Effects of the Dietary Probiotic, Enterococcus faecium NCIMB11181, on the Intestinal Barrier and System Immune Status in Escherichia coli O78-Challenged Broiler Chickens.

The effects of Enterococcus faecium on growth, intestinal barrier function, and immune response in Escherichia coli O78-challenged broiler chickens were investigated. Three hundred eight 1-day-old Ross male chickens were randomly assigned into three treatment groups: negative control (C), E. coli O78-infected positive (EP), and E. coli O78-infected with 200 mg/kg E. faecium dietary supplementation (EF). E. faecium significantly increased the body weight on day 10 (P < 0.05) and day 15. Furthermore, these birds had a greater average daily gain compared with the other groups during days 1-10 (P < 0.05). The death rate of the EF chickens dramatically declined. E. faecium supplementation improved the jejunal villus height and the ratio of villus height to crypt depth (P < 0.05) 3 and 7 days post-infection. The mRNA expression of claudin-1 significantly increased by E. faecium (P < 0.05) 3 and 7 days post-infection, and Mucin2 was markedly enhanced (P < 0.05) 3 days post-infection. E. faecium upregulated the mRNA expression of PPAR-γ and IL-10 (P < 0.05) and downregulated that of NF-κB, TLR4, and IL-1β (P < 0.05) in the spleen 3 and 7 days post-infection. Lipopolysaccharide stimulation index was markedly enhanced in the EF group (P < 0.05) 3 days post-infection. The increased liver E. coli number caused by the E. coli O78 challenge was significantly reversed by E. faecium (P < 0.05). E. faecium improved growth and reduced the death rate by regulating the immune response and maintaining the intestinal integrity in E. coli O78-challenged broiler chickens.

Introduction

Avian colibacillosis, caused by specific serotypes or opportunistically pathogenic Escherichia coli, is one of the crucial bacterial diseases of poultry [1, 2]. Young birds, in which the protective immune system is not fully developed, are more vulnerable. E. coli serotypes O78:K80, O1:K1, and O2:K1 are the most commonly found in domestic breeds with colibacillosis [3]. Although various antibiotics are typically used to prevent and control colibacillosis, cumulative reports have demonstrated that drug resistance of E. coli has increased owing to the spreading of resistance genes such as extended-spectrum beta-lactamases (ESBL) and/or plasmid-mediated Amp-C beta-lactamases (Amp-C) [4, 5]. Therefore, potential antibiotic alternatives to reduce antimicrobial drug usage in poultry production are urgently needed.

Enterococcus faecium, a lactic acid-producing Gram-positive bacterium found in the intestine of healthy animals and humans, is a probiotic that may be beneficial for animal health [6, 7]. E. faecium increases the concentration of organic acids and bacteriocins, which are important for the alimentary tract because of their nutritional benefits for enterocytes and their inhibitory effects on pathogens [8]. Previous studies have indicated that E. faecium improves the metabolism of macronutrients [7], promotes growth performance [6, 9], inhibits pathogen proliferation [1, 10], improves intestinal morphology [6, 11], and enhances the immune response [12]. Additionally, E. faecium prevents E. coli-induced intestinal disorders and manipulates the cecal microflora [1]. E. faecium can also elicit protective immune responses by inducing cytokines, and T and B lymphocytes against Salmonella spp. [8, 13]. However, there are limited published reports on the effects of E. faecium on E. coli-challenged broiler chickens. Hence, the present study was designed to investigate the effects of E. faecium on growth performance, intestinal barrier function, and the innate immune response in broilers challenged with E. coli O78.

Methods

Experimental Design

The experimental animal protocol in this study was approved by the Animal Care and Use Committee of China Agricultural University (permit number 20121209–1). A total of 216 1-day-old birds were randomly assigned into three groups with six replicates of each. Each replicate consisted of 12 birds. Treatments were set as follows: negative control birds were fed a basal diet and injected with sterile saline (0.2 ml) in the left thoracic air sac (C); positive control birds were fed a basal diet and challenged at 11 days of age with E. coli O78 [0.2 ml, 104 colony-forming unit (CFU)/ml] injected into the left thoracic air sac (EP) [2]; probiotic birds were fed a basal diet containing E. faecium and challenged with 0.2 ml, 104 CFU/ml E. coli O78 that was injected into the left thoracic air sac (EF). The basal diet formula met or exceeded the nutrient requirements for broiler chickens recommended by the National Research Council (1994) and the diet composition is listed in Table 1. The total feeding period was 20 days.

