Literature DB >> 30056367

Expression Analysis of Platinum Sensitive and Resistant Epithelial Ovarian Cancer Patient Samples Reveals New Candidates for Targeted Therapies.

K Veskimäe1, M Scaravilli2, W Niininen2, H Karvonen2, S Jaatinen2, M Nykter2, T Visakorpi3, J Mäenpää4, D Ungureanu2, S Staff5.   

Abstract

Ovarian cancer has the highest mortality rate of all gynecologic malignancies. Identification of new biomarkers is highly needed due to its late diagnosis and high recurrence rate. The objective of this study was to identify mechanisms of therapy resistance and potential biomarkers by analyzing mRNA and protein expression from samples derived from patients with platinum-sensitive and -resistant ovarian cancer (total cohort n = 53). The data revealed new candidates for targeted therapies, such as GREB1 and ROR2. We showed that the development of platinum resistance correlated with upregulation of ROR2, whereas GREB1 was downregulated. Moreover, we demonstrated that high levels of ROR2 in platinum-resistant samples were associated with upregulation of Wnt5a, STAT3 and NF-kB levels, suggesting that a crosstalk between the non-canonical Wnt5a-ROR2 and STAT3/NF-kB signaling pathways. Upregulation of ROR2, Wnt5a, STAT3 and NF-kB was further detected in a platinum-resistant cell-line model. The results of the present study provided insight into molecular mechanisms associated with platinum resistance that could be further investigated to improve treatment strategies in this clinically challenging gynecological cancer.
Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Entities:  

Year:  2018        PMID: 30056367      PMCID: PMC6079561          DOI: 10.1016/j.tranon.2018.07.010

Source DB:  PubMed          Journal:  Transl Oncol        ISSN: 1936-5233            Impact factor:   4.243


Introduction

Epithelial ovarian cancer (EOC) accounts for the majority of mortality from gynecological cancers, with diagnosis often at a late stage. Currently, the golden standard of treatment is primary debulking surgery (PDS) followed by platinum-based chemotherapy [1]. Although most patients initially respond to chemotherapy, cancer cells will eventually develop resistance leading to relapse [2]. Despite intensive efforts to improve targeted therapy in EOC, the five-year survival rate is still only 30% for advanced disease [3]. Therefore, increased knowledge about mechanisms of platinum resistance in EOC treatment is needed in search for cure. Genetically complex and unstable high-grade serous ovarian cancer subtype (HGSC), accounting for approximately 50–70% of EOC, represents the most aggressive histological subtype [4]. A large-scale integrated genomic data analysis for HGSC identified TP53 mutations in almost 96% of tumors. Recurrent somatic mutations were found in nine other genes including NF1, BRCA1, BRCA2, RB1 and CDK12, as well as DNA copy number aberrations and promoter methylation events, indicating biological and molecular heterogeneity that should be considered when developing novel therapeutic strategies [5]. While only 10%–15% of ovarian cancer patients carry BRCA1 or BRCA2 mutations in their germline, ∼50% of ovarian cancers exhibit a defect in the homologous recombination (HR) repair of DNA [6]. PARP-1 enzyme became an attractive target for chemotherapeutics for its crucial function in single-strand breaks (SSBs) DNA repair mechanism through base excision repair (BER) pathway [7]. The concept of synthetic lethality has been used in genetic studies to determine functional interactions and compensation among genes for decades and has also been exploited in the development of PARP (Poly (ADP-ribose) polymerase) inhibitors [8]. The responsiveness to platinum and PARP inhibitors associates with so called BRCAness profile showing independent prognostic value [9], [10]. The chemotherapy resistance can arise due to multiple mechanisms, such as drug target alteration, re-activation or amplification of the oncogenic pathway, activation of parallel pathways, increased DNA damage tolerance/repair, and deregulation of growth factor receptors among others [11]. Deregulation of apoptosis and altered phosphorylation (intracellular signaling), as well as metabolic pathways represent the two main biological processes responsible for oncogene-mediated drug resistance in ovarian cancer [12]. In this context, activation of PI3K/AKT cell survival pathway plays a pivotal role with NF-kB and STAT3 as the main mediations of these intracellular events. On the other hand, tumor suppressor genes such as BRCA1, BRCA2, MLH1 and p21 contribute to ovarian cancer drug resistance via alterations in the DNA damage and repair mechanisms, whereas RASSF1, TP53 and TP73 impair the apoptotic machinery for the same outcome [13]. Epithelial-to-mesenchymal transition (EMT) has also been implicated in HGSC invasiveness and chemoresistance, and in vitro studies using ovarian cancer cell lines have shown that more aggressive, mesenchymal-type cells are more resistant to cisplatin treatment [14]. An important signaling cascade involved in EMT is the Wnt signaling, with increasing evidence suggesting that β-catenin-independent pathway via Wnt5a/ROR1/ROR2 has a critical role in EMT and chemoresistance [15], [16], [17], [18]. Consequently, therapies targeting these pathways may offer means to overcome drug resistance. Active and also productive research in the field of cancer therapy has led to an improved understanding of the molecular mechanisms, providing insight into the development of cancer. This new data has led to the development of new treatment options for cancer patients, including targeted therapies and associated biomarker tests that can select which patients are most likely to respond [19]. The aim of this study was to identify candidate genes and their molecular pathways involved in the pathogenesis of ovarian cancer associating with platinum resistance. Overcoming the paucity of obtaining large collection of tumor samples available for molecular profiling, we investigated differences in mRNA and protein expression between ovarian cancer samples derived from two clinically and molecularly distinct patient cohorts namely high PARP/platinum-sensitive and low PARP/platinum-resistant HGSC cohorts. This comparison aimed at distinction of two cohorts with extremely different clinical behavior. Finally, this analysis led to identification of GREB1 and ROR2 that showed significant differential expression profile between the two groups. Our data suggest new predictive biomarkers for ovarian cancer drug resistance development warranting further investigations.

Materials and Methods

Study Cohort and Tissue Samples

The study was carried out at the University of Tampere and Tampere University Hospital (TAUH), Tampere, Finland. The study protocol was approved by the Ethics Committee of TAUH (identification code ETL-R11137). The microarray study cohort consisted of 12 HGSC patients who participated in a prospective study addressing PARP enzyme activity in fresh ovarian cancer tumor samples [20]. The selection of this patient subcohort was based on PARP values (high PARP/low PARP, cut off 203 pg/ml, which corresponded to the median value of PARP) and platinum sensitivity/resistance (treatment response), with no differences in respect of age and FIGO (International Federation of Gynecology). Platinum sensitivity was defined as no recurrence within 12 months after the completion of first-line platinum-based chemotherapy. Patient characteristics are presented in Table 1.
Table 1

Characteristics of the Study Patients in the Microarray Cohort (n = 12)

CharacteristicPlatinum Sensitive* n (%)Platinum Resistant* n (%)
All66
PDS52
NACT14
PARP§ low06
PARP§ high60
Age
 mean (SD)6562
 median (range)63 (46–78)62 (55–79)
 Grade 36 (100%)6 (100%)
Stage#
 FIGO st I00
 FIGO st II00
 FIGO st III and IV66
Histology
 serous6 (100%)6 (100%)
 PFS** (months)283.5

Sensitivity defined as relapse or event-free interval> 12 months after completion of platinum based 1st line therapy.

