Literature DB >> 29932422

Host autophagy machinery is diverted to the pathogen interface to mediate focal defense responses against the Irish potato famine pathogen.

Yasin F Dagdas1,2, Pooja Pandey3, Yasin Tumtas3, Nattapong Sanguankiattichai3, Khaoula Belhaj1, Cian Duggan3, Alexandre Y Leary3, Maria E Segretin4, Mauricio P Contreras3,4, Zachary Savage3, Virendrasinh S Khandare3, Sophien Kamoun1, Tolga O Bozkurt3.   

Abstract

During plant cell invasion, the oomycete Phytophthora infestans remains enveloped by host-derived membranes whose functional properties are poorly understood. P. infestans secretes a myriad of effector proteins through these interfaces for plant colonization. Recently we showed that the effector protein PexRD54 reprograms host-selective autophagy by antagonising antimicrobial-autophagy receptor Joka2/NBR1 for ATG8CL binding (Dagdas et al., 2016). Here, we show that during infection, ATG8CL/Joka2 labelled defense-related autophagosomes are diverted toward the perimicrobial host membrane to restrict pathogen growth. PexRD54 also localizes to autophagosomes across the perimicrobial membrane, consistent with the view that the pathogen remodels host-microbe interface by co-opting the host autophagy machinery. Furthermore, we show that the host-pathogen interface is a hotspot for autophagosome biogenesis. Notably, overexpression of the early autophagosome biogenesis protein ATG9 enhances plant immunity. Our results implicate selective autophagy in polarized immune responses of plants and point to more complex functions for autophagy than the widely known degradative roles.
© 2018, Dagdas et al.

Entities:  

Keywords:  RXLR Effector; autophagosome; cell biology; defense-related autophagy; effector biology; haustoria; nicotiana benthamiana; phytophthora infestans; plant biology; plant immunity; selective autophagy

Mesh:

Substances:

Year:  2018        PMID: 29932422      PMCID: PMC6029844          DOI: 10.7554/eLife.37476

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Plants intimately interact with a diverse range of pathogens, which typically produce specialized structures, such as haustoria, to invade the host cell space (Panstruga and Dodds, 2009). These specialized structures are surrounded by membranes derived from the host endomembrane system (Bozkurt et al., 2015, 2014; Whisson et al., 2016; Bozkurt et al., 2011), which mediate inter-organismal communication enabling nutrient and macromolecule trafficking (Wang et al., 2017; Dagdas et al., 2016; Micali et al., 2011; Koh et al., 2005; Le Fevre et al., 2015; Gutjahr and Parniske, 2013; Pumplin et al., 2012). However, our understanding of the origin and biogenesis of these host-microbe interfaces remains limited. In particular, the extent to which host accommodation membranes are shaped by the invading microbes is unclear. Similar to many other filamentous plant pathogens, the potato late blight pathogen Phytophthora infestans produces haustoria, hyphal extensions that invaginate the host cell membrane (Whisson et al., 2016). Strikingly, the host accommodation membrane, also known as the extrahaustorial membrane (EHM) sharply contrasts with the adjacent plasma membrane in both protein and lipid composition (Bozkurt et al., 2014; Lu et al., 2012; Schornack et al., 2009). Thus, the EHM is not uniform, and multiple membrane sources probably contribute to its biogenesis (Bozkurt et al., 2015). The emerging model is that multiple trafficking pathways are diverted to haustoria with some degree of specificity. Macroautophagy (hereafter called autophagy) is an evolutionary conserved membrane trafficking pathway that mediates removal or relocation of cytoplasmic components (Stolz et al., 2014). Bulk autophagy, typically activated by starvation, involves non-selective engulfment of cytoplasmic materials to double membrane vesicles called autophagosomes, which are then carried to the vacuole for recycling. In contrast, selective-autophagy employs specialized autophagy cargo receptors that bind ATG8 on autophagosome membranes, and recruit specific cargoes to autophagosomes (Lamb et al., 2013). For instance, to destroy viral particles and restrict viral infection, the plant autophagy cargo receptor Joka2/NBR1 activates antimicrobial autophagy, also known as xenophagy (Hafrén et al., 2017). Similarly, we recently showed that Joka2/NBR1 mediated selective autophagy pathway contributes to defense against P. infestans. However, the molecular basis of this Joka2/NBR1 mediated defense-related autophagy remains unknown (Dagdas et al., 2016). To counteract selective autophagy, P. infestans deploys PexRD54, a secreted protein that belongs to the large RXLR-WY family of virulence effectors (Dagdas et al., 2016). PexRD54 carries an ATG8 interacting motif (AIM) and attenuates defense-related autophagy by depleting Joka2 from autophagosomes (Dagdas et al., 2016). Interestingly, both PexRD54 and Joka2 preferably bind and stimulate formation of autophagosomes marked by potato ATG8CL over ATG8IL, highlighting the selective nature of the process (Dagdas et al., 2016). However, the fate of PexRD54 and Joka2 labelled autophagosomes during pathogen attack remains to be elucidated.

Results

ATG8CL-autophagosomes localise to haustoria in infected plant cells

To investigate subcellular dynamics of autophagy during infection, we first visualized transiently expressed GFP:ATG8CL in N. benthamiana leaf epidermal cells during P. infestans infection. GFP:ATG8CL labelled autophagosomes frequently accumulated around the haustoria (73% of observations, N = 60) labelled by the EHM marker REM1.3 (Figure 1A), whereas in uninfected cells ATG8CL labelled randomly distributed puncta and the central vacuole (Figure 1—figure supplement 1A–B). We previously showed that the EHM could be discriminated from the cytosol and adjacent vacuolar membrane (tonoplast) (Bozkurt et al., 2015). Time-lapse microscopy imaging of haustoriated cells in which the tonoplast and EHM are slightly parted away from each other revealed that perihaustorial ATG8CL-autophagosomes with varying size and shape remain tightly associated with the EHM (Figure 1—figure supplement 2A–C and Video 1). Unlike GFP:ATG8CL, autophagy deficient GFP:ATG8CLΔ mutant failed to accumulate around the haustoria (Figure 1B). GFP:ATG8CLΔ appeared randomly distributed as puncta that occurred around haustoria in only 14% of the observations (N = 51) and did not associate with the EHM (Figure 1B, Figure 1—figure supplement 1C). The GFP control construct showed only diffuse cytoplasmic signal and did not label any perihaustorial puncta (0% N = 20) (Figure 1C). To test whether other autophagosomes are targeted toward the haustoria, we investigated subcellular localisation of ATG8IL labelled autophagosomes. Unlike frequently observed GFP:ATG8CL puncta (73% of observations, N = 60) that is abundantly present around the haustoria (Figure 1A), GFP:ATG8IL appeared in only 28% the imaged haustoria (N = 65), typically with no more than a few puncta (Figure 1D). Taken together, these results demonstrate that during pathogen infection ATG8CL-autophagosomes are selectively directed toward the pathogen interface.
Figure 1.

ATG8CL-autophagosomes accumulate around the haustoria.

GFP:ATG8CL, GFP:ATG8CLΔ, GFP:EV (empty vector) or GFP:ATG8IL are co-expressed with the EHM marker RFP:REM1.3 via agroinfiltration in N. benthamiana leaves infected with P. infestans. Confocal laser scanning microscopy (CLSM) was used to monitor the autophagosomes in haustoriated cells 3–4 days post infection (dpi). (A) GFP:ATG8CL frequently showed perihaustorial puncta whereas (B) autophagy deficient GFP:ATG8CLΔ appeared as randomly distributed puncta, which failed to accumulate around haustoria (C) GFP:EV did not show any punctate localisation and only labelled perihaustorial cytoplasm (D) GFP:ATG8IL, a divergent member of the ATG8 family, remained mostly cytoplasmic and rarely labelled perihaustorial puncta. Multiple optical sections that fully cover the haustoria are obtained to monitor perihaustorial puncta. Images shown are maximal projections of 16, 10, 15, and 11 frames with 1 μm steps for the top, upper middle, lower middle and bottom rows, respectively. Arrowheads point to haustoria. Scale bars, 10 μm.