Table 1

Composition and nutrient level of diet

Items (%)	Content
Ingredient
Corn	56
Wheat	2
Soybean meal	34.5
Soybean oil	3.2
Dicalcium phosphate	1.85
Limestone	1.2
DL-Met	0.2
l-Lys-HCl	0.25
Sodium chloride	0.3
Choline chloride (50%)	0.2
Santoquin	0.05
Maifanite	0.03
Vitamin premixa	0.02
Trace mineral premixb	0.2
Nutrient and energy level
ME (Mcal/kg)	2.96
Protein	19.98
Calcium	0.97
Lysine	1.19
Methionine	0.51
Available phosphorus	0.43

aThe vitamin premix supplied the following (per kg of diet): vitamin A, 12500 IU; vitamin D3, 2500 IU; vitamin E 18.75 IU; vitamin K3, 2.65 mg; vitamin B1, 2 mg; vitamin B2, 6 mg; vitamin B6, 6 mg; vitamin B12, 0.025 mg; d-biotin, 0.0325 mg; folic acid, 1.25 mg; d-calcium pantothenate, 12 mg; nicotinic acid 50 mg

bThe trace mineral premix supplied the following (per kg of diet): copper, 8 mg; zinc,75 mg; iron, 80 mg; manganese,100 mg; selenium, 0.15 mg; iodine,0.35 mg

E. faecium NCIMB11181 Preparation

The E. faecium NCIMB11181 preparation used in this study was a commercial product purchased from Probiotics International Ltd. (Stoke Sub Hamdon, Somerset, UK), which contained a total bacteria count ≥ 2.00 × 1012 CFU/kg. Sample testing showed that the bacteria count was 8.2 × 1012 CFU/kg. The E. faecium product (200 mg/kg) was carefully mixed into the basal diet. The diets in this experiment were manufactured at the feed mill of China Agricultural University. Finally, the actual diet contained 5.1 × 1010 CFU/kg E. faecium.

E. coli O78 Preparation

The E. coli O78 (CVCC1555) used in this study was purchased from China General Microbiological Culture Collection Center, Beijing, China. The strain was aerobically incubated in Luria-Bacterial liquid medium for 24 h at 37 °C with shaking (120 rpm). Before the challenge, the bacteria were centrifuged at 2800×g for 10 min and washed three times with phosphate-buffered saline (PBS). The bacterial concentration was measured with a spectrometer at 600 nm. PBS was used to adjust the suspension to the desired bacterial concentration.

Sample Collection

On days 15 and 20, one bird of each replicate was randomly selected and euthanized by sodium pentobarbital (30 mg/kg). The small intestine was removed and gently flushed with PBS. Jejunum samples were collected for intestinal morphology, and mucosal antibody and mRNA expression. Liver samples for bacterial count and spleen samples for mRNA expression were taken. All samples for mRNA expression were immediately frozen in liquid nitrogen.

Growth Performance

Body weight (BW) for each replicate was measured on d1, d10 (the day before the challenge), d15 (3 days post-infection), and d20 (7 days post-infection). The average daily gain (ADG) was calculated during d1–10, d10–15, and d10–20. The death rate was calculated during d1–10 and d10–20.

Intestinal Morphology

Jejunum segments were fixed with 4% paraformaldehyde and embedded in paraffin after 48 h. For morphological examination, tissue sections (5 μm) were stained with hematoxylin and eosin. Nine complete villi were measured in each section. The villus height was measured from the tip of the villus to the villus-crypt junction, and crypt depth was measured from the bottom of the villus to the lamina propria. Then, the villus height/crypt depth ratio was calculated. All the observations and measurements were performed with an Olympus optical microscope and ProgRes CapturePro software (version 2.7; Jenoptik, Jena, Germany).