PDS - primary debulking surgery.

NACT - neoadjuvant therapy.

PARP - PARP activity in fresh frozen tumor tissue was assessed by an enzymatic chemiluminescense assay in a previous study [20]; the cut-off level for high PARP activity was set to 203 pg/ml corresponding to median value.

Grade – Grade 3 represents high grade tumors.

FIGO - International Federation of Gynecology.

PFS - progression free survival.

Characteristics of the Study Patients in the Microarray Cohort (n = 12) Sensitivity defined as relapse or event-free interval> 12 months after completion of platinum based 1st line therapy. PDS - primary debulking surgery. NACT - neoadjuvant therapy. PARP - PARP activity in fresh frozen tumor tissue was assessed by an enzymatic chemiluminescense assay in a previous study [20]; the cut-off level for high PARP activity was set to 203 pg/ml corresponding to median value. Grade – Grade 3 represents high grade tumors. FIGO - International Federation of Gynecology. PFS - progression free survival. The validation cohort of the microarray data consisted of all the patients (n = 53) that participated in the previous prospective study [20]. The median follow-up time of patients was 31 months. The validation cohort is described in Table 2.
Table 2

Characteristics of the Study Patients in the Validation Cohort (n = 53)

Characteristic
Patients in study, n53
Age at surgery, yrs. (SD)66 (9.3)
BMI, mean (SD)26.8 (6.2)
Median follow-up, months (range)31 (2–50)
Ca 125 level (kU/L) before treatment, median (range)523 (30–4728)
FIGO* Stage, n (%)
 Stage 12 (3,7%)
 Stage 23 (5,6%)
 Stage 334 (64,3%)
 Stage 414 (26,4%)
Histology, n (%)
 Serous46 (86,8)
 Endometroid4 (7,6%)
Papillar2 (3,7%)
 Mucinous0 (0%)
 Carcinosarcoma0 (0%)
Transitional cell1 (1,9%)
Grade, n (%)
 Grade 1 and 210 (18%)
 Grade 343 (82%)
Sensitivity to platinum therapy, n (%)
 Sensitive25 (47,2%)
 Resistant15 (28,3%)
 Partial sensitive13 (24,5%)
Neoadjuvant therapy, n (%)19 (36%)
Recurrence36 (68%)
Death22 (42%)

FIGO = International Federation of Gynecology.

Grade – Grade 3 represents high grade tumors, Grade 1 and 2 low grade tumors.

Sensitive: Recurrence >12 months after completion of platinum-based 1st line therapy; Resistant: Recurrence ≤6 months after completion of platinum-based 1st line therapy; Partially sensitive: Recurrence 6–12 months after completion of platinum-based 1st line therapy.

Characteristics of the Study Patients in the Validation Cohort (n = 53) FIGO = International Federation of Gynecology. Grade – Grade 3 represents high grade tumors, Grade 1 and 2 low grade tumors. Sensitive: Recurrence >12 months after completion of platinum-based 1st line therapy; Resistant: Recurrence ≤6 months after completion of platinum-based 1st line therapy; Partially sensitive: Recurrence 6–12 months after completion of platinum-based 1st line therapy. For further investigation of ROR2 in EOC, a retrospective subcohort was chosen from the study cohorts described above consisting of a subgroup of patients who had not received NACT (neoadjuvant chemotherapy) and were divided in two categories based on treatment response, i.e. either platinum-sensitive or platinum-resistant (Table 3).
Table 3

Characteristics of the study patients in the ROR investigation subcohort (n = 30)

Characteristic
Patients in study, n30
Age at surgery, yrs mean (SD)66 (9.3)
Median follow-up, months (range)31 (2–50)
FIGO* Stage, n (%)
 Stage 12 (6,7%)
 Stage 24 (14%)
 Stage 317 (56%)
 Stage 47(23,3%)
Histology, n (%)
 Serous22(73,3%)
 Endometroid2 (6,7%)
Papillar2 (6,7%)
 Mucinous2 (6,7%)
 Carcinosarcoma1 (3,3%)
Transitional cell1 (3,3%)
Grade, n (%)
 Grade 1 and 28 (26,7%)
 Grade 322 (73,3%)
Response to platinum therapy, n (%)
 Sensitive20 (66,7%)
 Resistant10 (33,3%)
Recurrence20 (66,7%)
Death9 (30%)

FIGO = International Federation of Gynecology.

Grade – Grade 3 represents high grade tumors, Grade 1 and 2 low grade tumors.

Sensitivity defined as relapse or event-free follow up time> 12 months after completion of platinum based 1st line therapy.

Characteristics of the study patients in the ROR investigation subcohort (n = 30) FIGO = International Federation of Gynecology. Grade – Grade 3 represents high grade tumors, Grade 1 and 2 low grade tumors. Sensitivity defined as relapse or event-free follow up time> 12 months after completion of platinum based 1st line therapy. The tumor tissue samples were collected at surgery, two samples approximately 0.5 cm were chosen at the operation room from macroscopically visible tumor and were snap-frozen with liquid nitrogen and stored in −70 °C. The findings from the corresponding archival surgical tumor specimens were assessed by experienced pathologists as part of routine diagnostics at the Department of Pathology at TAUH.

mRNA Microarray

Total RNA from ovarian cancer fresh frozen samples was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's protocol. The quality and integrity of the RNA was assessed using Fragment Analyzer parallel capillary electrophoresis (Advanced Analytical Technologies, Ankeny, IA, USA). The RNA was subsequently labeled and hybridized using the Agilent gene expression microarray kit (Agilent Technologies, Santa Clara, CA, USA), according to the manufacturer's instruction. Briefly, the RNA from the clinical samples was labeled with Cy3 fluorochrome and subsequently co-hybridized with Cy5 labeled Xpress Ref TM Human Universal Reference Total RNA (SuperArray Bio-science Corporation) as a control. The hybridization was carried out for 21 hours on Agilent 4X44K human gene expression array slides. The slides were subsequently scanned on an Agilent C scanner and raw data were extracted using the Agilent Feature Extraction software ver. 11.0.1.1 and quantile normalized. A fold-change cutoff of 2 was used to determine differential mRNA expression as well as q-value and signal intensity.

