The sensitivity of breast cancer cells to epirubicin (EPI) is closely related to the efficacy of the drug and the prognosis of patients. A growing body of research has suggested that autophagy is involved in the treatment of a variety of cancers, including breast cancer, and modifies the sensitivity of anticancer drugs. However, the mechanism by which autophagy participates in cancer therapy and modulates drug sensitivity has not been fully elucidated. In this study, we showed that the expression of Autophagy/Beclin 1 regulator 1 (Ambra1), a key protein of autophagy, was negatively correlated with EPI sensitivity in breast cancer cells. In addition, it altered the sensitivity of breast cancer cells to EPI by regulating EPI-induced autophagy. As a potential mechanism, we demonstrated that autophagy-related protein 12 (ATG12) was a downstream protein that Ambra1-regulated EPI-induced autophagy. Therefore, Ambra1 plays an important role in regulating the sensitivity of breast cancer cells to EPI. And the regulatory effect of Ambra1 on EPI sensitivity is achieved through the regulation of autophagy by targeting ATG12. Overall, we propose a novel mechanism by which autophagy modulates the sensitivity of breast cancer cells to EPI. ATG12 is a novel targeting protein of Ambra1 in regulating EPI-induced autophagy. In addition, the important role of Ambra1 in modulating the sensitivity of breast cancer cells to EPI is confirmed in vivo. This finding indicates that Ambra1 might be a target for developing breast cancer treatments.
The sensitivity of breast cancer cells to epirubicin (EPI) is closely related to the efficacy of the drug and the prognosis of patients. A growing body of research has suggested that autophagy is involved in the treatment of a variety of cancers, including breast cancer, and modifies the sensitivity of anticancer drugs. However, the mechanism by which autophagy participates in cancer therapy and modulates drug sensitivity has not been fully elucidated. In this study, we showed that the expression of Autophagy/Beclin 1 regulator 1 (Ambra1), a key protein of autophagy, was negatively correlated with EPI sensitivity in breast cancer cells. In addition, it altered the sensitivity of breast cancer cells to EPI by regulating EPI-induced autophagy. As a potential mechanism, we demonstrated that autophagy-related protein 12 (ATG12) was a downstream protein that Ambra1-regulated EPI-induced autophagy. Therefore, Ambra1 plays an important role in regulating the sensitivity of breast cancer cells to EPI. And the regulatory effect of Ambra1 on EPI sensitivity is achieved through the regulation of autophagy by targeting ATG12. Overall, we propose a novel mechanism by which autophagy modulates the sensitivity of breast cancer cells to EPI. ATG12 is a novel targeting protein of Ambra1 in regulating EPI-induced autophagy. In addition, the important role of Ambra1 in modulating the sensitivity of breast cancer cells to EPI is confirmed in vivo. This finding indicates that Ambra1 might be a target for developing breast cancer treatments.
Breast cancer is the most common malignancy and among the leading causes of cancer‐related mortality in women worldwide.1 Epirubicin (EPI), an anthracycline, is one of the most effective drugs for the treatment of breast cancer. Presently, regimens containing EPI are recommended as the first‐line adjuvant therapy for breast cancer.2 The sensitivity of breast cancer cells to EPI significantly influences the effectiveness of this treatment. However, the factors involved in the regulation of chemosensitivity are numerous and the mechanisms have not yet been fully elucidated.3Macroautophagy (herein referred to as autophagy) is an evolutionarily conserved protein degradation process in eukaryotic cells that helps the cell to overcome adverse conditions by recycling nutrients and energy.4, 5, 6 Recently, an increasing number of studies have linked autophagy to the treatment of a variety of cancers, including breast cancer.7, 8, 9 Nevertheless, the mechanisms by which autophagy participates in cancer treatment and modulates drug sensitivity have not been established. Autophagy/Beclin 1 regulator 1 (Ambra1) is a protein essential for autophagy induction.10, 11, 12 Meanwhile, it is also important for the execution of apoptosis.13, 14, 15 The levels of Ambra1 in cells are critical for determining the rate of apoptosis.16 Therefore, the level of Ambra1 may modify the sensitivity of breast cancer cells to EPI. So far, few studies have reported on the role of Ambra1 in breast cancer; in particular, there is a lack of evidence that Ambra1 is involved in the sensitivity of breast cancer cells to chemotherapy. Autophagy‐related protein 12 (ATG12) is an ubiquitin‐like protein that conjugates to ATG5 to form an ATG12‐ATG5 conjugate. The conjugate promotes the lipidation of ATG8 (LC3) and directs its correct subcellular localization, which is necessary for the elongation of phagophores and the maturation of autophagosomes.17, 18, 19, 20 Thus, ATG12 is an important protein in regulating autophagy. However, it is unclear whether there is an interaction between Ambra1 and ATG12.In this study, MDA‐MB‐231, SK‐Br‐3 and MCF‐7 breast cancer cells were used as the cell model. It was found that the level of Ambra1 altered the sensitivity of breast cancer cells to EPI by regulating the occurrence of EPI‐induced autophagy. In addition, ATG12 was a downstream protein of Ambra1 in regulating EPI‐induced autophagy. Consequently, Ambra1 is an important factor in modulating the sensitivity of breast cancer cells to EPI.