Mucosal IgA

Mucosal scraping was collected with sterile slides from two 5-cm jejunal samples and homogenized in saline. The secretory IgA (sIgA) concentration was measured by an ELISA kit (Bethyl Laboratories Inc., Montgomery, TX, USA) and the total protein of the mucosal homogenate was determined by a BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturers’ protocols. The sIgA concentration is presented as milligrams per gram of protein.

Liver Bacterial Count

Two hundred micrograms of liver tissue per sample was placed in 0.2 ml sterile saline and homogenized by a stomacher. Each homogenate was diluted from 10−1 to 10−6 with sterile saline. Each diluted sample (0.1 ml) was incubated on a MacConkey agar plate (Land Bridge Technology, Beijing, China) at 37 °C for 24 h. Plates containing 30–300 bacterial colonies were selected to count. The final number is shown as log10 (CFU/g tissue).

Peripheral Blood Mononuclear Cell Isolation

Blood was collected into heparin anticoagulant tubes on d15 and d20. Peripheral blood mononuclear cells (PBMCs) were separated by Ficoll solution (Histopaque1077; Sigma-Aldrich co., St. Louis, MO, USA). Uncoagulated blood was diluted with Hanks solution at 1:1 (no calcium and magnesium, Thermo Fisher Scientific) and layered on top of the Ficoll solution in a 10-ml centrifuge tube (2:1). After centrifugation for 30 min at 1000×g (20 °C), the PBMCs at the plasma-Ficoll interface were collected carefully. Then, cold RPMI-1640 medium (containing 5.0% inactivated fetal bovine serum, 0.0599 mg/ml penicillin, 100 μg/ml streptomycin, and 24 mM HEPES) was used to wash the PBMCs three times with centrifugation at 250×g for 10 min (4 °C). The PBMC count was evaluated by trypan blue staining.

Flow Cytometry for Lymphocyte Subpopulation Analysis

Peripheral lymphocytes contained in PBMC fraction as prepared above were stained with chicken CD3 (SPRD, clone: CT-3), CD4 (FITC, clone: CT-4), and CD8 (PE, clone: CT-8), and incubated in a water bath for 30 min. All the antibodies used in the study were purchased from SouthernBiotech (Birmingham, AL, USA). Then, lymphocytes were washed twice with Hanks solution and fixed with 3% paraformaldehyde solution. The analysis was conducted by a multi-channel cytometer (Beckman-Coulter, Carlsbad, CA, USA). The results are presented as the percentage of positive lymphocyte subpopulation with the specific antibody.

Lymphocyte Proliferative Responses

The method for PBMC isolation was described above. Trypan blue staining was used to evaluate cell count and viability. The proliferative response of T and B lymphocytes was measured by the MTT assay, after stimulation with Concanavalin A (Con A; from Canavalia ensiformis; Sigma-Aldrich) and lipopolysaccharides (LPS; from E. coli; Sigma-Aldrich), respectively. Results are expressed as stimulation index (SI).

Total RNA Extraction and Real-time Quantitative PCR

Total RNA of spleen and jejunal tissues was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. The RNA concentration was measured by a nanodrop spectrophotometer (ND-2000, Thermo Fisher Scientific) at 260 and 280 nm. The total RNA purity was verified by the 260 nm/280 nm ratio; the results of all samples were between 1.8 and 2.0. Then, 2 μg of total RNA was used for reverse transcription by a commercial kit (Takara Biotechnology Co. Ltd., Tokyo, Japan) following the manufacturer’s protocol. The complementary DNA was stored at − 20 °C.

The expression of inflammation-related genes and tight junction (TJ) genes in the spleen and jejunum were determined by real-time quantitative PCR (RT-PCR). Gene primer sequences are presented in Table 2. RT-PCR was performed on an Applied Biosystems 7500 Fast Real-time PCR System (Applied Biosystems, Carlsbad, CA, USA) using a commercial SYBR Green kit (Takara Biotechnology Co. Ltd.). According to the manufacturer’s protocol, the initial denaturation phase was set at 95 °C for 5 min followed by 40 cycles of 95 °C for 30 s and 60 °C for 30 s during annealing and extension. Melting curve analysis was used to evaluate the specificity of the amplified products. All the genes in this study were analyzed using GAPDH as an endogenous reference gene. The average gene expression level relative to GAPDH of each sample was calculated using the 2−ΔΔCt method.