qRT-PCR

Putatively differentially expressed genes (ROR2, CAST, ATP6V1D, GUCY1A3, TMOD1, MYCN, DLK1, PLEKHG4B, GREB1, B4GALNT4, SLC35F3, PTCH2, TNNC1, BNC1) were selected from the array results based on fold change, q-value, signal intensity and literature data and were validated by quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA from ovarian cancer fresh frozen tumor samples were extracted with TRIzol as described above and were reverse transcribed using random hexamere primers and MultiScribe reverse transcriptase (Thermo Fischer Scientific, Waltham, MA, USA). Quantitative Real Time PCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fischer Scientific) on a BioRad CFX96 ™ Real-Time PCR Detection System (BioRad Laboratories, Hercules, CA, USA). Each sample was run in duplicate and expression values were normalized against the TATA-binding protein (TBP). The primer sequences for the two validated genes are as follows:

Western blotting

Frozen tumor pieces were thawed, washed 2X with cold PBS and pestered to lyse in lysis buffer (50 mM Tris–HCl pH 7.5, 10% glycerol, 150 mM NaCl, 1 mM EDTA, 1% Triton-x-100, 50 mM NaF) supplemented with protease and phosphatase inhibitor cocktails (Bimake, Houston, TX, USA). Lysates were mixed with 4X Laemmli loading buffer and subjected to SDS-PAGE gel electrophoresis and Western blotting. The primary antibodies used were as following: pAkt S473 (#4060), pMEK1/2 S217/221 (#9121), NF-κB p65 (#6956), pPI3K p85 Y458/p55 Y199 (#4228), PI3K p85α (#13666), Rac-1 (#4651), pSTAT3 Y705 (#9145), STAT3 (#9139), Wnt5a/b (#2530) (Cell Signaling Technology, Danvers, MA, USA); Akt (#sc-5298), Bcl-2 (#sc-7382), MEK1/2 (#sc-6250), β-tubulin (#sc-166,729) (Santa Cruz, Dallas, TX, USA); ROR1 6D4 (Dr. Riddel lab, ref. Balakrishana et al. 2016); ROR2 (#565550, BD Biosciences, San Jose, CA, USA). Secondary antibodies: IRDye® 800CW Donkey anti-Mouse IgG, or IRDye® 680RD Donkey anti-Rabbit IgG (LI-COR, Lincoln, NE, USA). Blots were scanned and quantified using Odyssey CLx and Image Studio software (LI-COR). Protein quantification was normalized to β-tubulin expression level for each sample.

Cell Culture

A2780 and A2780cis cells were purchased from Merck & Company Inc. (Kenilworth, NJ, USA) and cultured according to manufacturer's recommendations. The A2780 line was maintained in medium containing 1 μM cisplatin (Selleckchem, Munich, Germany). The cisplatin EC50 response of A2780 and A2780cis cells was validated by incubating cells with increasing concentration of cisplatin for 3 days and cell viability was determined using CellTiterGlo (CTG) Assay (Promega, USA) according to manufacturer's instructions.

qRT-PCR of the Ovarian Cancer Cell Lines

RNA was collected from A2780 and A2780cis using TRI Reagent® (Molecular Research Center Inc. Cincinnati, OH, USA) according to the manufacturer's protocol. qRT-PCR was performed as described for the ovarian cancer clinical samples. Each cell line was run in 4 replicates and the expression of ROR2 and GREB1 was normalized against TBP.

Statistical Analysis

The statistical analysis of mRNA microarray data was implemented in R using packages limma and preprocessCore of Bioconductor project [21], [22], [23]. Data was quantile normalized and probe sets were summarized by choosing the probes with the highest average expression [22]. Using limma approach, differential expression was identified between patients who had low PARP value and were platinum resistant, and patients who had high PARP value and were platinum sensitive [23]. P-values were obtained by the empirical Bayes moderated t-test. A fold-change cutoff of 2 was used to determine differential mRNA expression. The results were interpreted by principal component analysis [24] and hierarchical clustering. qRT-PCR data were analyzed using the Student's t-test and Mann–Whitney U test where appropriate. The Kaplan–Meier regression analyses were used to estimate the survival rates from the date of surgery (primary debulked patients) or from the date of the first dose of neoadjuvant therapy until the date of the event of interest. For progression-free survival (PFS), the event of interest was a recurrence or death, whichever occurred first. Patients alive at the last follow-up without a recurrence were censored at the last follow-up date. Statistical analysis was performed using GraphPad Prism 6 software for Windows (GraphPad Software Inc., La Jolla, CA, USA). A p-value less than 0.05 was considered significant. Oncomine (https://www.oncomine.org/resource/login.html) and Kaplan–Meier plotter (http://kmplot.com/analysis/index.php?p=service&cancer=ovar) databases were searched for gene expression and survival data.

Results

Microarray Analysis of HGSC Patient Samples

In order to identify differentially expressed genes between ovarian cancer samples with platinum-sensitivity with high PARP levels and samples with platinum resistance with low PARP levels (n = 12), gene expression microarray was performed on total RNA isolated from the freshly frozen tumor samples. The analysis of gene expression showed a total of 3001 differentially expressed genes between the two comparison groups when a log fold change cutoff 2 was implemented. In this comparison, 1463 genes were downregulated and 1538 genes were upregulated. 50 most upregulated and 50 most downregulated genes are summarized in Table 4, Table 5, respectively. The comparison of patient groups according to PARP levels and treatment responses are shown in Figure 1, a-b.
Table 4

The 50 Most Upregulated mRNAs in High PARP and Platinum Sensitive OC Patient Samples in Comparison to low PARP and Platinum Resistant Samples.