MATERIALS AND METHODS
Cell culture
MCF‐7, MDA‐MB‐231 and SK‐Br‐3 cells were from the cell bank of the Chinese Academy of Sciences (Shanghai, China). MCF‐7 and SK‐Br‐3 cells were cultured in MEM media (Thermo Fisher, Waltham, MA, USA), and MDA‐MB‐231 cells were cultured in L15 media (Thermo Fisher), supplemented with 10% FBS (Thermo Fisher), 100 units/mL penicillin and 100 μg/mL streptomycin at 37°C in a humidified incubator with 5% CO2. Before the study, the cells were passaged for 6 generations. The identity of the cell lines was determined by short tandem repeat profiling.
Agents and antibodies
Epirubicin was from Pfizer Pharmaceuticals (Dalian, China). Bafilomycin A1 (BAF1) was from Sigma‐Aldrich (Shanghai) Trading (Shanghai, China). The annexin V‐PE/7‐AAD Apoptosis Assay Kit was from Nanjing KeyGen Biotech (Nanjing, China). The caspase‐9 activity assay kit, the lactate dehydrogenase (LDH) cytotoxicity assay kit, and the Cell Counting Kit‐8 (CCK‐8) were from the Beyotime Institute of Biotechnology (Shanghai, China). Anti‐MAPLC3β (H50) and anti‐Ambra1 antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti‐GAPDH antibody was from MultiSciences (Lianke) Biotech (Shanghai, China). Anti‐p62, ATG12, and ATG5 were from Abcam (HongKong, China). Anti‐Beclin 1 was from CST (Danvers, MA, USA).
Cell viability and death assay
For the cell viability and death assay, cells were seeded at 8 × 103 cells per well in 96‐well flat‐bottomed plates and were allowed to attach overnight at 37°C. Afterward, medium containing the assay agents was added to each well, and cells were further cultured at 37°C for the indicated times. The number of viable cells was estimated by CCK‐8 assay. The absorbance was measured at 450 nm with a microplate reader. The number of dead cells was estimated by LDH cytotoxicity assay kit according to the manufacturer's instructions.
Apoptosis assay
For the apoptosis assay, cells were seeded at 5 × 105 cells in 12.5 cm2 tissue culture flasks and were treated as described for the CCK‐8 assay for the indicated times. Afterward, cells were trypsinized at the indicated time and dyed with annexin V‐PE and 7‐AAD according to the manufacturer's instructions. Then, the apoptosis was detected with a flow cytometer.
Caspase‐9 activity assay
Cells were collected after treatment with the assay agents for the indicated time, and 30 μL of lysis buffer was added to the collected cells. The cells were resuspended in the lysis buffer and incubated on ice with light agitation for 30 minutes. Lysates were centrifuged at 1500 g for 5 minutes; 10 μL of supernatant was used to assay the protein concentration with Bradford reagent, and another 10 μL was used to assay caspase‐9 activity. The activity of caspase‐9 was assayed with Ac‐LEHD‐pNA as a substrate; the samples were incubated at 37°C for 2 hours, and the OD values were detected at 405 nm with a microplate reader.
Western blotting
For western blotting analyses, cells were seeded in 25‐cm2 tissue culture flasks and were allowed to reach approximately 80% confluency in fresh medium before treatment with the agents. After treatment, detached and attached cells were collected by centrifugation, and whole‐cell lysates were obtained using a lysis buffer (1 × PBS pH 7.6, 1% NP‐40, 0.1% sodium dodecyl sulfate and 0.5% sodium deoxycholate supplemented with inhibitor cocktails). Approximately 30‐50 μg of total protein from each group was electrophoretically separated on 12% or 15% SDS‐PAGE gels and electrotransferred to polyvinylidene fluoride membranes (PVDF membranes, Pierce, Rockford, USA). The PVDF membranes were blocked with 5% nonfat dry milk in Tris‐buffered saline‐Tween 20 (TBST, pH 7.6) for 1 hour at room temperature, incubated with the primary antibodies diluted in 5% nonfat dry milk in TBST with light agitation overnight at 4°, washed with TBST 3 times, and incubated with the secondary antibodies diluted in 5% nonfat dry milk in TBST with light agitation for 1 hour at room temperature; the proteins were then detected with electrochemiluminescence (Bio‐Rad, Hercules, CA, USA).