Table 2

Primers for real-time quantitative PCR assay

Gene	Primer sequence (5′–3′)	Accession no.
Mucin-2	F: TTCATGATGCCTGCTCTTGTG	XM_421035
	R: CCTGAGCCTTGGTACATTCTTGT
ZO-1	F: CTTCAGGTGTTTCTCTTCCTCCTC	XM_413773
	R: CTGTGGTTTCATGGCTGGATC
Claudin-1	F: CATACTCCTGGGTCTGGTTGGT	AY750897.1
	R: GACAGCCATCCGCATCTTCT
Occludin	F: ACGGCAGCACCTACCTCAA	D21837.1
	R: GGGCGAAGAAGCAGATGAG
NF-κb	F: GTGTGAAGAAACGGGAACTG	NM205129
	R: GGCACGGTTGTCATAGATGG
PPARγ	F: GACCTTAATTGTCGCATCCAT	AF163811
	R: CGGGAAGGACTTTATGTATGA
TLR4	F: AGTCTGAAATTGCTGAGCTCAAAT	NM_001030693
	R: GCGACGTTAAGCCATGGAAG
TNF-α	F: GAGCGTTGACTTGGCTGTC	NM_204267
	R: AAGCAACAACCAGCTATGCAC
IL-1β	F: ACTGGGCATCAAGGGCTA	NM_204524
	R: GGTAGAAGATGAAGCGGGTC
IL-6	F: TTTATG GAGAAGACCGTGAGG	NM_204628
	R: TGTGGCAGATTGGTAACAGAG
IL-10	F: GCTGTCACCGCTTCTTCACCT	EF554720.1
	R: GGCTCACTTCCTCCTCCTCATC

F, forward; R, reverse

Statistical Analysis

Data were analyzed by one-way ANOVA using SPSS 17.0 software (version 17.0, SPSS Inc., Chicago, IL, USA). Statistical differences among treatments were examined by Duncan’s multiple range test. Results are presented as the mean ± SE. Differences were considered statistically significant at P < 0.05, and 0.05 < P < 0.1 was regarded as a trend towards significance.

Results

The growth performance parameters are shown in Fig. 1. Compared with the control group, E. faecium supplementation significantly increased the BW of chickens on d10 (P < 0.05) right before the E. coli challenge, and on d15 (3 days after the E. coli challenge). The EF birds had a greater ADG than the other birds during d1–10 (P < 0.05). The death rate was dramatically lower in the EF group compared with that in the EP group. However, the E. coli challenge markedly decreased the BW on d15 (P < 0.05) and the ADG during d10–15 (P < 0.05). The death rate of the EP group was the highest among all three groups. No significant differences were observed in BW on d1 and 20, and in the ADG from d10 to d20.

Fig. 1

Effects of dietary Enterococcus faecium on growth performance (body weight, average daily gain, and death rate) of broilers. C, birds fed with basal diet; EP, birds fed with basal diet and challenged with E. coli O78; EF = birds fed a basal diet supplemented with E. faecium and challenged with E. coli O78. Bars with letters (a–c) suggested significant difference among different treatments (P < 0.05)

According to Fig. 2(A), 3 and 7 days post-infection, the E. coli challenge significantly decreased the jejunal villus height (P < 0.05), and the birds in the EF group had a markedly higher jejunal villus height than those in the other groups (P < 0.05). The E. coli infection significantly increased the crypt depth 3 and 7 days post-infection (P < 0.05). E. faecium markedly increased the villus/crypt ratio (P < 0.05) 3 and 7 days post-infection. Histopathological changes (Fig. 2(B, C)) showed that the E.coli infection caused shedding and swelling of villus tip and increased crypt depth 3 and 7 days post-infection. The supplementation of E. faecium maintained intact structural of jejunum and increased villus height 3 and 7 days post-infection.