Gene nameGene descriptionlog2-fold changep-valueq-value
COLEC11collectin subfamily member 113.68E+ 001.29E-020.2588936
MYCNMYCN proto-oncogene. bHLH transcription factor3.61E+002.74E-040.1050305
ESM1endothelial cell specific molecule 13.18E+ 001.64E-040.1028588
IGF1Rinsulin like growth factor 1 receptor3.08E+ 005.29E-030.211962
TNNC1troponin C1. slow skeletal and cardiac type3.04E+001.25E-050.0472319
LGSNlengsin. Lens protein with glutamine synthetase domain3.02E+ 001.25E-020.2588936
LOC100134423uncharacterized LOC1001344232.97E+ 002.71E-040.1050305
DLK1delta like non-canonical Notch ligand 12.89E+004.17E-030.2013983
CRYGCcrystallin gamma C2.86E+ 002.37E-030.1822358
A_33_P3286709NA2.82E+ 009.15E-050.0864965
PLEKHG4Bpleckstrin homology and RhoGEF domain containing G4B2.82E+001.17E-030.1525447
TSPAN8tetraspanin 82.78E+ 002.99E-020.3064189
ENPP6ectonucleotide pyrophosphatase/phosphodiesterase 62.73E+ 001.20E-020.2563874
FLJ30901uncharacterized protein FLJ309012.60E+ 003.26E-040.1050305
PROM1prominin 12.59E+ 003.02E-020.3079072
COL22A1collagen type XXII alpha 1 chain2.58E+ 002.64E-030.1844765
KIAA1324KIAA13242.58E+ 005.48E-040.1261184
PTCH2patched 22.57E+001.93E-050.0472319
SLC35F3solute carrier family 35 member F32.54E+003.87E-050.0596903
GABRG3gamma-aminobutyric acid type A receptor gamma3 subunit2.51E+ 004.50E-050.0628517
LOC613266uncharacterized LOC6132662.50E+ 004.89E-020.3485897
LCE1Elate cornified envelope 1E2.49E+ 002.28E-040.1050305
B4GALNT4beta-1.4-N-acetyl-galactosaminyltransferase 42.49E+001.24E-050.0472319
STC2stanniocalcin 22.48E+ 002.86E-040.1050305
FOXL2NBFOXL2 neighbor2.48E+ 001.04E-010.4447586
AK124496NA2.47E+ 002.78E-020.3020977
CU677518NA2.47E+ 002.82E-060.0275612
NM_130777NA2.45E+ 001.10E-020.2525629
NR_102701NA2.43E+ 002.11E-030.1762016
NSG1neuronal vesicle trafficking associated 12.43E+ 001.05E-030.1525447
STARsteroidogenic acute regulatory protein2.41E+ 005.08E-030.2110634
MCTS2Pmalignant T-cell amplified sequence 2. pseudogene2.40E+ 005.43E-030.2134259
TRABD2ATraB domain containing 2A2.36E+ 004.89E-030.2078187
DEPTORDEP domain containing MTOR interacting protein2.35E+ 004.70E-040.125416
CLEC4GP1C-type lectin domain family 4 member G pseudogene 12.35E+ 004.56E-030.2021535
LINC01405long intergenic non-protein coding RNA 14052.33E+ 006.95E-040.1391319
COL2A1collagen type II alpha 1 chain2.32E+ 001.82E-020.2816697
HS6ST2heparan sulfate 6-O-sulfotransferase 22.31E+ 002.15E-020.2871745
PRAMEpreferentially expressed antigen in melanoma2.30E+ 004.32E-050.0628517
LINC02398long intergenic non-protein coding RNA 23982.29E+ 001.08E-050.0472319
GJB7gap junction protein beta 72.29E+ 003.18E-020.3122712
PLCXD3phosphatidylinositol specific phospholipase C X domain containing 32.28E+ 006.03E-020.3707384
ERVI-1endogenous retrovirus group I member 12.27E+ 001.28E-020.2588936
ZNF556zinc finger protein 5562.27E+ 001.46E-060.0213888
NTSneurotensin2.26E+ 006.56E-020.3828556
BU963192NA2.25E+ 007.17E-050.0751488
GMNCgeminin coiled-coil domain containing2.24E+ 001.52E-020.2689731
A_33_P3274001NA2.24E+ 009.36E-050.0864965
CRYGDcrystallin gamma D2.24E+ 002.58E-020.2964626
GREB1growth regulation by estrogen in breast cancer 12.22E+001.22E-030.1542519

mRNAs selected for further validation are shown in bold.

Table 5

The 50 Most Downregulated mRNAs in High PARP and Platinum Sensitive OC Patient Samples in Comparison to Low PARP and Platinum Resistant Samples

Gene NameGene DescriptionLog2-Fold Changep-Valueq-Value
EFEMP1EGF containing fibulin extracellular matrix protein 1−3.85E+ 001.50E-030.1587368
FAPfibroblast activation protein alpha−3.66E+ 009.07E-040.1525447
TMOD1tropomodulin 1−3.41E+002.92E-080.0008577
BNC1basonuclin 1−3.36E+002.74E-040.1050305
ENST00000453673NA−3.22E+ 002.22E-020.2877726
ENST00000411475NA−3.18E+ 002.30E-020.2898232
SCRG1stimulator of chondrogenesis 1−3.18E+ 001.64E-030.1627023
PTGFRprostaglandin F receptor−3.04E+ 001.05E-030.1525447
POSTNperiostin−3.01E+ 001.10E-020.2525629
ENST00000390237NA−2.97E+ 001.54E-020.2695379
BF175071NA−2.92E+ 005.12E-020.3538495
GUCY1A3guanylate cyclase 1 soluble subunit alpha−2.89E+005.68E-050.0723946
ENST00000390628NA−2.87E+ 004.44E-030.2021325
CXCL13C-X-C motif chemokine ligand 13−2.87E+ 001.02E-020.2487313
ACKR4atypical chemokine receptor 4−2.86E+ 009.73E-050.0864965
IGLL5immunoglobulin lambda like polypeptide 5−2.86E+ 003.46E-020.318167
AREGamphiregulin−2.83E+ 001.43E-020.2670241
A_33_P3251412NA−2.81E+ 001.46E-020.2682963
FYB1FYN binding protein 1−2.79E+ 002.51E-030.1843078
CD38CD38 molecule−2.78E+ 001.54E-030.1587368
ENST00000468879NA−2.77E+ 004.36E-020.3380632
ENST00000390252NA−2.73E+ 001.49E-020.2682963
JCHAINjoining chain of multimeric IgA and IgM−2.70E+ 006.61E-030.2195342
ENST00000390547NA−2.69E+ 005.85E-030.2163421
MEDAGmesenteric estrogen dependent adipogenesis−2.69E+ 004.49E-020.3403785
CNR1cannabinoid receptor 1−2.68E+ 009.85E-030.2471112
PRRX1paired related homeobox 1−2.68E+ 007.45E-040.1427284
NR4A3nuclear receptor subfamily 4 group A member 3−2.67E+ 002.00E-020.2850432
CH25Hcholesterol 25-hydroxylase−2.65E+ 002.21E-030.1762175
AB363267NA−2.65E+ 004.23E-020.3347815
ENST00000426099NA−2.63E+ 004.11E-020.331398
CCL18C-C motif chemokine ligand 18−2.57E+ 001.16E-040.0898927
THBS2thrombospondin 2−2.57E+ 003.91E-020.327707
ENST00000410078NA−2.56E+ 005.30E-020.3580372
BCHEbutyrylcholinesterase−2.55E+ 001.00E-020.2471753
ATP6V1DATPase H+ transporting V1 subunit D−2.55E+001.54E-040.1028588
ENST00000390323NA−2.55E+ 002.42E-020.2937808
CCR2C-C motif chemokine receptor 2−2.54E+ 009.37E-030.24523
ENST00000479981NA−2.54E+ 009.43E-030.24523
CASTcalpastatin−2.54E+001.02E-030.1525447
ASPNasporin−2.52E+ 002.94E-020.3049408
HBBhemoglobin subunit beta−2.52E+ 002.08E-020.2862875
ENST00000390247NA−2.51E+ 002.16E-020.2871745
SULF1sulfatase 1−2.50E+ 001.80E-020.2805948
EPYCepiphycan−2.49E+ 001.28E-020.2588936
FGFBP1fibroblast growth factor binding protein 1−2.49E+ 001.03E-020.2499163
LRRC15leucine rich repeat containing 15−2.48E+ 004.14E-020.3321649
DOCK11dedicator of cytokinesis 11−2.45E+ 005.13E-040.1261184
OOEPoocyte expressed protein−2.45E+ 004.23E-030.2013983
ROR2receptor tyrosine kinase like orphan receptor 2−1.84E+002.83E-050.0506967