(A–B) In uninfected N. benthamiana epidermal cells BFP:ATG8CL labels randomly distributed puncta (Arrowheads) and central vacuole (engulfed by dotted white lines) (A), unlike BFP and RFP vector controls (B). Images were obtained three dpi. The intensity plots demonstrate relative BFP and RFP fluorescence signals along the dotted line connecting points a-b; BFP:ATG8CL fluorescence intensity is detected throughout central vacuole unlike RFP:EV, which peaks at cytoplasm (cyt.) (top right panel). In contrast. BFP:EV only shows a peak at the cytoplasm overlapping with the RFP:EV signal (bottom right panel).

(A-C) Single focal plane CLSM images show regions where the EHM and the tonoplast (dotted white line in B and C) are parted away and the cytosol is no longer a thin layer between the two membranes. (A–B) GFP:ATG8CL labelled autophagosomes with varying size and shape associated with the EHM marked by RFP:REM1.3, (C) unlike the GFP:ATG8CLΔ mutant. Images were obtained three dpi. Arrowheads point to autophagosomes in contact with the EHM.

Figure 1—figure supplement 1.

ATG8CL traffics vacuole in uninfected cells.

(A–B) In uninfected N. benthamiana epidermal cells BFP:ATG8CL labels randomly distributed puncta (Arrowheads) and central vacuole (engulfed by dotted white lines) (A), unlike BFP and RFP vector controls (B). Images were obtained three dpi. The intensity plots demonstrate relative BFP and RFP fluorescence signals along the dotted line connecting points a-b; BFP:ATG8CL fluorescence intensity is detected throughout central vacuole unlike RFP:EV, which peaks at cytoplasm (cyt.) (top right panel). In contrast. BFP:EV only shows a peak at the cytoplasm overlapping with the RFP:EV signal (bottom right panel).

Figure 1—figure supplement 2.

ATG8CL-autophagosomes associate with the EHM.

(A-C) Single focal plane CLSM images show regions where the EHM and the tonoplast (dotted white line in B and C) are parted away and the cytosol is no longer a thin layer between the two membranes. (A–B) GFP:ATG8CL labelled autophagosomes with varying size and shape associated with the EHM marked by RFP:REM1.3, (C) unlike the GFP:ATG8CLΔ mutant. Images were obtained three dpi. Arrowheads point to autophagosomes in contact with the EHM.

Video 1.

ATG8CL-autophagosomes accumulate around the haustoria and remain associated with the EHM.

GFP:ATG8CL is co-expressed with the EHM marker RFP:REM1.3 via agroinfiltration in N. benthamiana leaves infected with P. infestans. Confocal laser scanning microscopy was used to monitor the autophagosomes in haustoriated cells three dpi (days post infection). The movie represents time-lapse of maximal projections of 9 frames with 1.5 μm steps acquired during 15 min (Frame interval: 27 s).

ATG8CL-autophagosomes accumulate around the haustoria.

GFP:ATG8CL, GFP:ATG8CLΔ, GFP:EV (empty vector) or GFP:ATG8IL are co-expressed with the EHM marker RFP:REM1.3 via agroinfiltration in N. benthamiana leaves infected with P. infestans. Confocal laser scanning microscopy (CLSM) was used to monitor the autophagosomes in haustoriated cells 3–4 days post infection (dpi). (A) GFP:ATG8CL frequently showed perihaustorial puncta whereas (B) autophagy deficient GFP:ATG8CLΔ appeared as randomly distributed puncta, which failed to accumulate around haustoria (C) GFP:EV did not show any punctate localisation and only labelled perihaustorial cytoplasm (D) GFP:ATG8IL, a divergent member of the ATG8 family, remained mostly cytoplasmic and rarely labelled perihaustorial puncta. Multiple optical sections that fully cover the haustoria are obtained to monitor perihaustorial puncta. Images shown are maximal projections of 16, 10, 15, and 11 frames with 1 μm steps for the top, upper middle, lower middle and bottom rows, respectively. Arrowheads point to haustoria. Scale bars, 10 μm.

ATG8CL traffics vacuole in uninfected cells.

(A–B) In uninfected N. benthamiana epidermal cells BFP:ATG8CL labels randomly distributed puncta (Arrowheads) and central vacuole (engulfed by dotted white lines) (A), unlike BFP and RFP vector controls (B). Images were obtained three dpi. The intensity plots demonstrate relative BFP and RFP fluorescence signals along the dotted line connecting points a-b; BFP:ATG8CL fluorescence intensity is detected throughout central vacuole unlike RFP:EV, which peaks at cytoplasm (cyt.) (top right panel). In contrast. BFP:EV only shows a peak at the cytoplasm overlapping with the RFP:EV signal (bottom right panel).

ATG8CL-autophagosomes associate with the EHM.

(A-C) Single focal plane CLSM images show regions where the EHM and the tonoplast (dotted white line in B and C) are parted away and the cytosol is no longer a thin layer between the two membranes. (A–B) GFP:ATG8CL labelled autophagosomes with varying size and shape associated with the EHM marked by RFP:REM1.3, (C) unlike the GFP:ATG8CLΔ mutant. Images were obtained three dpi. Arrowheads point to autophagosomes in contact with the EHM.

ATG8CL-autophagosomes accumulate around the haustoria and remain associated with the EHM.

GFP:ATG8CL is co-expressed with the EHM marker RFP:REM1.3 via agroinfiltration in N. benthamiana leaves infected with P. infestans. Confocal laser scanning microscopy was used to monitor the autophagosomes in haustoriated cells three dpi (days post infection). The movie represents time-lapse of maximal projections of 9 frames with 1.5 μm steps acquired during 15 min (Frame interval: 27 s).

Accumulation of perihaustorial ATG8CL-autophagosomes is dependent on the core autophagy machinery

To determine the extent to which the core autophagy machinery contributes to the formation of perihaustorial ATG8CL-puncta, we employed RNA interference (RNAi) to knockdown gene expression of the core ATG components ATG4 or ATG9 (Lamb et al., 2013). We quantified haustoria associated with GFP:ATG8CL puncta upon silencing of ATG4 or ATG9, both of which mediate autophagosome biogenesis and maturation. We observed a notable reduction in frequency of perihaustorial ATG8CL-autophagosomes when ATG4 (31.6% ± 6.2) or ATG9 (39.3 ± 5.2%) is silenced compared to negative control (GUS gene silencing, 63 ± 1.5%) (Figure 2, Figure 2—figure supplement 1). These results indicate that the core autophagy machinery is required for perihaustorial accumulation of ATG8CL labelled autophagosomes.
Figure 2.

ATG4 and ATG9 are required for perihaustorial accumulation of ATG8CL autophagosomes.

(A–D) In infected leaf patches, GFP:ATG8CL is co-expressed with RFP:REM1.3 in the presence of hairpin RNAi constructs targeting ATG4, ATG9 or control GUS. CSLM analyses of three independent experiments revealed that perihaustorial accumulation of autophagosomes are significantly reduced when ATG9 (A) or ATG4 (B) is silenced compared to GUS (C) silencing. Images shown are maximal projections of 12, 10 and 9 frames with 1 μm steps from top to bottom rows, respectively. Arrowheads point to haustoria. Scale bars, 10 μm. Images were obtained 3–4 dpi. (D) Quantification of perihaustorial ATG8CL-puncta upon ATG9, ATG4 or GUS silencing.

Constructs carrying hairpin plasmids (pRNAi-GG) targeting NbATG4, NbATG9a/b or GUS were infiltrated to N. benthamiana and the expression of targeted genes was assessed by RT-PCR at three days post silencing. RT-PCR verified efficient gene silencing of NbATG4, NbATG9a and NbATG9b. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as internal control for silencing. RT-PCR band sizes are 431, 330, 424, and 220 base pairs for ATG4, ATG9A, ATG9B, and GAPDH respectively.

Figure 2—figure supplement 1.

Validation of ATG4 and ATG9 knockdowns.