Fig. 2

Effects of Enterococcus faecium on the jejunum morphology of broilers. (A) Statistic data of villus height, crypt depth, and villus/crypt ratio (V/C). (B) and (C) Photomicrographs of jejunum contained from C, EP, and EF group, on day 3 and 7 post-infection, respectively (× 100). C, birds fed with basal diet; EP, birds fed with basal diet and challenged with E. coli O78; EF, birds fed a basal diet supplemented with E. faecium and challenged with E. coli O78. Bars with small letters (a–c) suggested significant difference among different treatments (P < 0.05)

Relative mRNA Expression of TJ Proteins and Mucin

The relative mRNA expression of different intestinal TJ proteins (zonula occludens-1, claudin-1, and occludin) and the Mucin2 gene is shown in Fig. 3. Mucin2 mRNA expression in the jejunum significantly decreased after E. coli infection (P < 0.05). However, the EF group showed a significant increase in Mucin2 mRNA 3 days post-infection (P < 0.05) and an increased tendency 7 days post-infection (P = 0.083). The E. coli infection and the E. faecium supplementation did not affect the zonola occludens-1 (ZO-1) mRNA expression 3 and 7 days post-infection (P > 0.05). E. faecium addition markedly increased claudin-1 mRNA expression 3 and 7 days post-infection (P < 0.05). The E. faecium supplementation also tended to upregulate occludin mRNA expression 3 and 7 days post-infection (P = 0.053 and P = 0.051, respectively).

Fig. 3

The expression of intestinal tight junction proteins and mucin2 gene in the jejunum. C, birds fed with basal diet; EP, birds fed with basal diet and challenged with E. coli O78; EF = birds fed a basal diet supplemented with E. faecium and challenged with E. coli O78. Bars with letters (a–c) suggested significant difference among different treatments (P < 0.05)

Evaluation of Cellular and Humoral Immunity

The peripheral blood lymphocyte phenotypes of the different treatments are summarized in Table 3. No remarkable differences were observed in the percentage of CD3+, CD4+, and CD8+ cells, as well as the ratio of CD4+/CD8+ among the three treatments 3 and 7 days post-infection (P > 0.05).

Table 3

Phenotyping of lymphocytes in peripheral blood of broilers in different treatments

Items	Treatments			SEM	P value
	C	EP	EF
3 dpi
CD3+	52.1 ± 5.69	59.58 ± 2.96	53.53 ± 4.28	2.521	0.481
CD4+	31.78 ± 3.38	36.5 ± 2.11	34.6 ± 2.81	1.582	0.515
CD8+	19.28 ± 2.34	20.43 ± 0.82	17.13 ± 2.05	1.052	0.472
CD4+/CD8+	1.66 ± 0.06	1.79 ± 0.11	2.16 ± 0.41	0.145	0.375
7 dpi
CD3+	86.43 ± 2.16	84.35 ± 2.58	87.38 ± 0.96	1.122	0.577
CD4+	60.1 ± 1.38	55.9 ± 1.79	59.38 ± 1.42	0.976	0.176
CD8+	25.58 ± 1.49	27.05 ± 1.43	29.33 ± 0.3	0.784	0.142
CD4+/CD8+	2.38 ± 0.15	2.08 ± 0.08	2.03 ± 0.06	0.073	0.094

C, birds fed with basal diet; EP, birds fed with basal diet and challenged with E. coli O78; EF, birds fed a basal diet supplemented with E. faecium and challenged with E. coli O78

The function of peripheral blood lymphocytes among the three treatments 3 days post-infection was tested in vitro (Table 4). The proliferative response of T lymphocytes was not affected by E. coli infection or E. faecium supplementation (P > 0.05), as evidenced by ConA SI. However, E. faecium significantly increased the LPS SI (P < 0.05), which reflects the active response of B lymphocyte proliferation in the EF group.