Lentiviral vector and shRNA construction and transfection
A lentiviral vector‐AMBRA1 transfected with full‐length humanAMBRA1 cDNA (LV‐AMBRA1), a lentiviral vector‐ATG12 transfected with full‐length humanATG12 cDNA (LV‐ATG12) and an empty vector (EV) were constructed by Genechem (Shanghai, China). Two specific‐target AMBRA1 shRNA (2450 and 3388), a specific‐target BECLIN 1 shRNA, a specific‐target ATG12 shRNA and control scrambled plasmids were synthesized by GenePharma (Shanghai, China). The sequence of 2450 was GCT GGA ATC TTC CCT CAT TTC, the 3388 was GGA GAC ATG TCA GTA TCA ACT, sh‐BECLIN 1 was CAG TTT GGC ACA ATC AAT A,21 and sh‐ATG12 was GCA AAT CCT CTA TGC CTT CTT. ShRNA plasmids were transfected into cells by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), the transfection was performed according to the instructions of the manufacturer.
Autophagy assay
Microtubule‐associated protein 1 light chain 3 (LC3) puncta was monitored by RFP‐GFP‐LC3 tandem fluorescent probe (Genechem). Autophagosomes have both RFP and GFP signals, whereas autolysosomes emit only an RFP signal because GFP is quenched in the acidic lysosomal environment.22 The protein levels of LC3 (LC3‐I/LC3‐II) and SQSTM1/p62 (p62) were detected by western blotting.
Real‐time quantitative PCR
RNA was extracted by using Trizol Reagent (Generay Biotech [Shanghai], Shanghai, China) as indicated by the supplier. CDNA synthesis was generated using a reverse transcription kit (Vazyme Biotech, Shanghai, China) according to the manufacturer's recommendations. CDNA from cell samples were amplified by quantitative RT‐PCR (qRT‐PCR) with specific primers for AMBRA1 (upper: 5′‐TGGGGAGGTTAGGATTTGGGA‐3′, lower: 5′‐GAGCCGTAGGGTGGAAAGC‐3′), ATG12 (upper: 5′‐GAGACACTCCCATAATGAA‐3′, lower: 5′‐GTAGGACCAGTTTACCATC‐3′), ATG5 (upper: 5′‐ATGTGCTTCGAGATGTGTGG‐3′, lower: 5′‐TGGTTCTGCTTCCCTTTCAG‐3′) and ACTIN (upper: 5′‐TGACGTGGACATCCGCAAAG‐3′, lower: 5′‐CCAAGAAGGAAGGCTGGAAA‐3′) with the ChamQ SYBR Color qPCR Master Mix (Vazyme Biotech). The primers were synthesized by Shanghai Sunny Biotechnology (Shanghai, China). Data were normalized to ACTIN expression.
Mice xenograft models
To generate murine subcutaneous tumors, 1 × 107 MDA‐MB‐231 cells transfected with scramble or 2450 were injected subcutaneously to the right of the forelimb armpits in BALB/c nude mice (Shanghai SLAC Laboratory Animal, Shanghai, China). Upon the subcutaneous tumor size reaching a diameter of approximately 5 mm, the mice received i.p. injections of EPI (5 mg/kg). Tumor volumes were calculated using the following formula: length × width2 × ∏/6. All animal experiments conformed to the provisions of the Declaration of Helsinki (as revised in Fortaleza, Brazil, October 2013) and were approved by the Ethics Committee of the Second Affiliated Hospital of Guangxi Medical University.
Statistical analyses
Statistical comparisons of the mean values were performed using ANOVA. P < 0.05 was considered statistically significant.
RESULTS
Knockdown of Ambra1 increases the sensitivity of breast cancer cells to epirubicin
First, the expression of Ambra1 was examined by western blotting in MCF‐7, MDA‐MB‐231 and SK‐Br‐3 breast cancer cells (Figure 1A). To investigate the potential role of Ambra1 in EPI‐induced cell death in breast cancer cells, 2 target‐specific AMBRA1 shRNA (2450 and 3388) were constructed to knock down Ambra1 and an irrelevant shRNA (scramble) as a control. qRT‐PCR and western blotting revealed that after transfection with 2450 or 3388 for 48 hours, Ambra1 decreased significantly in both mRNA and protein (Figure 1B,C, *P < 0.05). After knocking down of Ambra1, the cells were treated with 2.2 μmol/L EPI for another 24 hours. The knockdown of Ambra1 resulted in a dramatic decrease in the viability and an increase in mortality (Figure 1D, *P < 0.05). Along with the increase of cell death, caspase‐9 activity and apoptosis also increased obviously (Figure 1E, *P < 0.05). Therefore, knockdown of Ambra1 increases EPI‐induced cell death in breast cancer cells by activating caspase‐9 and spurring apoptosis.