Constructs carrying hairpin plasmids (pRNAi-GG) targeting NbATG4, NbATG9a/b or GUS were infiltrated to N. benthamiana and the expression of targeted genes was assessed by RT-PCR at three days post silencing. RT-PCR verified efficient gene silencing of NbATG4, NbATG9a and NbATG9b. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as internal control for silencing. RT-PCR band sizes are 431, 330, 424, and 220 base pairs for ATG4, ATG9A, ATG9B, and GAPDH respectively.

ATG4 and ATG9 are required for perihaustorial accumulation of ATG8CL autophagosomes.

(A–D) In infected leaf patches, GFP:ATG8CL is co-expressed with RFP:REM1.3 in the presence of hairpin RNAi constructs targeting ATG4, ATG9 or control GUS. CSLM analyses of three independent experiments revealed that perihaustorial accumulation of autophagosomes are significantly reduced when ATG9 (A) or ATG4 (B) is silenced compared to GUS (C) silencing. Images shown are maximal projections of 12, 10 and 9 frames with 1 μm steps from top to bottom rows, respectively. Arrowheads point to haustoria. Scale bars, 10 μm. Images were obtained 3–4 dpi. (D) Quantification of perihaustorial ATG8CL-puncta upon ATG9, ATG4 or GUS silencing.

Validation of ATG4 and ATG9 knockdowns.

Constructs carrying hairpin plasmids (pRNAi-GG) targeting NbATG4, NbATG9a/b or GUS were infiltrated to N. benthamiana and the expression of targeted genes was assessed by RT-PCR at three days post silencing. RT-PCR verified efficient gene silencing of NbATG4, NbATG9a and NbATG9b. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as internal control for silencing. RT-PCR band sizes are 431, 330, 424, and 220 base pairs for ATG4, ATG9A, ATG9B, and GAPDH respectively.

Defense-related selective autophagy mediated by Joka2 is diverted towards haustoria

To investigate focal accumulation of defense-related autophagy components at the pathogen/host interface, we investigated subcellular localisation of Joka2-autophagosomes in haustoriated cells. Joka2 is a modular protein with multiple domains including an N-terminal Phox and Bem1 (PB1) domain, central zinc finger (ZZ) and NBR1 domains followed by two C-terminal ubiquitin-associated domains (UBA) that flank an AIM (Zientara-Rytter and Sirko, 2014). PB1 and ZZ domains are implicated in self-oligomerisation and protein-protein interactions, whereas UBA domains and the AIM bridge Joka2 to the autophagic machinery and the ubiquitinated cargo (Figure 3A). Autophagosomes labelled by the full length Joka2 fused to BFP (Joka2:BFP) accumulated around the haustoria at high frequency (92%, N = 50) and localised to the EHM, unlike the BFP vector control (Figure 3B and Figure 3—figure supplement 1A–B). Intriguingly, Joka2AIM:BFP mutant also labelled perihaustorial puncta, although at lower frequency (74%, N = 42) compared to Joka2:BFP (Figure 3C). Furthermore, a Joka2 truncate lacking the PB1 and ZZ domains, but retaining the ubiquitin binding and ATG8 interacting motifs (Joka2Δ1-487) showed distribution similar to the BFP vector control and failed to accumulate at the pathogen interface (1%, N = 72) (Figure 3D,E). This was not due to reduced protein stability as Joka2:BFPΔ1-487 accumulated at similar protein levels compared to Joka2:BFP (Figure 3—figure supplement 2). These findings suggest that Joka2-ATG8 interaction is not sufficient for Joka2's recruitment to the perihaustorial puncta and Joka2's oligomerisation and/or association with other proteins mediated by PB1 and ZZ domains are critical for its haustorial accumulation.
Figure 3.

Joka2-mediated antimicrobial autophagy is directed toward the haustoria.

(A) Joka2 domain architecture (B–E) Confocal microscopy of P. infestans infected N. benthamiana leaf epidermal cells expressing Joka2:BFP, Joka2AIM:BFP mutant, Joka2Δ1-487:BFP or BFP:EV control. Both Joka2:BFP (top panel) and Joka2AIM:BFP (mid panel) displayed perihaustorial puncta although the frequency of the later was much lower. Consistently, Joka2Δ1-487:BFP mainly showed cytoplasmic distribution similar to BFP:EV control and rarely marked perihaustorial puncta (1.3% of imaged haustoria). Images shown are maximal projections of 10, 14, 10 and 7 frames with 1 μm steps from top to bottom rows, respectively. Arrowheads point to haustoria. Scale bars, 10 μm. Images were obtained 3–4 dpi. (F–G) Full length Joka2 enhances disease resistance against P. infestans, whereas Joka2Δ1-487, which does not accumulate around haustoria (D), only provides partial resistance. (F) N. benthamiana leaves expressing Joka2, Joka2Δ1-487 and empty vector (EV) control were infected with P. infestans and pathogen growth was determined by measuring infection lesion size eight days post-inoculation. (G) Categorical scatter plots illustrate infection lesion size of 8–10 infections sites from six independent biological replicates pointed out by six different colours. Welch Two Sample t-test revealed a significant difference (***p=0.0126) in disease resistance conferred by Joka2 compared to Joka2Δ1-487.

(A) Single focal plane CSLM image of a haustoriated plant cell marked by RFP:REM1.3 in which Joka2:BFP/GFP:ATGCL co-labelled autophagosomes accumulate across the EHM. Arrowheads point to autophagosomes in contact with the EHM. Scale bar, 10 μm. Image is obtained three dpi. (B) Across the EHM, BFP:EV control do not produce any punctate signal that overlap with GFP:ATG8CL-autophagosomes. Arrowheads point to GFP:ATG8CL labelled autophagosomes in contact with the EHM. Scale bars, 10 μm. Images are obtained three dpi. PM: plasma membrane.

Western blot detection of Joka2Δ1-487 and Joka2 constructs using anti Anti-tRFP antibody (Evrogen) and anti-HA antibody (Chromotek) from total protein extracts of N. benthamiana leaves two days after agroinfiltration. * indicates expected protein band (Joka2:BFP, 120 kDa; Joka2Δ1-487:BFP, 68 kDa; BFP:EV, 27 kDa; Joka2:3xHA, 98 kDa; Joka2Δ1-487:3xHA, 45 kDa; 3xHA:EV, 3.6 kDa). LC: loading control.

GFP:ATG8CL labelled perihaustorial autophagosomes fully overlapped with the Joka2:BFP labelled puncta (A), whereas Joka2AIM:BFP generally did not label GFP:ATG8CL autophagosomes (B) similar to BFP:EV control (C). Images shown are maximal projections of 11, 10 and 8, frames with 1 μm steps from top to bottom panels, respectively. Arrowheads point to haustoria. Scale bars, 10 μm. Images are obtained three dpi.

P. infestans infection is associated with a decrease in Joka2 degradation. Joka2:BFP, GFP:ATG8CL and GFP:EV are co-expressed together in N. benthamiana leaves which are then infected (few hours post agroinfiltration) with P. infestans. Joka2:BFP and GFP:ATG8CL protein levels were higher in leaf patches that are infected compared to mock-infected leaves in both 3 and 4 days post infection (dpi). However, no such difference was detected in GFP:EV control in infected versus mock-infected samples. BFP detection was achieved using Anti-tRFP antibody (Evrogen) and GFP was detected by using a monoclonal anti-GFP antibody (Chromotek). Arrow heads point to the expected band sizes (Joka2:BFP, 120 kDa; GFP:EV, 27 kDa; GFP:ATG8CL, 42 kDa).

Figure 3—figure supplement 1.

Joka2/ATG8CL-autophagosomes associate with the EHM.

(A) Single focal plane CSLM image of a haustoriated plant cell marked by RFP:REM1.3 in which Joka2:BFP/GFP:ATGCL co-labelled autophagosomes accumulate across the EHM. Arrowheads point to autophagosomes in contact with the EHM. Scale bar, 10 μm. Image is obtained three dpi. (B) Across the EHM, BFP:EV control do not produce any punctate signal that overlap with GFP:ATG8CL-autophagosomes. Arrowheads point to GFP:ATG8CL labelled autophagosomes in contact with the EHM. Scale bars, 10 μm. Images are obtained three dpi. PM: plasma membrane.