mRNAs selected for further validation are shown in bold.

Figure 1

a. Scatterplot showing location of samples of high PARP and platinum sensitive and low PARP and platinum resistant in patients along the first two principal components (PC1 and PC2). Platinum sensitive and high PARP level samples are represented by black and low PARP and platinum resistant samples by purple dots.

b. Unsupervised clustering of the clinical samples shows differential expression patterns in patients with high PARP levels and platinum sensitivity compared to patients with low PARP levels and platinum resistant.

The 50 Most Upregulated mRNAs in High PARP and Platinum Sensitive OC Patient Samples in Comparison to low PARP and Platinum Resistant Samples. mRNAs selected for further validation are shown in bold. The 50 Most Downregulated mRNAs in High PARP and Platinum Sensitive OC Patient Samples in Comparison to Low PARP and Platinum Resistant Samples mRNAs selected for further validation are shown in bold. a. Scatterplot showing location of samples of high PARP and platinum sensitive and low PARP and platinum resistant in patients along the first two principal components (PC1 and PC2). Platinum sensitive and high PARP level samples are represented by black and low PARP and platinum resistant samples by purple dots. b. Unsupervised clustering of the clinical samples shows differential expression patterns in patients with high PARP levels and platinum sensitivity compared to patients with low PARP levels and platinum resistant.

GREB1 and ROR2 are Significantly Differentially Expressed in Ovarian Cancer Tumor Samples Based on Platinum Sensitivity and PARP Levels

Fourteen differentially expressed mRNAs (namely: ROR2, CAST, ATP6V1D, GUCY1A3, TMOD1, MYCN, DLK1, PLEKHG4B, GREB1, B4GALNT4, SLC35F3, PTCH2, TNNC1, BNC1) from the microarray analysis were selected for validation by qRT-PCR in the cohort of 53 ovarian cancer patients, based on fold change, q-value, signal intensity and previous literature (Table 2). Two genes, namely ROR2 and GREB1, were significantly differentially expressed in high PARP/platinum-sensitive vs. low PARP/platinum-resistant groups (P = .02 and 0.002, respectively) (Figure 2, a-b). ROR2 was downregulated in microarray data in high PARP/platinum-sensitive tumor samples and the same result was obtained by qRT-PCR analysis in the validation cohort (n = 53). A trend towards statistically significant difference between the platinum sensitive and resistant groups regardless of PARP levels was observed (P = .058) (Figure 2a). The comparisons described above were based on treatment response as a significant clinical feature and issue of interest. In addition, previously determined PARP levels were taken into account to further investigate tumors from the BRCAness profile point of view. The platinum sensitive and high PARP level cohort is considered a group of better prognosis befitting with the BRCAness profile, whereas the platinum resistant and low PARP level a group with poorer prognosis.
Figure 2

a. Expression of ROR2 and GREB1 in platinum sensitive (n = 38) vs resistant (n = 15) samples as well as high PARP level and platinum sensitive (n = 17) vs low PARP level and platinum resistant (n = 14) samples according to qRT-PCR (P = .02 and 0.002 respectively). The graphs show mean ± SEM.

b. Kaplan–Meier analysis of progression free survival (PFS) according to median level of GREB 1 concentration (log rank P = .019). Vertical lines represent censored patients.

c. Kaplan–Meier analysis of progression free survival (PFS) according to median level of GREB 1 concentration (log-rank P = .014) from Kaplan–Meier plotter database.

a. Expression of ROR2 and GREB1 in platinum sensitive (n = 38) vs resistant (n = 15) samples as well as high PARP level and platinum sensitive (n = 17) vs low PARP level and platinum resistant (n = 14) samples according to qRT-PCR (P = .02 and 0.002 respectively). The graphs show mean ± SEM. b. Kaplan–Meier analysis of progression free survival (PFS) according to median level of GREB 1 concentration (log rank P = .019). Vertical lines represent censored patients. c. Kaplan–Meier analysis of progression free survival (PFS) according to median level of GREB 1 concentration (log-rank P = .014) from Kaplan–Meier plotter database. On the other hand, GREB1 was upregulated in microarray data in high PARP/platinum-sensitive tumor samples, and this result was validated by qRT-PCR (Figure 2b). Furthermore, GREB1 also showed a trend of overexpression in platinum sensitive samples, regardless of PARP level (P = .26).

GREB1 Expression Defines Platinum Sensitivity and Correlates with Longer PFS in Ovarian Cancer

Furthermore, we investigated whether GREB1 expression affects PFS in ovarian cancer patients (n = 53). High GREB1 expression was significantly associated with longer PFS as shown in Figure 2c (P = .019 in log-rank test). In Kaplan–Meier database search, which included 1465 ovarian cancer patients, a similar result was shown associating high GREB1 expression with better PFS (P = 0,014 in log-rank test), as shown in Figure 2d. In addition to Kaplan–Meier plotter database and Oncomine (website links are reported in statistical analysis section) were searched for the ROR2 and GREB1 genes. No similar results in expression correlation were found, however, no similar study settings were found (HGSC, treatment response comparison).