Figure 1
Knockdown of Ambra1 increased epirubicin (EPI)‐induced apoptosis. A, The basal expression of Ambra1 in MCF‐7, MDA‐MB‐231 and SK‐Br‐3 cells was detected by western blotting. B, Cells were incubated with scrambled shRNA or target‐specific AMBRA1 shRNA (2450 or 3388) for 48 h, the protein of Ambra1 was examined by western blotting, and the mRNA was examined by quantitative RT‐PCR (C). The results (mean ± SE) are from 3 independent experiments (*P < 0.05). D, Cells were transfected with scrambled shRNA or 2450 or 3388 for 48 h, following treatment with 2.2 μmol/L EPI for another 24 h; then, cell viability and mortality were analyzed. At the same time, caspase‐9 activity and apoptosis were measured (E). The results (mean ± SE) are from 3 independent experiments (*P < 0.05)
Knockdown of Ambra1 increased epirubicin (EPI)‐induced apoptosis. A, The basal expression of Ambra1 in MCF‐7, MDA‐MB‐231 and SK‐Br‐3 cells was detected by western blotting. B, Cells were incubated with scrambled shRNA or target‐specific AMBRA1 shRNA (2450 or 3388) for 48 h, the protein of Ambra1 was examined by western blotting, and the mRNA was examined by quantitative RT‐PCR (C). The results (mean ± SE) are from 3 independent experiments (*P < 0.05). D, Cells were transfected with scrambled shRNA or 2450 or 3388 for 48 h, following treatment with 2.2 μmol/L EPI for another 24 h; then, cell viability and mortality were analyzed. At the same time, caspase‐9 activity and apoptosis were measured (E). The results (mean ± SE) are from 3 independent experiments (*P < 0.05)
Overexpression of Ambra1 increases the resistance of breast cancer cells to epirubicin
To further characterize the role of Ambra1 in EPI‐induced cell death, a lentiviral vector‐AMBRA1 transfected with full‐length humanAMBRA1 cDNA and an empty vector (EVam, as a control) were constructed to overexpress Ambra1 in MCF‐7, MDA‐MB‐231 and SK‐Br‐3 cells. After transfection with LV‐AMBRA1 for 48 hours, the expression of Ambra1 was significantly increased in both mRNA and protein (Figure 2A,B, *P < 0.05). In addition, the overexpression of Ambra1 led to a significant increase in cell viability as well as decreases in cell death, caspase‐9 activity and apoptosis after EPI treatment (Figure 2C,D, *P < 0.05). Thus, overexpression of Ambra1 increases EPI‐resistance by inhibiting apoptosis in breast cancer cells. LC3 is currently the most widely used autophagosome marker.22 Overexpression of Ambra1 resulted in more LC3 puncta formations in MCF‐7, MDA‐MB‐231 and SK‐Br‐3 cells at basal level and after EPI treatment, and the increased LC3 puncta was more pronounced in the presence of BAF1, a potent V‐ATPase inhibitor that blocks the fusion of autophagosomes and lysosomes22 (Figure 2E, *P < 0.05).
Figure 2
Overexpression of Ambra1 increased the resistance of breast cancer cells to epirubicin (EPI). A, MCF‐7, MDA‐MB‐231 and SK‐Br‐3 cells were transfected with LV‐AMBRA1 or empty vector (EVam) for 48 h, and the protein of Ambra1 was tested by western blotting. Meanwhile, the mRNA of AMBRA1 was analyzed by quantitative RT‐PCR (B). The results (mean ± SE) are from 3 independent experiments (*P < 0.05). C, Cells incubated with LV‐AMBRA1 or EVam for 48 h, following treatment with 2.2 μmol/L EPI for 24 h; then, cell viability and mortality were analyzed. Moreover, caspase‐9 activity and apoptosis were assayed (D). The results (mean ± SE) are from 3 independent experiments (*P < 0.05). E, Cells expressing RFP‐GFP‐LC3 were incubated with LV‐AMBRA1 or EVam for 48 h. After that, these cells were treated with 2.2 μmol/L EPI for 24 h in the presence or absence of Bafilomycin A1 (BAF1, 20 nmol/L). Autophagy was assessed with the LC3 puncta. The results (mean ± SE) are from 3 independent experiments (*P < 0.05). F, MDA‐MB‐231 cells were transfected with LV‐AMBRA1 or EVam for 48 h and then incubated with scrambled shRNA or sh‐BECLIN 1 for additional 48 h. Then, the protein of Beclin 1 was detected by western blotting. G, MDA‐MB‐231 cells expressing RFP‐GFP‐LC3 were incubated with LV‐AMBRA1 or EVam for 48 h. Then, the cells were transfected with scrambled shRNA or sh‐BECLIN 1 for 48 h, followed by treatment with 2.2 μmol/L EPI for another 24 h in the presence or absence of Bafilomycin A1 (BAF1, 20 nmol/L). After treatment, the fluorescence of RFP and GFP was observed with a fluorescence microscope (600×) and LC3 puncta were counted. The nucleus was stained with Hoechst. The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05). In parallel, the proteins of Ambra1, LC3‐I/II and p62 were detected by western blotting (H). Then, (I) and (J), cell viability, cell death, caspase‐9 activity and apoptosis were analyzed. The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05)