Figure 3—figure supplement 2.

Joka2Δ1-487 is stably expressed.

Western blot detection of Joka2Δ1-487 and Joka2 constructs using anti Anti-tRFP antibody (Evrogen) and anti-HA antibody (Chromotek) from total protein extracts of N. benthamiana leaves two days after agroinfiltration. * indicates expected protein band (Joka2:BFP, 120 kDa; Joka2Δ1-487:BFP, 68 kDa; BFP:EV, 27 kDa; Joka2:3xHA, 98 kDa; Joka2Δ1-487:3xHA, 45 kDa; 3xHA:EV, 3.6 kDa). LC: loading control.

Joka2-mediated antimicrobial autophagy is directed toward the haustoria.

(A) Joka2 domain architecture (B–E) Confocal microscopy of P. infestans infected N. benthamiana leaf epidermal cells expressing Joka2:BFP, Joka2AIM:BFP mutant, Joka2Δ1-487:BFP or BFP:EV control. Both Joka2:BFP (top panel) and Joka2AIM:BFP (mid panel) displayed perihaustorial puncta although the frequency of the later was much lower. Consistently, Joka2Δ1-487:BFP mainly showed cytoplasmic distribution similar to BFP:EV control and rarely marked perihaustorial puncta (1.3% of imaged haustoria). Images shown are maximal projections of 10, 14, 10 and 7 frames with 1 μm steps from top to bottom rows, respectively. Arrowheads point to haustoria. Scale bars, 10 μm. Images were obtained 3–4 dpi. (F–G) Full length Joka2 enhances disease resistance against P. infestans, whereas Joka2Δ1-487, which does not accumulate around haustoria (D), only provides partial resistance. (F) N. benthamiana leaves expressing Joka2, Joka2Δ1-487 and empty vector (EV) control were infected with P. infestans and pathogen growth was determined by measuring infection lesion size eight days post-inoculation. (G) Categorical scatter plots illustrate infection lesion size of 8–10 infections sites from six independent biological replicates pointed out by six different colours. Welch Two Sample t-test revealed a significant difference (***p=0.0126) in disease resistance conferred by Joka2 compared to Joka2Δ1-487.

Joka2/ATG8CL-autophagosomes associate with the EHM.

(A) Single focal plane CSLM image of a haustoriated plant cell marked by RFP:REM1.3 in which Joka2:BFP/GFP:ATGCL co-labelled autophagosomes accumulate across the EHM. Arrowheads point to autophagosomes in contact with the EHM. Scale bar, 10 μm. Image is obtained three dpi. (B) Across the EHM, BFP:EV control do not produce any punctate signal that overlap with GFP:ATG8CL-autophagosomes. Arrowheads point to GFP:ATG8CL labelled autophagosomes in contact with the EHM. Scale bars, 10 μm. Images are obtained three dpi. PM: plasma membrane.

Joka2Δ1-487 is stably expressed.

Western blot detection of Joka2Δ1-487 and Joka2 constructs using anti Anti-tRFP antibody (Evrogen) and anti-HA antibody (Chromotek) from total protein extracts of N. benthamiana leaves two days after agroinfiltration. * indicates expected protein band (Joka2:BFP, 120 kDa; Joka2Δ1-487:BFP, 68 kDa; BFP:EV, 27 kDa; Joka2:3xHA, 98 kDa; Joka2Δ1-487:3xHA, 45 kDa; 3xHA:EV, 3.6 kDa). LC: loading control.

Joka2 localizes to ATG8CL-autophagosomes around the haustoria.

GFP:ATG8CL labelled perihaustorial autophagosomes fully overlapped with the Joka2:BFP labelled puncta (A), whereas Joka2AIM:BFP generally did not label GFP:ATG8CL autophagosomes (B) similar to BFP:EV control (C). Images shown are maximal projections of 11, 10 and 8, frames with 1 μm steps from top to bottom panels, respectively. Arrowheads point to haustoria. Scale bars, 10 μm. Images are obtained three dpi.

Joka2 degradation slows down during P. infestans infection.

P. infestans infection is associated with a decrease in Joka2 degradation. Joka2:BFP, GFP:ATG8CL and GFP:EV are co-expressed together in N. benthamiana leaves which are then infected (few hours post agroinfiltration) with P. infestans. Joka2:BFP and GFP:ATG8CL protein levels were higher in leaf patches that are infected compared to mock-infected leaves in both 3 and 4 days post infection (dpi). However, no such difference was detected in GFP:EV control in infected versus mock-infected samples. BFP detection was achieved using Anti-tRFP antibody (Evrogen) and GFP was detected by using a monoclonal anti-GFP antibody (Chromotek). Arrow heads point to the expected band sizes (Joka2:BFP, 120 kDa; GFP:EV, 27 kDa; GFP:ATG8CL, 42 kDa). To validate that Joka2 localizes to perihaustorial ATG8CL autophagosomes, we co-expressed Joka2:BFP, Joka2AIM:BFP or BFP:EV with GFP:ATG8CL in haustoriated N. benthamiana cells marked by RFP:REM1.3. Joka2:BFP fluorescent signal fully overlapped with GFP:ATG8CL labelled perihaustorial autophagosomes (100%, N = 140) unlike the BFP:EV (0%, N = 20) indicating Joka2 localizes to perihaustorial ATG8CL autophagosomes (Figure 3—figure supplement 3A–C). Surprisingly, Joka2:BFP also labelled puncta that did not show any GFP:ATG8CL fluorescence suggesting that Joka2 also labels compartments that are not ATG8CL-autophagosomes (Figure 3—figure supplement 3A). Consistent with this, Joka2AIM:BFP produced fluorescence signal at discrete puncta that rarely coincided with perihaustorial ATG8CL-autophagosomes (19%, N = 37) (Figure 3—figure supplement 3B). Like mammalian autophagy cargo receptors, Joka2 forms oligomers (Zientara-Rytter and Sirko, 2014), and this most likely accounts for recruitment of Joka2AIM:BFP to ATG8CL-autophagosomes.
Figure 3—figure supplement 3.

Joka2 localizes to ATG8CL-autophagosomes around the haustoria.

GFP:ATG8CL labelled perihaustorial autophagosomes fully overlapped with the Joka2:BFP labelled puncta (A), whereas Joka2AIM:BFP generally did not label GFP:ATG8CL autophagosomes (B) similar to BFP:EV control (C). Images shown are maximal projections of 11, 10 and 8, frames with 1 μm steps from top to bottom panels, respectively. Arrowheads point to haustoria. Scale bars, 10 μm. Images are obtained three dpi.

Based on these observations, we hypothesized that diversion of Joka2 mediated autophagy towards haustoria would lead to a decrease in vacuolar degradation of Joka2. To test this, we measured autophagic flux in infected leaves. We observed that, similar to ATG8CL, Joka2 protein levels were higher in infected leaves compared to the mock infected leaves (Figure 3—figure supplement 4). These results further illustrate that ATG8CL/Joka2 mediated antimicrobial autophagy is targeted to the haustorial interface.
Figure 3—figure supplement 4.

Joka2 degradation slows down during P. infestans infection.

P. infestans infection is associated with a decrease in Joka2 degradation. Joka2:BFP, GFP:ATG8CL and GFP:EV are co-expressed together in N. benthamiana leaves which are then infected (few hours post agroinfiltration) with P. infestans. Joka2:BFP and GFP:ATG8CL protein levels were higher in leaf patches that are infected compared to mock-infected leaves in both 3 and 4 days post infection (dpi). However, no such difference was detected in GFP:EV control in infected versus mock-infected samples. BFP detection was achieved using Anti-tRFP antibody (Evrogen) and GFP was detected by using a monoclonal anti-GFP antibody (Chromotek). Arrow heads point to the expected band sizes (Joka2:BFP, 120 kDa; GFP:EV, 27 kDa; GFP:ATG8CL, 42 kDa).