Table 4

The function of peripheral blood lymphocytes of broilers in different treatments on day 3 post-infection

Items	Treatments			SEM	P value
	C	EP	EF
ConA SI	0.7 ± 0.070	0.66 ± 0.020	0.78 ± 0.040	0.030	0.212
LPS SI	0.73 ± 0.05b	0.68 ± 0.02b	1.15 ± 0.14a	0.088	0.023

a, bMeans in the same row, values with different small letter superscripts, show significant difference (P < 0.05)

C, birds fed with basal diet; EP, birds fed with basal diet and challenged with E. coli O78; EF, birds fed a basal diet supplemented with E. faecium and challenged with E. coli O78

Intestinal Immune Responses (sIgA)

The concentration of the jejunum sIgA was not influenced by either the E. coli challenge or the E. faecium supplementation 3 and 7 days post-infection (P > 0.05) (data not shown).

Spleen Inflammation-Related Gene Expression

The relative mRNA expression levels of spleen immune cytokines are presented in Fig. 4. Three days post-infection, the E. coli challenge significantly increased the expression of nuclear factor-κB (NF-κB), peroxisome proliferator-activated receptor-γ (PPAR-γ), toll-like receptor 4 (TLR4), IL-1β, and IL-6 (P < 0.05) and tended to increase the expression of TNF-α (P = 0.052). The E. faecium supplementation markedly decreased the expression of NF-κB, TLR4, IL-1β, and IL-6 (P < 0.05), and significantly enhanced the expression of PPAR-γ and IL-10 (P < 0.05). Seven days post-infection, the EP birds had remarkably higher expression levels of NF-κB, PPAR-γ, TLR4, and IL-1β (P < 0.05). Furthermore, the E. coli infection tended to increase the expression of TNF-α and IL-6 (P = 0.057 and P = 0.092, respectively). Dietary addition of E. faecium significantly elevated the expression of NF-κB, PPAR-γ, and IL-10 (P < 0.05), and downregulated the expression of TLR4 and IL-1β (P < 0.05). The birds in the EF group had a relatively lower TNF-α and IL-6 expression (P = 0.057 and P = 0.092, respectively).

Fig. 4

Relative mRNA expression levels of spleen inflammation-related cytokines of broilers in different treatments. C, birds fed with basal diet; EP, birds fed with basal diet and challenged with E. coli O78; EF, birds fed a basal diet supplemented with E. faecium and challenged with E. coli O78. Bars with letters (a–c) suggested significant difference among different treatments (P < 0.05)

Liver Bacterial Translocation

As presented in Fig. 5, E. coli infection caused considerable liver bacterial translocation in broiler chickens. The E. coli challenge significantly increased the liver E. coli number (P < 0.05) 3 and 7 days post-infection. Compared with the EP group, the EF group had a markedly lower number of liver E. coli (P < 0.05) 3 and 7 days post-infection.

Fig. 5

Liver bacterial translocation of E. coli in broilers (log10 cfu/g). C, birds fed with basal diet; EP, birds fed with basal diet and challenged with E. coli O78; EF, birds fed a basal diet supplemented with E. faecium and challenged with E. coli O78. Bars with letters (a–c) suggested significant difference among different treatments (P < 0.05)

Discussion

Probiotics have been proven to be beneficial for broiler breeding [14, 15]. E. faecium is a Lactobacillus genus that shows many positive effects on broiler growth and immunity [6, 7, 11, 12].

E. coli is a Gram-negative bacterium and its core pathogenic element is LPS [5, 16]. LPS can trigger system inflammation and cause death. Inflammation limits the synthesis of muscle protein and mobilizes energy to support the immune response, resulting in poor growth [16]. In the present study, chickens infected with E. coli O78 had a lower BW and ADG 3 days post-infection and the highest death rate during the entire feeding period. Many studies have shown that E. faecium can improve broiler performance [6, 9]. Cao et al. [1] have indicated that E. faecium enhanced chicken growth performance after an E. coli K88 challenge. Similarly, we showed that dietary E. faecium supplementation increased BW and ADG both before and 3 days post-infection and decreased the death rate.