Overexpression of Ambra1 increased the resistance of breast cancer cells to epirubicin (EPI). A, MCF‐7, MDA‐MB‐231 and SK‐Br‐3 cells were transfected with LV‐AMBRA1 or empty vector (EVam) for 48 h, and the protein of Ambra1 was tested by western blotting. Meanwhile, the mRNA of AMBRA1 was analyzed by quantitative RT‐PCR (B). The results (mean ± SE) are from 3 independent experiments (*P < 0.05). C, Cells incubated with LV‐AMBRA1 or EVam for 48 h, following treatment with 2.2 μmol/L EPI for 24 h; then, cell viability and mortality were analyzed. Moreover, caspase‐9 activity and apoptosis were assayed (D). The results (mean ± SE) are from 3 independent experiments (*P < 0.05). E, Cells expressing RFP‐GFP‐LC3 were incubated with LV‐AMBRA1 or EVam for 48 h. After that, these cells were treated with 2.2 μmol/L EPI for 24 h in the presence or absence of Bafilomycin A1 (BAF1, 20 nmol/L). Autophagy was assessed with the LC3 puncta. The results (mean ± SE) are from 3 independent experiments (*P < 0.05). F, MDA‐MB‐231 cells were transfected with LV‐AMBRA1 or EVam for 48 h and then incubated with scrambled shRNA or sh‐BECLIN 1 for additional 48 h. Then, the protein of Beclin 1 was detected by western blotting. G, MDA‐MB‐231 cells expressing RFP‐GFP‐LC3 were incubated with LV‐AMBRA1 or EVam for 48 h. Then, the cells were transfected with scrambled shRNA or sh‐BECLIN 1 for 48 h, followed by treatment with 2.2 μmol/L EPI for another 24 h in the presence or absence of Bafilomycin A1 (BAF1, 20 nmol/L). After treatment, the fluorescence of RFP and GFP was observed with a fluorescence microscope (600×) and LC3 puncta were counted. The nucleus was stained with Hoechst. The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05). In parallel, the proteins of Ambra1, LC3‐I/II and p62 were detected by western blotting (H). Then, (I) and (J), cell viability, cell death, caspase‐9 activity and apoptosis were analyzed. The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05)To explore whether autophagy mediated the effects of Ambra1‐mediated resistance to the apoptotic response after treatment with EPI, we knocked down Beclin 1 by sh‐BECLIN 1 in MDA‐MB‐231 cells and corresponding cells that highly expressed Ambra1 (Figure 2F). Beclin 1 is a critical autophagic regulator in mammalian cells.23 The knockdown of Beclin 1 not only inhibited the formation of LC3 puncta induced by EPI in MDA‐MB‐231 cells but also inhibited the formation of LC3 puncta in cells with high expression of Ambra1 (Figure 2G, *P < 0.05, **P > 0.05). In addition, silencing of Beclin 1 inhibited the conversion of LC3‐I into LC3‐II and the degradation of p62 by EPI treatment (Figure 2H). During autophagy, LC3‐I is converted to LC3‐II, which is used as an indicator of autophagy.24, 25 P62 forms protein aggregates that are degraded by autophagy and is another indicator of autophagy.26, 27 BAF1 was used to inhibit the lysosome‐dependent degradation of LC3 and p62 and block autophagy in late stages. At the same time, the inhibition of autophagy by Beclin 1‐knockdown and BAF1 also increased the sensitivity of cells overexpressing Ambra1 to EPI (Figure 2I,J, *P < 0.05, **P > 0.05). Therefore, autophagy is required for Ambra1‐mediated EPI‐resistance.
Ambra1 regulates epirubicin‐induced autophagy in breast cancer cells
As a key factor in autophagy, we explored whether Ambra1 was also involved in EPI‐induced autophagy in breast cancer cells. To do this, we used 2450 or 3388 to knock down Ambra1 in MDA‐MB‐231 cells (Figure 3A). After 48 hours of transfection with either 2450 or 3388, the cells were treated with EPI for additional 24 hours. The knockdown of Ambra1 inhibited the conversion of LC3‐I into LC3‐II and p62 degradation caused by EPI (Figure 3B). In parallel, the increase of LC3 puncta caused by EPI treatment was also suppressed by 2450 or 3388 (Figure 3C, *P < 0.05). BAF1 was used to inhibit the degradation of LC3 and p62 and to analyze autophagic flux. Hence, EPI‐induced autophagy is Ambra1‐dependent in breast cancer cells; that is, Ambra1 regulates EPI‐induced autophagy.