Previously we have shown that overexpression of Joka2 restricts pathogen colonisation (Dagdas et al., 2016). To test if focal accumulation of Joka2 is important for its antimicrobial function, we infected Joka2 and Joka2:BFPΔ1-487 overexpressing leaves with P. infestans. In contrast to leaf patches expressing the full length Joka2, which can accumulate at the perihaustorial autophagosomes (Figure 3B), leaves expressing Joka2Δ1-487 conferred only mild resistance (Figure 3F–G). Considered together with the cell biological analyses of Joka2 in haustoriated cells, infection assays suggest that diversion of plant antimicrobial autophagy towards pathogen interface is critical to limit P. infestans infection. Thus, the pathogen needs to subvert the biogenesis of antimicrobial Joka2/ATG8CL compartments and/or neutralize their defense related function at the host-pathogen interface.

Phytophthora infestans effector PexRD54 accumulates at Haustoria

To explore focal subversion of autophagic defense responses during infection, we set out to determine the subcellular localisation of the P. infestans effector PexRD54 in infected cells. In haustoriated cells, GFP:PexRD54 frequently labelled perihaustorial puncta (70%, N = 36) (Figure 4A). However, similar to the GFP control (0%, N = 22), we rarely detected any puncta around the haustoria labelled by GFP:PexRD54AIM2 (4%, N = 71, Figure 4B–C). This suggests that ATG8CL binding is critical for recruitment of PexRD54 to the perihaustorial autophagosomes. To determine whether PexRD54 labelled vesicles are ATG8CL-autophagosomes, we co-expressed BFP:PexRD54 with GFP:ATG8CL in haustoriated N. benthamiana cells. We observed a full overlap between the two punctate fluorescent signals across the EHM, in contrast to BFP:PexRD54AIM2 and BFP:EV negative controls (100%, N = 73 for PexRD54, 14%, N = 35 for PexRD54AIM2 and 0%, N = 29 for EV control) (Figure 4D–G). Although hardly observed (5/35, 14%), detection of perihaustorial PexRD54AIM2 labelled autophagosomes suggests that this mutant can still weakly associate with ATG8CL in vivo or forms higher order molecular complexes with the host autophagy machinery. Altogether, these findings demonstrate that the ATG8CL selective autophagy pathway that is targeted by P. infestans is diverted to the haustorial interface.
Figure 4.

PexRD54 accumulates at perihaustorial autophagosomes.

(A–C) Confocal images of haustoriated plant cells marked by REM1.3. GFP:PexRD54 showed frequent perihaustorial puncta (A) unlike its ATG8 interaction motif mutant PexRD54AIM2 (B), which rarely labelled perihaustorial puncta and showed cytoplasmic distribution similar to GFP:EV (C). (D–F) In haustoriated cells marked by RFP:REM1.3, GFP:ATG8CL labelled autophagosomes fully overlapped with perihaustorial BFP:PexRD54 puncta (D). In contrast, BFP:PexRD54AIM2 mainly remained cytoplasmic and mostly did not show perihaustorial puncta that overlap with ATG8CL autophagosomes (E), similar to BFP:EV control (F). Images shown are maximum projections of 8, 12, 10, 8, 5, and 9 frames with 1 μm steps from top to bottom rows, respectively. White arrowheads point to haustoria. Scale bars, 10 μm. Images are obtained 3–4 dpi. (G) PexRD54/ATG8CL labelled autophagosomes accumulate across the EHM. Single focal plane CLSM images show regions where the EHM and the tonoplast (dotted line) are parted away and the cytosol is no longer a thin layer between the two membranes. Autophagosomes co-labelled by BFP:PexRD54 and GFP:ATG8CL associate with the EHM marked by RFP:REM1.3. Green arrowheads in overlay panel point to BFP:PexRD54 labelled autophagosomes that associate with the EHM marked by RFP:REM1.3. Scale bar, 10 μm.

PexRD54 accumulates at perihaustorial autophagosomes.

(A–C) Confocal images of haustoriated plant cells marked by REM1.3. GFP:PexRD54 showed frequent perihaustorial puncta (A) unlike its ATG8 interaction motif mutant PexRD54AIM2 (B), which rarely labelled perihaustorial puncta and showed cytoplasmic distribution similar to GFP:EV (C). (D–F) In haustoriated cells marked by RFP:REM1.3, GFP:ATG8CL labelled autophagosomes fully overlapped with perihaustorial BFP:PexRD54 puncta (D). In contrast, BFP:PexRD54AIM2 mainly remained cytoplasmic and mostly did not show perihaustorial puncta that overlap with ATG8CL autophagosomes (E), similar to BFP:EV control (F). Images shown are maximum projections of 8, 12, 10, 8, 5, and 9 frames with 1 μm steps from top to bottom rows, respectively. White arrowheads point to haustoria. Scale bars, 10 μm. Images are obtained 3–4 dpi. (G) PexRD54/ATG8CL labelled autophagosomes accumulate across the EHM. Single focal plane CLSM images show regions where the EHM and the tonoplast (dotted line) are parted away and the cytosol is no longer a thin layer between the two membranes. Autophagosomes co-labelled by BFP:PexRD54 and GFP:ATG8CL associate with the EHM marked by RFP:REM1.3. Green arrowheads in overlay panel point to BFP:PexRD54 labelled autophagosomes that associate with the EHM marked by RFP:REM1.3. Scale bar, 10 μm.

Host-microbe interface is a hotspot for autophagosome biogenesis

We next investigated the origin of perihaustorial autophagosomes by testing whether they are synthesized at the host-pathogen interface or traffic to these sites following their biogenesis in other subcellular regions. A recent study has shown that the plant ATG9 homolog, the only transmembrane domain containing ATG protein, localises to autophagosome biogenesis sites and remains in mobile puncta adjacent to mature autophagosomes (Zhuang et al., 2017). Hence, we used ATG9:GFP as a marker for phagophore assembly sites (PAS) and monitored its localisation during infection. Transient expression of ATG9:GFP in haustoriated cells revealed that ATG9 is ubiquitously found at the perihaustorial puncta (in >92% of imaged haustoria) neighbouring ATG8CL and Joka2 labelled perihaustorial autophagosomes with a partial yet clear overlap (Figure 5A–C). This finding suggests that in addition to accommodating mature ATG8CL autophagosomes, perihaustorial compartments are hotspots for autophagosome biogenesis. Besides, we noted a substantial increase in the frequency of haustoria that associate with ATG8CL autophagosomes in infected plant cells overexpressing ATG9:GFP (90%, N = 120) compared to cells expressing GFP as a control (67%, N = 105) (Figure 5—figure supplement 1). Accumulation of ATG9 around the haustoria and its boosting effect on the perihaustorial autophagosomes prompted us to test its role in immunity. For this, we infected ATG9:GFP and GFP:EV expressing leaves with P. infestans (Figure 5D). Strikingly, we repeatedly observed that increasing ATG9 protein levels led to a significant drop in P. infestans infection (p=0.0035, six biological replicates). Overall these results suggest selective autophagy functions as a focal immune response against P. infestans. (Figure 5D–E).
Figure 5.

ATG9 accumulates around the haustoria and contributes to immunity.

(A–C) ATG9 localizes to ATG8CL-autophagosomes around the haustoria. ATG9:GFP labelled puncta frequently observed around the haustoria (>%92 of the imaged haustoria in (A), (B, C) which partially overlapped with the perihaustorial autophagosomes marked by BFP:ATG8CL and Joka2:BFP (A, B), but not with BFP:EV control (C). Images shown are maximal projections of 16, 15 and 7, frames with 1 μm steps from top to bottom panels, respectively. Arrowheads point to haustoria. Scale bars, 10 μm. Images are obtained three dpi.(d–e) ATG9 overexpression enhances disease resistance against P. infestans. (D) N. benthamiana leaves expressing on each half either ATG9:GFP or GFP empty vector (GFP:EV) control were infected with P. infestans and pathogen growth was determined by measuring infection lesion size eight days post-inoculation. (E) Categorical scatter plots illustrate infection lesion size of 6 infections sites (except rep2 with five infection sites) from six independent biological replicates pointed out by six different colours. ATG9 significantly (***p<0.01) enhanced disease resistance against P. infestans.