Intestinal morphology reflects the health and integrity of the alimentary tract. A decreasing crypt size indicates the reconstruction of intestinal villus by accelerating the regenerative rate of enterocytes [14]. Therefore, the gut can resist devastating damage by pathogens or toxins. However, increased villus suggests the expansion of the intestinal absorption area, accumulation of mature enterocytes, and strengthening of the absorption and digestion ability [17]. Zhang et al. [5] have found that an E. coli K88 challenge disrupted intestinal morphology. Furthermore, E. faecium efficiently improved the intestinal mucosal architecture by increasing the villus height and decreasing the crypt depth [6]. According to Jin et al. [10], E. faecium can inhibit the adhesion of E. coli to enterocytes potentially through modifying the lumen pH and altering steric hindrance. Cao et al. [1] have reported that E. faecium was beneficial for the jejunal morphology of E. coli K88-challenged broilers compared with the control and antibiotic groups. Consistently, we showed that the addition of E. faecium improved the intestinal histomorphology with an increased V:C ratio and villus height in the challenged birds 3 and 7 days post-infection.

The intestinal mechanical barrier, which is composed of enterocytes and TJs, plays a key role in the natural defense against pathogen invasion [18, 19]. The major TJ proteins, including occludin, claudin and zonula occludens (ZO), and junctional adhesion molecule (JAM) [20], play an important role in maintaining intestinal permeability and the mucosal barrier function by sealing the extracellular space between the epithelial cells. In this study, the E. coli O78 challenge significantly reduced the expression of claudin-1 3 and 7 days post-infection, which is consistent with the findings of Gadde et al. [21] and Lee et al. [22], who showed that LPS treatment decreased the expression of TJ proteins. Probiotics have been proven to enhance TJ protein excretion and strengthen the mucosal barrier [23]. Feeding chickens with E. faecium upregulated the expression of claudin-1 3 and 7 days post-infection. The mucosal layer above the gastrointestinal tract is the chemical barrier of the intestine and mucins are the fundamental components [24]. Mucin-2, acting as a major mucin gene in the small intestine, was significantly increased 3 days post-infection by the E. faecium supplementation in the present study. This result is consistent with Gadde et al. [21], who revealed that probiotics increased the expression of the Mucin2 gene in LPS-challenged chickens. These results suggest that E. faecium addition counteracted the detrimental effects of E. coli, and significantly enhanced claudin-1 and Mucin2 expression, especially at the early infection stage. However, E. faecium did not affect the gene expression of other TJ proteins.

The spleen, a vital immune organ involved in both cellular and humoral immune responses, is important for lymphocyte generation, maturation, and storage [25]. Thus, immune-mediated spleen gene expression is considered to be an indicator of system immunity [26]. LPS is the primary cytoderm component of Gram-negative bacteria, and the LPS endotoxin serves as an activator of the innate immune response [27]. E. coli O78 can release LPS. Pattern recognition receptors (PRRs) have been selected to recognize the conserved elements of pathogens during the process of evolution [28]. TLRs are crucial members of PRRs and TLR4 can recognize LPS [29]. After binding to LPS, avian TLR4 triggers a cascade of inflammation responses via the myeloid differentiation factor 88 (MyD88)-dependent signaling pathway, which results in NF-κB activation [30]. NF-κB is the key factor in the regulation of the secretion of various cytokines and inflammatory mediators [31]. Many studies have used LPS injection to trigger a pro-inflammatory cytokine response in broiler chickens [16, 27, 31, 32], which resulted in activated TLR4. Similarly, in the current study, the infection of E. coli O78 significantly increased the expression of TLR4 and NF-κB 3 and 7 days post-infection. PPARs are key regulators of inflammatory and immune responses [16]. Cumulative research has proven that PPAR-γ ligands can inhibit major inflammation signaling pathways such as NF-κB, which implies the anti-inflammatory effect of PPAR-γ [33]. We found that E. faecium supplementation downregulated the expression of TLR4 and NF-κB, and upregulated PPAR-γ expression 3 and 7 days post-infection, which is consistent with the results by Gadde et al. [21].

Pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α regulate the immune response by inducing differentiation and proliferation of leukocytes to eliminate pathogens [34]. However, excessive secretion leads to organ damage and exacerbated energy consumption [34]. Thus, the suppression of IL-1β, IL-6, and TNF-α by dietary E. faecium supplementation in the current study may alleviate system inflammation. Conversely, Cao et al. [1] have indicated that E. faecium had no effect on the immune response to an E. coli K88 challenge. Different challenge approaches and measuring methods may be the reasons for this discrepancy. However, IL-10, which is a critical anti-inflammatory cytokine, acts as an inflammation feedback factor to modulate the immune response [35]. An LPS challenge suppressed the expression of anti-inflammatory cytokines [16, 21]. Our study found the same downregulation of IL-10 expression after E. coli O78 infection. Siepert et al. [12] have suggested that E. faecium supplementation elevated IL-10 expression. In the present study, addition of E. feacium markedly increased the IL-10 gene expression. Hence, we assume that E. feacium might regulate the NF-κB pathway by interacting with TLR4 and PPAR-γ, to alleviate the system inflammation caused by E. coli O78 infection.

Cellular and humoral immunity is the primary defense mechanism to obliterate pathogens [13]. CD4+ and CD8+ T cells play an important role in the cellular immune response. CD4+ T lymphocytes enhance the intercellular killing by macrophages and promote the expansion of cytotoxic T lymphocytes. CD8+ T lymphocytes are mainly involved in the elimination of antigens. CD3+ presents a surface marker of mature T lymphocytes [36]. The ratio of CD4+/CD8+ indicates the level of cell immunity [8]. The effect of E. faecium on animal immunity is controversial. Wang et al. [37] have demonstrated that the E. faecium supplementation elevated the activation of T helper lymphocytes and cytotoxic T lymphocytes in the peripheral blood of piglets infected with swine influenza. Levkut et al. [8] have indicated that E. faecium addition increased the number of CD3+, CD4+, and CD8+ cells in the peripheral blood of broiler chickens challenged with Salmonella enteritidis. In contrast, Kreuzer et al. [38] have found that E. faecium had no effect on the cellular immune response in lymph nodes and blood of piglets subjected with Salmonella enterica. In the current study, the differences in CD3+, CD4+, CD8+, and CD4+/CD8+ were not obvious among the three treatments, both 3 and 7 days post-infection. This result suggests that E. faecium may have a limited effect on immune mediation. Alternatively, it may be that cellular immunity has a minor effect on extracellular bacteria such as E. coli. At the early infection stage, the result of lymphocyte proliferative responses indicated that dietary E. faecium supplementation had no effect on T lymphocytes, as shown by ConA SI, whereas it significantly elevated B lymphocyte proliferation, as shown by LPS SI. Therefore, these results further indicate that the protective immune response evoked by E. faecium mainly focused on humoral immunity rather than cellular immunity. Interestingly, the E. coli O78 challenge reduced the LPS SI. According to Shini et al. [39], the endotoxins released by LPS induce degeneration and destruction of lymphocytes in birds. SIgA is a crucial immunoglobulin that serves as the first line of defense against pathogens [40]. Several studies have shown that probiotics can increase intestinal IgA excretion [40, 41]. However, the E. faecium supplementation did not result in overt upregulation of sIgA, both 3 and 7 days post-infection, which was similar to a previous study using the same challenging pathogen [1].

Bacterial translocation, defined as intestinal bacteria moving from the lumen to the mesentery or other parenteral organs, occurs frequently in damaged intestine [42]. Therefore, bacterial translocation is a useful indicator of the integrity of the intestinal structure [43]. In the present study, E. faecium supplementation markedly decreased the number of E. coli colonies in the liver of broiler chickens challenged with E. coli O78 3 and 7 days post-infection. The results manifested that E. faecium had the ability to maintain the intestinal integrity and limit the high permeability of the intestine caused by E. coli infection.

Conclusions

Dietary E. faecium supplementation improved the growth performance and reduced the death rate of broiler chickens by enhancing the humoral immune response, modulating inflammatory cytokine secretion, enhancing TJ proteins’ expression, and maintaining the intestinal barrier against E. coli O78 infection. The beneficial effects of E. faecium may be partially associated with its effects on intestinal integrity and system humoral immunity. More studies are needed to further explore the potential mechanism of E. faecium in intestinal immunity.