Figure 3
Ambra1 regulated epirubicin (EPI)‐induced autophagy in breast cancer cells. A, MDA‐MB‐231 cells were incubated with scrambled shRNA or target‐specific AMBRA1 shRNA (2450 or 3388) for 48 h. The protein of Ambra1 was detected by western blotting. B, MDA‐MB‐231 cells were incubated with scrambled shRNA or 2450 or 3388 for 48 h, followed by treatment with EPI for another 24 h in the presence or absence of Bafilomycin A1 (BAF1, 20 nmol/L); then, the protein of LC3‐I/II and p62 was detected by western blotting. C, MDA‐MB‐231 cells expressing RFP‐GFP‐LC3 were incubated with scrambled shRNA or 2450 or 3388 for 48 h. Then, the cells were treated with EPI for another 24 h in the presence or absence of Bafilomycin A1 (BAF1, 20 nmol/L). Autophagy was assessed with the LC3 puncta. The results (mean ± SE) are from 3 independent experiments (*P < 0.05)
Ambra1 regulated epirubicin (EPI)‐induced autophagy in breast cancer cells. A, MDA‐MB‐231 cells were incubated with scrambled shRNA or target‐specific AMBRA1 shRNA (2450 or 3388) for 48 h. The protein of Ambra1 was detected by western blotting. B, MDA‐MB‐231 cells were incubated with scrambled shRNA or 2450 or 3388 for 48 h, followed by treatment with EPI for another 24 h in the presence or absence of Bafilomycin A1 (BAF1, 20 nmol/L); then, the protein of LC3‐I/II and p62 was detected by western blotting. C, MDA‐MB‐231 cells expressing RFP‐GFP‐LC3 were incubated with scrambled shRNA or 2450 or 3388 for 48 h. Then, the cells were treated with EPI for another 24 h in the presence or absence of Bafilomycin A1 (BAF1, 20 nmol/L). Autophagy was assessed with the LC3 puncta. The results (mean ± SE) are from 3 independent experiments (*P < 0.05)
ATG12 is a downstream protein of Ambra1 in epirubicin‐induced autophagy
To explore the underlying mechanism of Ambra1 in the regulation of EPI‐induced autophagy in breast cancer cells, we analyzed the expression of ATG12 in response to Ambra1 knockdown. ATG12 is an ubiquitin‐like protein involved in the formation of autophagic vesicles, which is crucial for autophagy.17, 18, 19, 20 Ambra1 was knocked down by 2450 in MDA‐MB‐231 cells (Figure 4A). Interestingly, 2450 also caused a decrease in ATG12 protein and mRNA (Figure 4A, *P < 0.05, upper histogram). Correspondingly, the overexpression of Ambra1 by LV‐AMBRA1 increased the expression of ATG12 protein and mRNA (Figure S1, *P < 0.05). To further confirm the relationship between ATG12 and Ambra1, we constructed a lentiviral vector‐ATG12 (LV‐ATG12) transfected with full‐length humanATG12 cDNA to overexpress ATG12, and an empty vector (EVat) served as a control. LV‐ATG12 caused ATG12 overexpression in MDA‐MB‐231 cells, but it did not affect the expression of Ambra1 (Figure 4B, *P < 0.05, **P > 0.05). Therefore, Ambra1 positively regulates the expression of ATG12. Because ATG12 is closely related to ATG5, we also detected the expression of ATG5 and ATG12‐ATG5. Similar to ATG12, the knockdown of Ambra1 also resulted in decreased expression of ATG12‐ATG5 (Figure 4A). However, there were no significant changes in ATG5 protein and mRNA (Figure 4A, **P > 0.05, lower histogram). It was worth noting that the downregulation of Beclin1 did not affect the expressions of ATG12 and ATG5 (Figure 4A, **P > 0.05, upper and lower histograms). Thus, ATG12 is a target protein of Ambra1 in breast cancer cells.
Figure 4
ATG12 was a downstream protein of Ambra1 in epirubicin (EPI)‐induced autophagy. A, MDA‐MB‐231 cells were incubated with scrambled shRNA or sh‐BECLIN 1 or 2450 for 48 h. The protein of Ambra1, ATG12, ATG12‐ATG5 and ATG5 was detected by western blotting. At the same time, the mRNA of ATG12 and ATG5 were examined by quantitative RT‐PCR (qRT‐PCR). The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05). B, MDA‐MB‐231 cells were transfected with LV‐ATG12 or empty vector (EVat) for 48 h. The proteins and mRNA of ATG12 and Ambra1 were detected by western blotting and qRT‐PCR, respectively. The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05). C, MDA‐MB‐231 cells expressing RFP‐GFP‐LC3 were incubated with LV‐ATG12 or empty vector (EVat) for 48 h. After that, the cells were treated with EPI for another 24 h in the presence or absence of Bafilomycin A1 (BAF1, 20 nmol/L); then, autophagy was assessed with the LC3 puncta. The results (mean ± SE) are from 3 independent experiments (*P < 0.05). D, MDA‐MB‐231 cells were transfected with scramble shRNA or 2450 for 48 h, and then incubated with LV‐ATG12 or empty vector (EVat) for another 48 h. Subsequently, the cells were treated with EPI for 24 h. After treatment, the proteins of ATG12, LC3‐I/II and p62 were detected by western blotting (D). In parallel, autophagy was assessed with LC3 puncta in MDA‐MB‐231 cells that expressed RFP‐GFP‐LC3 (E). The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05). Moreover, (F) and (G), cell viability, cell death, caspase‐9 activity and apoptosis were measured, respectively. The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05)