(A–B) The number of haustoria (marked by RFP:REM1.3) that associate with BGP:ATG8CL labelled autophagosomes substantially increases when ATG9:GFP is overexpressed (%90, N = 120) compared to GFP:EV control (%67, N = 105). Blue arrows point to haustoria that accommodate BFP:ATG8CL-autophagosomes whereas white arrows point to haustoria that lack BFP:ATG8CL-autophagosomes. Images shown are maximal projections of 10, and 22 frames with 1 μm steps from top to bottom rows, respectively. Scale bars, 10 μm.

Figure 5—figure supplement 1.

ATG9 overexpression enhances the frequency of haustoria that associate with ATG8CL-autophagosomes.

(A–B) The number of haustoria (marked by RFP:REM1.3) that associate with BGP:ATG8CL labelled autophagosomes substantially increases when ATG9:GFP is overexpressed (%90, N = 120) compared to GFP:EV control (%67, N = 105). Blue arrows point to haustoria that accommodate BFP:ATG8CL-autophagosomes whereas white arrows point to haustoria that lack BFP:ATG8CL-autophagosomes. Images shown are maximal projections of 10, and 22 frames with 1 μm steps from top to bottom rows, respectively. Scale bars, 10 μm.

ATG9 accumulates around the haustoria and contributes to immunity.

(A–C) ATG9 localizes to ATG8CL-autophagosomes around the haustoria. ATG9:GFP labelled puncta frequently observed around the haustoria (>%92 of the imaged haustoria in (A), (B, C) which partially overlapped with the perihaustorial autophagosomes marked by BFP:ATG8CL and Joka2:BFP (A, B), but not with BFP:EV control (C). Images shown are maximal projections of 16, 15 and 7, frames with 1 μm steps from top to bottom panels, respectively. Arrowheads point to haustoria. Scale bars, 10 μm. Images are obtained three dpi.(d–e) ATG9 overexpression enhances disease resistance against P. infestans. (D) N. benthamiana leaves expressing on each half either ATG9:GFP or GFP empty vector (GFP:EV) control were infected with P. infestans and pathogen growth was determined by measuring infection lesion size eight days post-inoculation. (E) Categorical scatter plots illustrate infection lesion size of 6 infections sites (except rep2 with five infection sites) from six independent biological replicates pointed out by six different colours. ATG9 significantly (***p<0.01) enhanced disease resistance against P. infestans.

ATG9 overexpression enhances the frequency of haustoria that associate with ATG8CL-autophagosomes.

(A–B) The number of haustoria (marked by RFP:REM1.3) that associate with BGP:ATG8CL labelled autophagosomes substantially increases when ATG9:GFP is overexpressed (%90, N = 120) compared to GFP:EV control (%67, N = 105). Blue arrows point to haustoria that accommodate BFP:ATG8CL-autophagosomes whereas white arrows point to haustoria that lack BFP:ATG8CL-autophagosomes. Images shown are maximal projections of 10, and 22 frames with 1 μm steps from top to bottom rows, respectively. Scale bars, 10 μm.

Discussion

In this study, we combined high-resolution microscopy with functional genetic analysis to monitor the course of defense related autophagy in N. benthamiana cells during P. infestans infection. We show that autophagosomes labelled by the core autophagy protein ATG8CL and the plant autophagy cargo receptor Joka2 are diverted to the EHM, and accumulation of Joka2 at this interface is critical for its antimicrobial activity (Figures 1–3). Moreover, P. infestans RXLR effector PexRD54, which functions as a competitive inhibitor of Joka2, also accumulated across the EHM (Figure 4). These findings suggest that previously discovered antagonistic interaction between PexRD54 and Joka2 principally takes place across the EHM, where PexRD54 depletes Joka2 from ATG8CL-autophagosomes to undermine antimicrobial autophagy. A similar antagonistic interaction has recently been reported in plasmodium infected hepatocytes, in which a plasmodium virulence factor counteracts functioning of the mammalian xenophagy receptor p62 on the parasitophorous vacuole membrane that accommodates the intracellular plasmodium (Real et al., 2018). These findings highlight convergent evolution of autophagy related host defenses, guided by autophagy cargo receptors, targeted towards the invading plant and animal pathogens. Furthermore, our results illustrate that adapted plant pathogens deploy effector proteins to remodel processes taking place at the perimicrobial host membranes and antagonize the focal immune responses deployed by the host to destroy the invaders. Recruitment of ATG9 labelled vesicles to perihaustorial region suggests the pathogen interface serves a scaffold for autophagosome formation and defense related autophagy responses (Figure 5). This would not only eliminate the unnecessary energy spent to transport these defense-related spherical bodies towards the EHM, but more importantly, minimize the time required for their effective deployment at this interface. This is reminiscent of the antibacterial autophagy responses mounted by mammalian cells against Salmonella Typhimurium (Randow et al., 2013). Future studies focusing on dissecting the components of the perihaustorial autophagosome biogenesis machinery should provide insights into how antimicrobial autophagy is accurately guided towards pathogen invasion sites. Surprisingly, ATG8 gene family has expanded and diversified to different degrees in plant lineages (Kellner et al., 2017). The expansion of plant ATG8s appears to have occurred early in evolution, and each plant family carries a unique set of ATG8 isoforms that have diversified over millions of years (Kellner et al., 2017). Thus, it is possible that in different plant families different ATG8 isoforms are specialized to carry out defense-related tasks. A phylogenetic analysis of solanaceous plants revealed family-specific groups of ATG8 members that form four distinct clades (Kellner et al., 2017). Unlike ATG8CL, another solanaceous ATG8 clade member, ATG8IL, does not accumulate at the haustorial interface during P. infestans infection. Thus, not all autophagic trafficking components are diverted to the haustorial interface. Autophagosomes labelled by ATG8IL do not respond to pathogen infection and remain cytosolic, further highlighting the specialization of ATG8 isoforms in plants that was proposed by Kellner et al (Kellner et al., 2017). (Figure 1). These findings reveal a novel trafficking route from the cytoplasm to the pathogen interface and expands our understanding of the biogenesis of the EHM (Bozkurt et al., 2015, 2014; Lu et al., 2012). The emerging view is that the EHM is formed by the redirection of different endomembrane trafficking pathways, notably the late endocytic pathway and ATG8CL-mediated selective autophagy. We hypothesize that the PexRD54-ATG8CL autophagosomes carry a distinct cargo that substitutes the defense related cargo to redirect molecules towards the pathogen. Such pathogen modified double-layered autophagosomes could fuse with the EHM discharging single layered vesicles into the extrahaustorial matrix. Fusion of autophagosomes with the EHM could provide a membrane source for EHM biogenesis and may account for the extracellular vesicles (EVs) that have been recently reported in several host-microbe interfaces (Deeks and Sánchez-Rodríguez, 2016; Rutter and Innes, 2017). Thus, PexRD54 may orchestrate the recruitment of host cargo for delivery as EVs to the host-pathogen interface. Further studies are required to determine the precise mechanisms that govern autophagosome biogenesis at the haustorial interface and its impact in pathogenicity. Moreover, identifying the nature of the autophagosome cargo sequestered by PexRD54 and Joka2 will further expand our understanding of the role of selective autophagy in host-microbe interactions.