High ROR2 Expression in LowPARP/Platinum Resistant Ovarian Cancer Samples Correlated with Higher Wnt5a, STAT3 and NF-kB levels

Previous data have shown no association with ROR2 expression and relapse-free survival [25] in ovarian cancer. However, ROR2 and ROR1 expression is increased in cisplatin resistant A2780 cell line compared to parental cells ([18]), and silencing their ligand Wnt5a in serous adenocarcinoma OVCAR3 cell line had greater effect in inhibiting cell migration and invasion than silencing either ROR alone [25]. Since ROR2 was significantly upregulated in low PARP/platinum-resistant patient samples in our microarray data, we decided to investigate the expression levels of Wnt5a, ROR1 and ROR2 proteins by Western blot in a subcohort of samples described in Table 3. As shown in Figure 3a-b, higher expression levels of Wnt5a, ROR1 and ROR2 proteins were found in low PARP/platinum-resistant group compared to high PARP/platinum-sensitive group. Moreover, upregulation of downstream signaling mediators such as pSTAT3 (Y705) and NF-kB was also observed in tumor lysates from low PARP/platinum resistant group. Noteworthy, patient samples with high levels of ROR1 and ROR2 from low PARP/platinum-resistant group showed higher pSTAT3 (Y705) levels (Figure 3a), indicating that STAT3 could mediate signaling downstream ROR1 and ROR2. Database search (Oncomine, Kaplan–Meier plotter; website links are reported in statistical analysis section) revealed no additional information regarding ROR in therapy response and ovarian cancer setting.
Figure 3

Wnt5a/ROR2 expression is increased in lysates from platinum resistant tumors. A. Western blot analysis of lysates from platinum resistant vs. platinum sensitive patient samples with the indicated primary antibodies. B. Quantification of protein expression for Wnt5a, ROR2, STAT3 and NF-kB based on β-tubulin levels. Horizontal lines represent the average and errors bars are SEM (standard error of mean). After normalization, samples were quantified based on the highest expression level of all samples.

Wnt5a/ROR2 expression is increased in lysates from platinum resistant tumors. A. Western blot analysis of lysates from platinum resistant vs. platinum sensitive patient samples with the indicated primary antibodies. B. Quantification of protein expression for Wnt5a, ROR2, STAT3 and NF-kB based on β-tubulin levels. Horizontal lines represent the average and errors bars are SEM (standard error of mean). After normalization, samples were quantified based on the highest expression level of all samples.

ROR2 and GREB1 Show Differential Expression in Cisplatin Resistant Ovarian Cancer Cell Line Model

The human epithelial ovarian cancer cell line A2780 and its cisplatin resistant model A2780cis were selected to investigate the expression levels of ROR2 and GREB1. We confirmed the chemoresistant phenotype of A2780cis cells compared to A2780 parental cells by CTG assay and found significant increase of EC50 to cisplatin treatment for A2780cis cells (Figure 4a). The expression of both ROR2 and GREB1 mRNA level was investigated in A2780 and A2780cis cells (Figure 4b and c). We observed ROR2 mRNA upregulation in platinum resistant cell line A2780cis compared to platinum sensitive A2780 cells (P = .0046), as previously shown ([18]), whereas GREB1 mRNA level was downregulated in A2780cis compared to A2780 parental cells (P = .0012). Furthermore, A2780cis cells have increased protein expression levels of ROR2 and Wnt5a compared with the parental A2780 cells as shown by Western blotting of cytoplasmic cell lysates (Figure 4d). In addition, we detected higher nuclear expression levels for STAT3 and NF-kB in chemoresistant A2780cis compared to parental A2780 cells (Figure 4d). Thus, our microarray data from patient samples are validated in chemoresistant ovarian cancer cell line and investigations are ongoing to decipher the molecular mechanisms employed by ROR2 and GREB1 for their differential expression associated with cisplatin resistance.
Figure 4

a. Cisplatin sensitivity testing of A2780 and A2780cis cell lines. Cells were incubated as five replicates for 3 days with increased concentrations of cisplatin as indicated and cell-viability was measured by CTG assay. EC50 was calculated using Graph Prism software and shown as approximate values.

b. ROR2 mRNA expression in platinum sensitive and resistant cell lines A2780/A2780cis (P = .0046). The graphs show mean ± SEM.

c. GREB1 mRNA expression in platinum sensitive and resistant cell lines A2780/A2780cis (P = .0012. The graphs show mean ± SEM.

d. Protein expression levels for ROR2, Wnt5a, NF-kB and STAT3 in the cytoplasmic and nuclear cell lysates of A2780 and A2780cis cell lines. Protein quantification was done using Oddyssey Licor software and normalized against the loading control.

a. Cisplatin sensitivity testing of A2780 and A2780cis cell lines. Cells were incubated as five replicates for 3 days with increased concentrations of cisplatin as indicated and cell-viability was measured by CTG assay. EC50 was calculated using Graph Prism software and shown as approximate values. b. ROR2 mRNA expression in platinum sensitive and resistant cell lines A2780/A2780cis (P = .0046). The graphs show mean ± SEM. c. GREB1 mRNA expression in platinum sensitive and resistant cell lines A2780/A2780cis (P = .0012. The graphs show mean ± SEM. d. Protein expression levels for ROR2, Wnt5a, NF-kB and STAT3 in the cytoplasmic and nuclear cell lysates of A2780 and A2780cis cell lines. Protein quantification was done using Oddyssey Licor software and normalized against the loading control.