ATG12 was a downstream protein of Ambra1 in epirubicin (EPI)‐induced autophagy. A, MDA‐MB‐231 cells were incubated with scrambled shRNA or sh‐BECLIN 1 or 2450 for 48 h. The protein of Ambra1, ATG12, ATG12‐ATG5 and ATG5 was detected by western blotting. At the same time, the mRNA of ATG12 and ATG5 were examined by quantitative RT‐PCR (qRT‐PCR). The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05). B, MDA‐MB‐231 cells were transfected with LV‐ATG12 or empty vector (EVat) for 48 h. The proteins and mRNA of ATG12 and Ambra1 were detected by western blotting and qRT‐PCR, respectively. The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05). C, MDA‐MB‐231 cells expressing RFP‐GFP‐LC3 were incubated with LV‐ATG12 or empty vector (EVat) for 48 h. After that, the cells were treated with EPI for another 24 h in the presence or absence of Bafilomycin A1 (BAF1, 20 nmol/L); then, autophagy was assessed with the LC3 puncta. The results (mean ± SE) are from 3 independent experiments (*P < 0.05). D, MDA‐MB‐231 cells were transfected with scramble shRNA or 2450 for 48 h, and then incubated with LV‐ATG12 or empty vector (EVat) for another 48 h. Subsequently, the cells were treated with EPI for 24 h. After treatment, the proteins of ATG12, LC3‐I/II and p62 were detected by western blotting (D). In parallel, autophagy was assessed with LC3 puncta in MDA‐MB‐231 cells that expressed RFP‐GFP‐LC3 (E). The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05). Moreover, (F) and (G), cell viability, cell death, caspase‐9 activity and apoptosis were measured, respectively. The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05)In addition, overexpression of ATG12 also resulted in more LC3 puncta formations (Figure 4C, *P < 0.05), and more LC3‐I conversion into LC3‐II and p62 degradation regardless of EPI treatment (Figure 4D). Therefore, ATG12 is also a proautophagic protein in breast cancer cells. Meanwhile, overexpression of ATG12 dramatically increased the cell viability of EPI treatment and decreased cell death, caspase‐9 activity and apoptosis (Figure 4F,G, *P < 0.05). This suggests that ATG12 plays an important role in regulating EPI sensitivity.Next, to affirm the role of ATG12 in Ambra1‐mediated autophagy, we knocked down ATG12 by sh‐ATG12 in MDA‐MB‐231 cells and corresponding cells with high expression of Ambra1 (Figure S2A). Even if Ambra1 was overexpressed, the knockdown of ATG12 reduced the number of LC3 puncta (Figure S2B, *P < 0.05, **P > 0.05). Thus, ATG12 is a key protein of Ambra1‐mediated autophagy. Subsequently, we simultaneously knocked down Ambra1 and re‐expressed ATG12 in MDA‐MB‐231 cells. Unfortunately, the re‐expression of ATG12 did not restore EPI‐induced autophagy inhibited by Ambra1 knockdown (Figure 4D,E, **P > 0.05); moreover, the re‐expression of ATG12 did not disturb the increased sensitivity of cells to EPI induced by Ambra1 knockdown (Figure 4F,G, **P > 0.05). The autophagy was detected by LC3‐I conversion into LC3‐II, p62 degradation and LC3 puncta. Therefore, ATG12 is a downstream protein of the Ambra1‐mediated autophagy pathway and is an important protein for Ambra1 to modulate EPI sensitivity.
Knockdown of Ambra1 enhances epirubicin sensitivity in vivo
To confirm whether downregulation of Ambra1 also increased the sensitivity of breast cancer cells to EPI in vivo, we inoculated BALB/c nude mice with MDA‐MB‐231 cells that had previously been transfected with 2450 and scramble shRNA. The expression of Ambra1 was inhibited by 2450 (Figure 5A,B, *P < 0.05, **P > 0.05). On days 24, 29, 36 and 43 after inoculation of the cells, 5 mg/kg EPI was intraperitoneally administered to the mice. After EPI treatment, the growth of 2450‐transfected tumors was significantly inhibited compared to scramble shRNA transfected tumors (Figure 5C, *P < 0.05). Therefore, Ambra1 is important in modulating EPI sensitivity in breast cancer cells in vivo.