Materials and methods

Molecular cloning and plasmid constructs

GFP:ATG8CL, GFP:ATG8CLΔ, GFP:ATG8IL, GFP:PexRD54, GFP:PexRD54AIM, GFP:EV and RFP:REM1.3 constructs were previously described (Bozkurt et al., 2015). All other blue fluorescent protein (BFP) fusion constructs were generated in this study. The vector for N-terminal BFP fusion was derived from pK7WGF2 plasmid (Karimi et al., 2002) by excising a fragment from the backbone with EcoRV digestion then replacing it with a custom synthesized fragment containing tagBFP sequence followed by linker sequence (GGATCTGCTGGATCTGCTGCTGGATCTGGAGAATTT) and EcoRV restriction site (where the gene of interest will be inserted) (Eurofins Genomics). Similarly, the vector for C-terminal BFP fusion was also derived from pK7WGF2 plasmid but by inserting PCR fragments containing EcoRV restriction site (where the gene of interest will be inserted) followed by linker sequence (GGATCTGCTGGATCTGCTGCTGGATCTGGAGAATTTGGATCA) and tagBFP sequence amplified from N-terminal BFP fusion vector using primer pairs GA_35 s_F with Cterm_BFP_Prom_R and Cterm_BFP_F with Cterm_BFP_R. Then, ATG9:GFP, BFP:PexRD54, BFP:PexRD54AIM2, Joka2:BFP and Joka2AIM:BFP, Joka2Δ1-487:BFP constructs were generated by Gibson assembly of each gene PCR fragment into EcoRV digested GFP/BFP vectors (N-terminal fusion for PexRD54 and PexRD54AIM, C-terminal fusion for ATG9, Joka2Δ1-487, Joka2 and Joka2AIM). All genes except ATG9, which was amplified from N. benthamiana cDNA, were amplified from existing constructs previously described (Bozkurt et al., 2015), using primer pairs GA_RD54_F with GA_RD54_R for PexRD54, GA_RD54_F with GA_LIR2_R for PexRD54AIM and GA_Joka2_BFP_F with GA_Joka2_BFP_R for both Joka2, Joka2AIM, and GA_Joka2Δ1-487_F, and GA_ATG9_F with GA_ATG9_R. Silencing constructs for ATG4 and ATG9 were amplified using the primer combinations hpATG4_F/hpATG4_R and hpATG9_F/hpATG9_R and cloned into the pRNAiGG vector, following the protocol from Pu Yan et al. (Yan et al., 2012). All primers used in this study are listed in Supplementary file 1.

ATG4 and ATG9 silencing assays

A BLASTP search of ATG4 and ATG9 against N. benthamiana proteins in the Sol Genomics database revealed one coding region for ATG4 (Niben101Scf02450g03007.1) and two homologs of ATG9, referred to here as ATG9A and ATG9B (Niben101Scf00114g00010.1 and Niben101Scf08519g00001.1). A hairpin RNAi construct targeting a conserved region in ATG9a/b was designed to silence both ATG9 homologs. Silencing of ATG4 and ATG9 was verified using RT-PCR. Total RNA was extracted using GeneJET Plant RNA purification Mini Kit (Thermo Scientific). 2 μg of RNA was used for cDNA synthesis using SuperScript IV Reverse Transcriptase (Invitrogen). RT was performed with the following conditions: 50 min at 55°C followed by 20 min at 70°C. Primers pairs used for cDNA amplification were RT_ATG4_F/RT_ATG4_R, RT_ATG9A_F/RT_ATG9A_R, and RT-ATG9B F/RT-ATG9B R. GAPDH was used to normalize transcript abundance. All primers used in this study are listed in Supplementary file 1.

Confocal microscopy

Imaging was performed using Leica SP5 resonant inverted confocal microscope (Leica Microsystems) using 63x water immersion objective. All microscopy analyses were carried out on live leaf tissue 3–4 days after agroinfiltration. Leaf discs of N. benthamiana were cut and mounted onto Carolina observation gel (Carolina Biological Supply Company) to minimize the damage. Specific excitation wavelengths and filters for emission spectra were set as described previously (Koh et al., 2005). BFP, GFP and RFP probes were excited using 405, 488 and 561 nm laser diodes and their fluorescent emissions detected at 450–480, 495–550 and 570–620 nm, respectively. Sequential scanning between lines was done to avoid spectral mixing from different fluorophores and images acquired using multichannel. Maximum intensity projections of Z-stack images were presented in each figure. Z-stack sections were processed to enhance image clarity, sections that caused blurriness (top and bottom ones), were removed for generation of maximum intensity projections. Image analysis was performed using ImageJ (1.50 g) and Adobe Photoshop (CS6).

Transient gene-expression assays in N. benthamiana

Transient gene-expression was performed in planta by infiltration of leaves of 3–4 week old N. benthamiana with cultures of Agrobacterium tumefaciens GV3101 strain carrying T-DNA constructs, as previously described (Bozkurt et al., 2011). Transient co-expression assays were carried out by mixing equal ratios of A. tumefaciens carrying the plant expression constructs in agroinfiltration medium [10 mM MgCl2, 5 mM 2-(N-morpholine)-ethanesulfonic acid (MES), pH 5.6] to achieve a final OD600 of 0.2.

