoprenoid biosynthesis pathway in B. orientalis, which could be a potential drug target for screening anti-babesiosis drugs. Further research should focus on the biological function of the MEP pathway in B. orientalis and the screening of new drugs using the E. coli model due to its identical isoprenoid biosynthesis pathway with apicomplexan parasites and easiness in manipulation.
  24 in total

1.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

2.  Babesia bovis: a comprehensive phylogenetic analysis of plastid-encoded genes supports green algal origin of apicoplasts.

Authors:  Audrey O T Lau; Terry F McElwain; Kelly A Brayton; Donald P Knowles; Eric H Roalson
Journal:  Exp Parasitol       Date:  2009-07-29       Impact factor: 2.011

3.  Isoprenoid metabolism in apicomplexan parasites.

Authors:  Leah Imlay; Audrey R Odom
Journal:  Curr Clin Microbiol Rep       Date:  2014-12-01

4.  Isoprenoid biosynthesis in bacteria: a novel pathway for the early steps leading to isopentenyl diphosphate.

Authors:  M Rohmer; M Knani; P Simonin; B Sutter; H Sahm
Journal:  Biochem J       Date:  1993-10-15       Impact factor: 3.857

5.  Loop-mediated isothermal amplification (LAMP) detection of Babesia orientalis in water buffalo (Bubalus babalis, Linnaeus, 1758) in China.

Authors:  Lan He; Yan-Qin Zhou; Marinda C Oosthuizen; Jun-Long Zhao
Journal:  Vet Parasitol       Date:  2009-07-04       Impact factor: 2.738

6.  Functional genetic analysis of the Plasmodium falciparum deoxyxylulose 5-phosphate reductoisomerase gene.

Authors:  Audrey R Odom; Wesley C Van Voorhis
Journal:  Mol Biochem Parasitol       Date:  2009-12-16       Impact factor: 1.759

7.  A 1-deoxy-D-xylulose 5-phosphate reductoisomerase catalyzing the formation of 2-C-methyl-D-erythritol 4-phosphate in an alternative nonmevalonate pathway for terpenoid biosynthesis.

Authors:  S Takahashi; T Kuzuyama; H Watanabe; H Seto
Journal:  Proc Natl Acad Sci U S A       Date:  1998-08-18       Impact factor: 11.205

8.  Identification of lethal mutations in Escherichia coli genes encoding enzymes of the methylerythritol phosphate pathway.

Authors:  Susanna Sauret-Güeto; Ana Ramos-Valdivia; Ester Ibáñez; Albert Boronat; Manuel Rodríguez-Concepción
Journal:  Biochem Biophys Res Commun       Date:  2003-07-25       Impact factor: 3.575

9.  Characterization of acyl carrier protein and LytB in Babesia bovis apicoplast.

Authors:  Marina C Caballero; Monica J Pedroni; Guy H Palmer; Carlos E Suarez; Christine Davitt; Audrey O T Lau
Journal:  Mol Biochem Parasitol       Date:  2011-10-25       Impact factor: 1.759

10.  Sequencing of the smallest Apicomplexan genome from the human pathogen Babesia microti.

Authors:  Emmanuel Cornillot; Kamel Hadj-Kaddour; Amina Dassouli; Benjamin Noel; Vincent Ranwez; Benoît Vacherie; Yoann Augagneur; Virginie Brès; Aurelie Duclos; Sylvie Randazzo; Bernard Carcy; Françoise Debierre-Grockiego; Stéphane Delbecq; Karina Moubri-Ménage; Hosam Shams-Eldin; Sahar Usmani-Brown; Frédéric Bringaud; Patrick Wincker; Christian P Vivarès; Ralph T Schwarz; Theo P Schetters; Peter J Krause; André Gorenflot; Vincent Berry; Valérie Barbe; Choukri Ben Mamoun
Journal:  Nucleic Acids Res       Date:  2012-07-24       Impact factor: 16.971

View more
  5 in total

1.  Construction and Use of Transposon MycoTetOP 2 for Isolation of Conditional Mycobacteria Mutants.

Authors:  Sarah D Riggs-Shute; Joseph O Falkinham; Zhaomin Yang
Journal:  Front Microbiol       Date:  2020-01-21       Impact factor: 5.640

2.  zzm321990 N-Glycosylation in Piroplasmids: Diversity within Simplicity.

Authors:  Monica Florin-Christensen; Anabel E Rodriguez; Carlos E Suárez; Massaro W Ueti; Fernando O Delgado; Ignacio Echaide; Leonhard Schnittger
Journal:  Pathogens       Date:  2021-01-08

3.  YdfD, a Lysis Protein of the Qin Prophage, Is a Specific Inhibitor of the IspG-Catalyzed Step in the MEP Pathway of Escherichia coli.

Authors:  Zhifang Lu; Biying Wang; Zhiyu Qiu; Ruiling Zhang; Jimin Zheng; Zongchao Jia
Journal:  Int J Mol Sci       Date:  2022-01-29       Impact factor: 5.923

4.  Erythrocyte Adhesion of Merozoite Surface Antigen 2c1 Expressed During Extracellular Stages of Babesia orientalis.

Authors:  Zheng Nie; Yangsiqi Ao; Sen Wang; Xiang Shu; Muxiao Li; Xueyan Zhan; Long Yu; Xiaomeng An; Yali Sun; Jiaying Guo; Yangnan Zhao; Lan He; Junlong Zhao
Journal:  Front Immunol       Date:  2021-05-17       Impact factor: 7.561

5.  Inhibitory Effects of Fosmidomycin Against Babesia microti in vitro.

Authors:  Sen Wang; Muxiao Li; Xiaoying Luo; Long Yu; Zheng Nie; Qin Liu; Xiaomeng An; Yangsiqi Ao; Qin Liu; Jiaxu Chen; Yu Tian; Junlong Zhao; Lan He
Journal:  Front Cell Dev Biol       Date:  2020-04-28
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.