Figure 5
Downregulation of Ambra1 increased sensitivity of breast cancer to epirubicin (EPI) in vivo. A, MDA‐MB‐231 cells were transfected with scrambled shRNA or 2450 for 48 h, and then the protein of Ambra1 was detected by western blotting. At the same time, the mRNA of AMBRA1 was tested by quantitative RT‐PCR (B). The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05). C, After knocking down of Ambra1, MDA‐MB‐231 cells we inoculated BALB/c nude mice. Then, the mice were treated with 5 mg/kg EPI for indicated time, and the volume and weight of the tumor were measured (*P < 0.05)
Downregulation of Ambra1 increased sensitivity of breast cancer to epirubicin (EPI) in vivo. A, MDA‐MB‐231 cells were transfected with scrambled shRNA or 2450 for 48 h, and then the protein of Ambra1 was detected by western blotting. At the same time, the mRNA of AMBRA1 was tested by quantitative RT‐PCR (B). The results (mean ± SE) are from 3 independent experiments (*P < 0.05, **P > 0.05). C, After knocking down of Ambra1, MDA‐MB‐231 cells we inoculated BALB/c nude mice. Then, the mice were treated with 5 mg/kg EPI for indicated time, and the volume and weight of the tumor were measured (*P < 0.05)
DISCUSSION
Based on the results in vitro and in vivo, we propose that Ambra1 plays an important role in modulating the sensitivity of breast cancer cells to EPI. Furthermore, ATG12 is a downstream protein of Ambra1 in the regulation of EPI‐induced autophagy.Ambra1 is a key protein in the crosstalk between autophagy and apoptosis. Its expression may determine the fate of cells.13, 14, 15, 16 Studies on several cell lines have shown that high expression of Ambra1 is beneficial for cell survival.10, 14, 16, 28 In this study, we found that downregulation of Ambra1 resulted in an increase in EPI‐induced apoptosis in breast cancer cells; in contrast, overexpression of Ambra1 led to the resistance of breast cancer cells to EPI‐induced apoptosis. Therefore, the expression of Ambra1 determines the apoptosis rate of breast cancer cells treated with EPI. In fact, overexpression of Ambra1 resulted in more LC3 puncta formations, while blocking autophagy by sh‐BECLIN 1 or BAF1 increased the sensitivity of cells overexpressing Ambra1 to EPI. Therefore, autophagy is involved in Ambra1‐mediated EPI‐resistance in breast cancer cells. Recently, autophagy is widely concerned because of its close relationship with tumorigenesis and cancer treatment.7, 8, 9 Our previous study has found that EPI can induce autophagy in MCF‐7 breast cancer cells, which protects the cells from apoptosis.29 Guo et al30 subsequently obtained similar results in MDA‐MB‐231 and SK‐BR‐3 cells. However, Garbar et al31 report that multiple chemotherapy drugs, including EPI, induced an increase of autophagy in MCF‐7 cells, but not in MDA‐MB‐231 cells. Indeed, we confirmed that EPI could induce an increase of autophagy in MDA‐MB‐231 cells by detecting the conversion of LC3‐I into LC3‐II, p62 degradation and LC3 puncta formations. The same was true in MCF‐7 and SK‐Br‐3 cells. This is consistent with our previous findings and those of Guo et al. Although a great deal of studies have been published on the relationship between autophagy and cancer therapy, the mechanism by which autophagy participates in the treatment of cancer has not yet been fully established.7, 8, 9 Here, we found that knockdown of Ambra1 blocked EPI‐induced autophagy and increased the sensitivity of breast cancer cells to EPI. Therefore, Ambra1 is a key protein that autophagy regulates the sensitivity of breast cancer cells to EPI.Interestingly, we found that Ambra1 positively regulated the expression of ATG12, but not ATG5. ATG12 is a key protein in the elongation and maturation of autophagic vesicles.17, 18, 19, 20 In fact, overexpression of ATG12 increased EPI‐induced autophagy and EPI resistance. This suggests that ATG12 is also a proautophagic protein in breast cancer cells and is involved in the regulation of EPI sensitivity. In contrast, knockdown of ATG12 inhibited EPI‐induced autophagy of the cells overexpressing Ambra1. Thus, ATG12 plays an important role in Ambra1‐mediated autophagy. However, in the presence of ATG12 overexpression, knockdown of Ambra1 inhibited EPI‐induced autophagy and increased cell sensitivity to EPI. This indicates that ATG12 is a downstream protein of Ambra1 during EPI‐induced autophagy, and it is an important protein through which Ambra1 regulates the sensitivity of breast cancer cells to EPI.In summary, Ambra1 is an important protein that determines whether EPI‐treated breast cancer cells undergo apoptosis or autophagy. Its level modulates the sensitivity of breast cancer cells to EPI. In addition, ATG12 is a downstream protein of Ambra1 during EPI‐induced autophagy and plays an important role in regulating EPI sensitivity.We conclude that Ambra1 regulates EPI‐induced autophagy in breast cancer cells by targeting ATG12, thereby modulating EPI sensitivity. This finding also indicates that Ambra1 might be a potential target for breast cancer treatment.
CONFLICT OF INTEREST
The authors have no conflict of interest.Click here for additional data file.Click here for additional data file.
Authors: Li Yu; Ajjai Alva; Helen Su; Parmesh Dutt; Eric Freundt; Sarah Welsh; Eric H Baehrecke; Michael J Lenardo Journal: Science Date: 2004-05-06 Impact factor: 47.728
Authors: Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier Journal: Autophagy Date: 2016 Impact factor: 16.016