| Literature DB >> 29997588 |
Fiona F Hager1, Arturo López-Guzmán1, Simon Krauter2, Markus Blaukopf2, Mathias Polter1, Inka Brockhausen3, Paul Kosma2, Christina Schäffer1.
Abstract
Various mechanisms of protein cell surface display have evolved during bacterial evolution. Several Gram-positive bacteria employ S-layer homology (SLH) domain-mediated sorting of cell-surface proteins and concomitantly engage a pyruvylated secondary cell-wall polymer as a cell-wall ligand. Specifically, pyruvate ketal linked to β-D-ManNAc is regarded as an indispensable epitope in this cell-surface display mechanism. That secondary cell wall polymer (SCWP) pyruvylation and SLH domain-containing proteins are functionally coupled is supported by the presence of an ortholog of the predicted pyruvyltransferase CsaB in bacterial genomes, such as those of Bacillus anthracis and Paenibacillus alvei. The P. alvei SCWP, consisting of pyruvylated disaccharide repeats [→4)-β-D-GlcNAc-(1→3)-4,6-Pyr-β-D-ManNAc-(1→] serves as a model to investigate the widely unexplored pyruvylation reaction. Here, we reconstituted the underlying enzymatic pathway in vitro in combination with synthesized compounds, used mass spectrometry, and nuclear magnetic resonance spectroscopy for product characterization, and found that CsaB-catalyzed pyruvylation of β-D-ManNAc occurs at the stage of the lipid-linked repeat. We produced the P. alvei TagA (PAV_RS07420) and CsaB (PAV_RS07425) enzymes as recombinant, tagged proteins, and using a synthetic 11-phenoxyundecyl-diphosphoryl-α-GlcNAc acceptor, we uncovered that TagA is an inverting UDP-α-D-ManNAc:GlcNAc-lipid carrier transferase, and that CsaB is a pyruvyltransferase, with synthetic UDP-α-D-ManNAc and phosphoenolpyruvate serving as donor substrates. Next, to substitute for the UDP-α-D-ManNAc substrate, the recombinant UDP-GlcNAc-2-epimerase MnaA (PAV_RS07610) of P. alvei was included in this in vitro reconstitution system. When all three enzymes, their substrates and the lipid-linked GlcNAc primer were combined in a one-pot reaction, a lipid-linked SCWP repeat precursor analog was obtained. This work highlights the biochemical basis of SCWP biosynthesis and bacterial pyruvyl transfer.Entities:
Keywords: SLH domain; glycosyltransferase; multi-enzyme assay; pyruvyltransferase; secondary cell wall polymer
Year: 2018 PMID: 29997588 PMCID: PMC6030368 DOI: 10.3389/fmicb.2018.01356
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 6.064
Oligonucleotide primers used for PCR amplification reactions.
| Gene | Primer | Sequence (5′–3′) |
|---|---|---|
| csaB_for | GGCGCAAGTGATGAAGAAGC | |
| tagA_rev | GAAGCTGCCCCCGACACCCA | |
| tagA_for | GCTGTTCGTTGCTCGTGGAG | |
| tagO_rev | CCAGAGTCCCCCATAAAGAT | |
| MnaA_fwd_ | GCGCGGGCATATGTCCAAAGTGAAAGTA | |
| MnaA_rev_ | GCGCGGGCTCGAGATTTGTGAACTTTGT | |
| MBP- | TagA_fwd_ | CGATGGAATTCATGTTAGAAATGAAGGAT |
| MBP- | TagA_rev_ | CGATGCTGCAGTTACTGCACTTTTGTGGG |
| CsaB_fwd_ | CTGTGGCATATGGCGTCCAAAGCTAC AAGAATAGTACTTTCCGGATATTACGGATTC | |
| CsaB_rev_ | GACCTACTCGAGCGCCTTATGACGCAGCCAC TTCACAATTTGTTGCGCTGGCTGTTCTGCTT |
NMR data of compounds 4 and 5 recorded in D2O.
| H-1 | H-2 | H-3 | H-4 | H-5 | H-6a | H-6b | |
|---|---|---|---|---|---|---|---|
| C-1 | C-2 | C-3 | C-4 | C-5 | C-6 | ||
| β- | 4.87 | 4.575 | ∼3.80 | 3.48 | 3.39 | n.d. | n.d. |
| <1.0 | 4.2 | n.d. | 9.8 | 2.0, 4.9 | |||
| 99.9 | 54.3 | 67.3 | 77.2 | ||||
| CH3 | 2.03/0.04 | ||||||
| 22.7 | |||||||
| NHC = O | n.d. | ||||||
| →4)-α- | 5.45 | 3.99 | ∼3.94 | ∼3.78 | 3.92 | n.d. | n.d. |
| 3.1, 7.1 | 2.6 | n.d. | n.d. | n.d. | |||
| 94.9 | 54.2 | 72.15 | 79.0 | 72.2 | |||
| CH3 | 2.03 /0.04 | ||||||
| 22.7 | |||||||
| NHC = O | n.d. | ||||||
| PP→OCH2CH2CH2- | ∼3.90 | 1.60 | n.d. | ||||
| n.d. | 6.2 | ||||||
| 67.6 | 30.7 | ||||||
| PhOCH2CH2CH2- | 4.08 | 1.75 | 1.42 | ||||
| n.d. | 6.6 | 6.6 | |||||
| 69.5 | 28.8 | 25.9 | |||||
| Additional signals (CH2)2 | 1.37–1.20 | ||||||
| 29.3 | |||||||
| Ph | – | 7.01 | 7.36 | 7.02 | 7.36 | 7.01 | |
| 7.1 | 7.3 | 7.6 | 7.3 | 7.1 | |||
| 115.7 | 130.6 | 122.0 | 130.6 | 115.7 | |||
| 4,6-Pyr-β- | 4.90 | 4.51 | 3.93 | 3.58 | 3.39 | 4.01 | ∼3.72 |
| <1.0 | 4.3 | 4.5, 10.1 | 9.8 | 5.0, 9.9 | 4.9, 10.8 | ||
| 100.5 | 54.0 | 70.3 | 74.6 | 67.6 | 64.7 | ||
| CH3 | 2.05 | ||||||
| 22.75 | |||||||
| NHC = O | 176.15 | ||||||
| Pyruvic acetal | – | – | 1.44 | ||||
| 176.2 | 102.6 | 25.5 | |||||
| →4)-α- | 5.46 | 3.98 | 3.85 | 3.74 | 3.92 | 3.81 | ∼3.72 |
| br s | 10.5 | 9.4, 9.4 | 9.0 | n.d. | 12.4 | ||
| 94.9 | 54.4 | 70.2 | 79.2 | 72.2 | 60.45 | ||
| CH3 | 2.05 | ||||||
| 22.75 | |||||||
| NHC = O | 176.15 | ||||||
| PP→OCH2CH2CH2 | 3.91 | 1.60 | 1.33 | ||||
| n.d. | 6.7 | n.d. | |||||
| 67.6 | 30.5 | 29.3 | |||||
| PhOCH2CH2CH2 | 4.08 | 1.74 | 1.43 | ||||
| 6.6 | 6.8, | 7.1 | |||||
| 69.6 | 29.0 | ||||||
| Additional (CH2)2 signals | 1.35–1.27 | ||||||
| 29.4 | |||||||
| Ph | – | 7.02 | 7.37 | 7.04 | 7.37 | 7.02 | |
| 8.3 | 8.0 | 7.5 | 8.0 | 8.3 | |||
| 158.9 | 115.7 | 130.5 | 122.2 | 130.5 | 115.7 | ||