Discussion

Due to its poor prognosis, identification of new therapeutic approaches is highly needed in ovarian cancer. Although approximately 50% of HGSC tumors with HR defects may benefit from PARP inhibitors, beyond this, identification of other commonly deregulated pathways could provide opportunities for better therapeutic interventions. As such, our goal was to examine gene and protein expression in a HGSC tumor sample cohort defined by response to platinum therapy and the level of PARP expression. Patients were carefully stratified based on their PARP levels and platinum responsiveness as previously indicated [20] and monitored for relatively long time, up to 50 months to ensure a comprehensive analysis of their disease progression. Two functionally unrelated genes, GREB1 and ROR2 were identified in our analysis as significantly differentially expressed between high PARP/platinum-sensitive and low PARP/platinum-resistant groups. While initially sequenced from brain tissue, human GREB1 is highly expressed in normal and neoplastic ovarian tissue and in several other hormone-responsive tissues such as breast, uterine and prostate [26], [27], [28], [29]. GREB1, along with CCND1 and MYC, are common transcription targets for E2 (17β-estradiol)-mediated proliferative responses, via ESR1 (estrogen receptor one) engagement [28]. Estrogen receptor positive (ESR1+,) breast cancers usually express GREB1, whereas in ovarian cancer, its expression could be detected in both, ESR1+ or estrogen receptor negative (ESR1−) tumors. ESR1-independent expression of GREB1 may indicate the existence of other signaling pathways for estrogen-promoting growth in the absence of E2 and/or ESR1, underlining differences in E2-responsiveness between breast and ovarian cancer that play an important role in response to antiestrogenic therapies [30]. GREB1 was upregulated in all EOC tumors and was suggested to have potential biomarker role in ovarian cancer [29]. GREB1 was upregulated in our microarray data in high PARP/platinum-sensitive patients, and high GREB1 expression was associated with longer PFS, suggesting a prognostic value for GREB1 in ovarian cancer. It has been demonstrated that GREB1 knockdown inhibits proliferation of ovarian cancer cell lines and consequently, prolongs survival in an orthotopic mouse model [28]. Also, hypomethylation at specific CpG site associated with GREB1 has been associated with longer PFS in ovarian cancer in a DNA methylation study designed to investigate epigenetic modifications [31]. Interestingly, loss of GREB1 has been linked to tamoxifen resistance in breast cancer due to loss of sensitivity to endocrine agents in general, underlining its important role in endocrine resistance [32], [33]. Although endocrine therapy has overall limited efficacy in ovarian cancer patients, more research is needed to assess whether GREB1 is associated with antiestrogen sensitivity in this cancer. In view of this previous data, our results are in accordance with these findings reaffirming the understanding that GREB1 is highly expressed in high PARP/platinum-sensitive patient group that has been associated with a positive outcome befitting with the BRCAness profile [10]. Our data show for the first time that GREB1 could have prognostic value in ovarian cancer and warrants further investigation, especially associated with response to hormone-based therapy. ROR2 belongs to the ROR receptor family (ROR1 and ROR2) from the non-canonical Wnt pathway [17]. ROR1 and ROR2 form heterodimers in response to Wnt5a, which leads to RhoA/Rac1 activation and increases migration and invasion properties of cancer cells [34]. Recent studies have demonstrated that upregulation of ROR2 and its ligand Wnt5a in EOC regulates EMT and correlates with worse prognosis [35]. ROR1 and ROR2 regulate migration and invasion of ovarian cancer cells and more importantly, their expression was increased in platinum resistant A2780 ovarian cancer cell line compared to parental cells ([18]). TCGA data analysis of over 500 ovarian tumor samples identified high expression of Wnt5a and Wnt5a protein was found prevalent in ascites samples of ovarian cancer patients [36]. In our study, ROR2 gene expression was significantly upregulated in low PARP/platinum-resistant vs. high PARP/platinum-sensitive patient samples. We also found higher protein levels of ROR2, ROR1 and Wnt5a ligand in lysates of platinum-resistant tumors (Figure 3, a-b), confirming our gene expression analysis. Interestingly, higher expression levels of NF-κB and pSTAT3 (Y705) proteins were also noted in platinum-resistant tumor lysate with high ROR1 and ROR2 levels, indicating that STAT3 could be downstream mediator of ROR signaling in ovarian cancer. These results showing Wnt5a-ROR2 and STAT3/NF-kB signaling pathway in clinical ovarian tumor samples are novel findings. A direct link between ROR1 and STAT3 expression has been demonstrated previously in leukemia, showing that STAT3 promoter harbors two ROR1 binding sites [37]. Moreover, previous studies have shown that Wnt5a is involved in cancer multidrug resistance (MDR)[36]. High Wnt5a expression levels in ovarian cancer cell lines correlated with lower chemosensitivity to paclitaxel, oxaliplatin, 5-fluorouracil, epirubicin and etoposide ([38], [39]. Furthermore, upregulation of Wnt5a and ROR2 was detected in colon cancer cells resistant to butyrate, a histone deacetylase inhibitor (HDACi)[40], along with activation of AKT/PKB (protein kinase B) signaling pathway. Wnt5a orchestrates multiple signaling networks involved in chronic inflammation and carcinogenesis, and crosstalk with STAT3 and NF-κB pathways have been previously documented [41]. Thus, upregulation of Wnt5a, ROR1 and ROR2 signaling pathways could be common mechanisms in ovarian cancer chemoresistance and could serve as putative biomarkers. ROR1 targeted therapies have shown promising results in preclinical and clinical models, with anti-ROR1 monoclonal antibody cirmtuzumab being efficient not only in leukemia, but also in ovarian cancer [42], indicative of high therapeutic potential for targeting these receptors. Our mRNA expression data from patient samples were validated using a cisplatin resistant cell line model A2780cis and we found that upregulation of ROR2 at the mRNA and protein levels is associated with cisplatin resistance. Moreover, GREB1 mRNA level was downregulated in A2780cis compared to A2780 parental cells. Furthermore, we observed higher expression levels for Wnt5a, STAT3 and NF-kB proteins in chemoresistant A2780cis cells compared to parental cells, in support of our results from patient samples (Figure 3). In conclusion, we found the expression of ROR2 and GREB1 to be associated with treatment response in HGSC. The association between Wnt5a/ROR2 expression and development of platinum resistance reported herein suggests that the Wnt5a/ROR2 pathway is potentially actionable for possible modulation of chemoresistance. Because silencing ROR1 and ROR2 restores the chemosensitivity of carboplatin-resistant ovarian cancer cells [18], a combination of ROR antagonists and chemotherapeutic agents may offer a promising treatment option. Also, our findings regarding GREB1 expression in highPARP/platinum-sensitive patients should reinforce the interest in this gene for future investigations.
GREB1 fw5’ATGGGAAATTCTTACGCTGGAC
GREB1 rev5’CACTCGGCTACCACCTTCT
ROR2 fw5’GTGCGGTGGCTAAAGAATGAT
ROR2 rev5’ATTCGCAGTCGTGAACCATATT
TBP fw5’GAATATAATCCCAAGCGGTTTG
TBP rev5’ACTTCACATCACAGCTCCCC
  39 in total

1.  Epithelial-mesenchymal status renders differential responses to cisplatin in ovarian cancer.

Authors:  Q H Miow; T Z Tan; J Ye; J A Lau; T Yokomizo; J-P Thiery; S Mori
Journal:  Oncogene       Date:  2014-05-26       Impact factor: 9.867

Review 2.  Mechanism-based cancer therapy: resistance to therapy, therapy for resistance.

Authors:  P Ramos; M Bentires-Alj
Journal:  Oncogene       Date:  2014-09-29       Impact factor: 9.867

Review 3.  The WNT signaling pathway from ligand secretion to gene transcription: molecular mechanisms and pharmacological targets.

Authors:  Hoeke A Baarsma; Melanie Königshoff; Reinoud Gosens
Journal:  Pharmacol Ther       Date:  2013-01-14       Impact factor: 12.310

Review 4.  Pre-clinical Specificity and Safety of UC-961, a First-In-Class Monoclonal Antibody Targeting ROR1.

Authors:  Michael Y Choi; George F Widhopf; Christina C N Wu; Bing Cui; Fitzgerald Lao; Anil Sadarangani; Joy Cavagnaro; Charles Prussak; Dennis A Carson; Catriona Jamieson; Thomas J Kipps
Journal:  Clin Lymphoma Myeloma Leuk       Date:  2015-06

5.  Gene expression profile of BRCAness that correlates with responsiveness to chemotherapy and with outcome in patients with epithelial ovarian cancer.

Authors:  Panagiotis A Konstantinopoulos; Dimitrios Spentzos; Beth Y Karlan; Toshiyasu Taniguchi; Elena Fountzilas; Nancy Francoeur; Douglas A Levine; Stephen A Cannistra
Journal:  J Clin Oncol       Date:  2010-06-14       Impact factor: 44.544

6.  The non-canonical Wnt ligand, Wnt5a, is upregulated and associated with epithelial to mesenchymal transition in epithelial ovarian cancer.

Authors:  C E Ford; G Punnia-Moorthy; C E Henry; E Llamosas; S Nixdorf; J Olivier; R Caduff; R L Ward; V Heinzelmann-Schwarz
Journal:  Gynecol Oncol       Date:  2014-06-10       Impact factor: 5.482

Review 7.  Role of PARP inhibitors in cancer biology and therapy.

Authors:  D Davar; J H Beumer; L Hamieh; H Tawbi
Journal:  Curr Med Chem       Date:  2012       Impact factor: 4.530

Review 8.  Insight into the role of Wnt5a-induced signaling in normal and cancer cells.

Authors:  Mitsuharu Endo; Michiru Nishita; Masanori Fujii; Yasuhiro Minami
Journal:  Int Rev Cell Mol Biol       Date:  2014-11-18       Impact factor: 6.813

9.  Stat3 activates the receptor tyrosine kinase like orphan receptor-1 gene in chronic lymphocytic leukemia cells.

Authors:  Ping Li; David Harris; Zhiming Liu; Jie Liu; Michael Keating; Zeev Estrov
Journal:  PLoS One       Date:  2010-07-29       Impact factor: 3.240

10.  Gene expression patterns in ovarian carcinomas.

Authors:  Marci E Schaner; Douglas T Ross; Giuseppe Ciaravino; Therese Sorlie; Olga Troyanskaya; Maximilian Diehn; Yan C Wang; George E Duran; Thomas L Sikic; Sandra Caldeira; Hanne Skomedal; I-Ping Tu; Tina Hernandez-Boussard; Steven W Johnson; Peter J O'Dwyer; Michael J Fero; Gunnar B Kristensen; Anne-Lise Borresen-Dale; Trevor Hastie; Robert Tibshirani; Matt van de Rijn; Nelson N Teng; Teri A Longacre; David Botstein; Patrick O Brown; Branimir I Sikic
Journal:  Mol Biol Cell       Date:  2003-09-05       Impact factor: 4.138

View more
  10 in total

1.  Host Wnt5a Potentiates Microenvironmental Regulation of Ovarian Cancer Metastasis.

Authors:  Marwa Asem; Allison M Young; Carlysa Oyama; Alejandro Claure De La Zerda; Yueying Liu; Jing Yang; Tyvette S Hilliard; Jeffery Johnson; Elizabeth I Harper; Ian Guldner; Siyuan Zhang; Toni Page-Mayberry; William J Kaliney; M Sharon Stack
Journal:  Cancer Res       Date:  2020-01-13       Impact factor: 12.701

2.  Long-term progression-free survival of apatinib monotherapy for relapsed ovarian cancer: a case report and literature review.

Authors:  Di Zhang; Jiaqi Huang; Yulan Sun; Qisen Guo
Journal:  Onco Targets Ther       Date:  2019-05-15       Impact factor: 4.147

Review 3.  The WNT/ROR Pathway in Cancer: From Signaling to Therapeutic Intervention.

Authors:  Kerstin Menck; Saskia Heinrichs; Cornelia Baden; Annalen Bleckmann
Journal:  Cells       Date:  2021-01-12       Impact factor: 6.600

4.  Effects of trans-(±)-kusunokinin on chemosensitive and chemoresistant ovarian cancer cells.

Authors:  Nadeeya Mad-Adam; Thidarath Rattanaburee; Tanotnon Tanawattanasuntorn; Potchanapond Graidist
Journal:  Oncol Lett       Date:  2021-12-22       Impact factor: 2.967

5.  ROR2 increases the chemoresistance of melanoma by regulating p53 and Bcl2-family proteins via ERK hyperactivation.

Authors:  María Victoria Castro; Gastón Alexis Barbero; Paula Máscolo; Rocío Ramos; María Josefina Quezada; Pablo Lopez-Bergami
Journal:  Cell Mol Biol Lett       Date:  2022-03-08       Impact factor: 5.787

Review 6.  The Ror-Family Receptors in Development, Tissue Regeneration and Age-Related Disease.

Authors:  Mitsuharu Endo; Koki Kamizaki; Yasuhiro Minami
Journal:  Front Cell Dev Biol       Date:  2022-04-13

7.  Multiomics characterization implicates PTK7 in ovarian cancer EMT and cell plasticity and offers strategies for therapeutic intervention.

Authors:  Juuli Raivola; Alice Dini; Hanna Karvonen; Emilia Piki; Kari Salokas; Wilhelmiina Niininen; Laura Kaleva; Kaiyang Zhang; Mariliina Arjama; Greta Gudoityte; Brinton Seashore-Ludlow; Markku Varjosalo; Olli Kallioniemi; Sampsa Hautaniemi; Astrid Murumägi; Daniela Ungureanu
Journal:  Cell Death Dis       Date:  2022-08-17       Impact factor: 9.685

8.  Loss of receptor tyrosine kinase-like orphan receptor 2 impairs the osteogenesis of mBMSCs by inhibiting signal transducer and activator of transcription 3.

Authors:  Lizhen Lei; Zhuwei Huang; Jingyi Feng; Zijing Huang; Yiwei Tao; Xiaoli Hu; Xiaolei Zhang
Journal:  Stem Cell Res Ther       Date:  2020-03-26       Impact factor: 6.832

9.  Glucocorticoids induce differentiation and chemoresistance in ovarian cancer by promoting ROR1-mediated stemness.

Authors:  Hanna Karvonen; Mariliina Arjama; Laura Kaleva; Wilhelmiina Niininen; Harlan Barker; Riitta Koivisto-Korander; Johanna Tapper; Päivi Pakarinen; Heini Lassus; Mikko Loukovaara; Ralf Bützow; Olli Kallioniemi; Astrid Murumägi; Daniela Ungureanu
Journal:  Cell Death Dis       Date:  2020-09-23       Impact factor: 8.469

10.  MicroRNA-378a-3p contributes to ovarian cancer progression through downregulating PDIA4.

Authors:  Yao Chanjiao; Chen Chunyan; Qiu Xiaoxin; Han Youjian
Journal:  Immun Inflamm Dis       Date:  2020-11-07
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.