Biological material

N. benthamiana plants were grown and maintained in a greenhouse with high light intensity (16 hr light/8 hr dark photoperiod) at 22–24°C. P. infestans strain 88069 cultures (van West et al., 1998) were grown and maintained on rye sucrose agar medium at 18°C in the dark for 12–14 days, as described elsewhere (Song et al., 2009) prior to use for infection of N. benthamiana. Zoospores were released from sporangia by addition of cold water and incubation at 4°C for 90 min adjusting dilution to 50,000 spores/ml. Infection of agroinfiltrated leaves was carried out by addition of 10 μl droplets containing zoospores as described previously (Song et al., 2009; Saunders et al., 2012) with the exception that infection was carried out on attached leaves, incubating inoculated plants in humid growth chambers. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. [Editors’ note: a previous version of this study was rejected after peer review, but the authors submitted for reconsideration. The first decision letter after peer review is shown below.] Thank you for submitting your work entitled "Host autophagosomes are diverted to a plant-pathogen interface" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife. There was general agreement that the study is interesting. However, the study falls short of providing enough new mechanistic insights to be suitable for a research advance. Specifically, there are important issues that are not fully substantiated, which raised questions: -Do the events described in the manuscript happen during infection? (That is, what is the biological relevance during natural infection?) -Are autophagosomes actually directed toward the pathogen interface under native conditions? Additional microscopy (e.g. electron microscopy) can help address this important issue. Reviewer #1: The manuscript by Dagdas et al., is a continuation of research from this group that studies effectors from the oomycete Phytophthora infestans. Effector biology, mode action, localization/translocation and importantly, the underlying mechanistic details responsible for this intriguing class of regulators. Previously, this group made an interesting discovery, coupling effector research with another emerging (emerged) area of research that is operative in both plants and animals, namely autophagy. Utilizing an effector from P. infestans; (Pex RD54). In mechanistic studies the authors were able to show that this oomycete effector binds to a host protein, to trigger autophagosome formation. Interestingly during infection where autophagosomes usually deliver their cargo, instead P. infestans triggers autophagosome formation that results in the depletion of autophagy cargo including Joka2 a selective ATG receptor. How does this work? How is this used to establish compatibility? Finally, in the current manuscript, data is presented that suggests that Autophagosomes are "diverted" to the pathogen interface and in a resistant response results in starvation. Conclusions include the idea that the pathogen reprograms host selective autophagy purely for the benefit of the pathogen. This a very nice paper in many ways and will likely be a seminal contribution to the field merging Molecular Plant Pathology and autophagic cell death. 1) My main concern is the microscopy. Not being a microscopist … but can the resolution be improved? It is hard to determine what is happening during these interactions. Would TEM help? Reviewer #2: This research advance builds upon previous work where the P. infestans effector PexRD54 specifically binds to the plant protein ATG8CL to induce autophagosome formation. Here, the authors demonstrate that ATG8CL, but not AGT8IL, localize to haustoria after transient expression in Nicotiana plants infected with P. infestans using the expression of the remorin protein REM1.3 as a marker for P. infestans haustoria. The autophagy cargo receptor Joka2 also accumulates at haustoria upon infection. Previous papers have demonstrated targeted vesicular trafficking to the site of pathogen infection, indicating that trafficking of cellular components to the site of pathogen ingress is a common phenomenon. The microscopy images are striking and in general the experiments are well performed. However, all the data rely upon transient overexpression in Nicotiana. Does this occur during natural infection under native expression? The biological relevance of this relocalization is also not clear. Identifying the cargo of autophagosomes relocalized to the site of pathogen infection is required to understand the role of selective autophagy during P. infestans infection. Reviewer #3: Some of the authors in this manuscript previously found that an effector from the Irish potato famine pathogen Phytophthora infestans binds to autophagosome-localized ATG8 protein instead of autophagy cargo receptor Joka2 in order to counteract plant defenses for its infection. In this manuscript Dagdas et al., reported that autophagosomes labeled with GFP-ATG8CL are directed toward the pathogen interface for membrane sources of extra haustorial membrane (EHM). Although the authors' concept/hypothesis that autophagosomal membranes can be one of the origins and source of the host-microbe interfaces is quite interesting, new mechanistic insights for it are not provided. For example, how are the pathogen-manipulated autophagosomes diverted to the pathogen interface? Additionally, convincing data are still missing to support the authors' claim. If the authors' hypothesis is true, GFP-ATG8CL should be well colocalized with EHM marker REM1.3. GFP-ATG8CL signal is not completely overlapped with REM1.3-RFP signal. It seems to be localized in cytoplasm between EHM and vacuolar membrane. To make a solid paper, immuno-EM analyses using anti-antibodies of autophagosomal membrane marker are necessary. [Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.] This manuscript has been improved significantly from previous submission. The work uncovers selective autophagy targeted to haustoria as a defense mechanism, represents one of the first papers to tackle plant cargo receptors, and is a significant contribution to our understanding of how autophagy may contribute immunity. We are happy to offer publication of the manuscript after the authors have addressed the following issues: 1) It is helpful to explain in the Introduction differences of "selective autophagy", "antimicrobial-autophagy", and "xenophagy". This will help readers. 2) Where does ATG8CL localize without infection? 3) The title is a bit misleading by stating "autophagosomes are diverted to the pathogen interface", since it implies initiation of autophagosomes elsewhere then move to haustoria. What the authors show is that autophagosomes are formed around haustoria.. 4) Many of the figures show fluorescence of BFP protein fusions using a blue color. Although this is intuitive, it is very difficult to see the blue color against the black background. Since this is a false color, anyhow, I strongly suggest replacing the blue color with something brighter such as yellow or magenta. 5) Figure 4—figure supplement 1 and Figure 4—figure supplement 2 present critical data to support the conclusion that PexRD54 and ATG8CL co-localize in puncta at the perihaustorial membrane. This should be moved to main figures. 6) In the Discussion section the authors allude to phylogenetic analyses that they have performed on the ATG8 family in plants. It would be helpful to explicitly state whether ATG8CL is conserved across flowering plants, or whether it is specific to the Solanaceae family. I gather that it is not broadly conserved. If it is not, do they speculate that other ATG8 members fulfill this role in other plant families? 7) Images in Figure 3 were collected 3-4 days post infection. Based on Figure 3—figure supplement 4, protein levels differ significantly. Please comment whether this affect interpretation of the data. [Editors’ note: the author responses to the first round of peer review follow.] Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife. There was general agreement that the study is interesting. However, the study falls short of providing enough new mechanistic insights to be suitable for a research advance. Specifically, there are important issues that are not fully substantiated, which raised questions: -Do the events described in the manuscript happen during infection? (That is, what is the biological relevance during natural infection?) -Are autophagosomes actually directed toward the pathogen interface under native conditions? Additional microscopy (e.g. electron microscopy) can help address this important issue. We are very pleased to submit the manuscript “Host autophagosomes are diverted to the pathogen interface to mediate focal defense responses against the Irish potato famine pathogen” for publication in eLife as a Research Advance. We recently showed that the Irish potato famine pathogen P. infestans subverts host autophagy related defences by secreting an effector protein (Dagdas et al., eLife, 2016, 5:e10856; Maqbool et al., JBC, 2016, 291:20270). In this manuscript, we provide an exciting cellular biology dimension to our previous model and show that defense-related selective autophagy pathway is diverted to the plant-microbe interface in order to limit the pathogen growth, instead of taking the default vacuolar degradation route. In turn, the pathogen antagonizes the antimicrobial-autophagy launched to destroy itself by deploying an effector protein that disarms the defense-related autophagosomes across the perimicrobial host membrane. Interestingly, the autophagosome biogenesis machinery, marked by the conserved early autophagosome protein ATG9, is also diverted to hostmicrobe interface. Furthermore, we assign a previously unknown antimicrobial function to ATG9 protein, as its overexpression significantly improved plant immunity to pathogen infection. The extent to which autophagy contributes to immunity and/or serves adapted pathogens is currently under debate. In Dagdas et al. (eLife, 2016), we showed that the effector protein PexRD54 of P. infestans outcompetes host autophagy cargo receptor Joka2 in binding the core autophagy adaptor ATG8. This results in suppression of Joka2-mediated immunity. Interestingly, the effector also stimulates the formation of the autophagosomes, which suggests that the pathogen could subvert host autophagy for its own benefit. In this study, we demonstrate that autophagosomes are diverted towards haustoria, specialized hyphal extensions that grow inwards host cells. This reveals a new pathway that is re-routed towards the pathogen interface and provides evidence for extensive remodelling of the host endomembrane system by plant pathogens. In addition to showing importance of focal autophagic defense responses, our work has wider implications. It sheds light on membrane biogenesis in plant cells that accommodate microbial structures and explains the differences in protein composition between plant plasma membrane and perimicrobial membranes. This work also points to a possible source for the enigmatic extracellular vesicles that have been reported in host-microbe interfaces of symbiotic and parasitic interactions. Although the essence of this story is similar to our previous submission that was rejected, this is almost a new manuscript, not a cosmetically re-decorated version of the previous one. We have added several new composite figures and modified the text accordingly. A summary of the new data and figures are as follows: 1) We provide RNAi based genetic evidence demonstrating autophagosome targeting to haustorial interface is dependent on the core autophagy components ATG4 and ATG9. This is now presented in Figure 2. 2) We have performed high resolution imaging of ATG8CL/Joka2/PexRD54 autophagosomes to show that they associate with the perimicrobial host membrane. These data are presented in Figure 1—figure supplement 1, Figure 3—figure supplement 1, and Figure 4—figure supplement 2. 3) We have performed domain-function analyses of Joka2 to show that domains that mediate oligomerization and protein-protein interaction are important for haustorial accumulation of Joka2. Furthermore, we did pathogenicity assays that shows focal accumulation of Joka2 is important for its positive role in antimicrobial immunity. These data are now presented in Figure 3, Figure 3—figure supplement 2, Figure 3—figure supplement 4. 4) We have performed high-resolution imaging and pathogenicity assays that showed perihaustorial niche is a hot spot for autophagosome biogenesis and overexpression of early autophagosome biogenesis marker ATG9 enhances plant immunity. These data are now presented in Figure 5, Figure 5—figure supplement 1. [Editors' note: the author responses to the re-review follow.] This manuscript has been improved significantly from previous submission. The work uncovers selective autophagy targeted to haustoria as a defense mechanism, represents one of the first papers to tackle plant cargo receptors, and is a significant contribution to our understanding of how autophagy may contribute immunity. We are happy to offer publication of the manuscript after the authors have addressed the following issues: We are delighted to hear about the positive evaluation of our manuscript by the reviewers and the editor. We addressed all the raised issues as following: 1) It is helpful to explain in the Introduction differences of "selective autophagy", "antimicrobial-autophagy", and "xenophagy". This will help readers. We now included new text in the Introduction to clarify different types of autophagy. 2) Where does ATG8CL localize without infection? We now present images (Figure 1—figure supplement 1A-B) showing punctate and vacuolar localization of ATG8CL in uninfected cells. 3) The title is a bit misleading by stating "autophagosomes are diverted to the pathogen interface", since it implies initiation of autophagosomes elsewhere then move to haustoria. What the authors show is that autophagosomes are formed around huastoria. We changed the title to “Host autophagy machinery is diverted to the pathogen interface to mediate focal defense responses against the Irish potato famine pathogen”. 4) Many of the figures show fluorescence of BFP protein fusions using a blue color. Although this is intuitive, it is very difficult to see the blue color against the black background. Since this is a false color, anyhow, I strongly suggest replacing the blue color with something brighter such as yellow or magenta. We thank the editor for this suggestion. We updated all the figures and changed all blue channels to teal and green channels to yellow. 5) Figure 4—figure supplement 1 and Figure 4—figure supplement 2 present critical data to support the conclusion that PexRD54 and ATG8CL co-localize in puncta at the perihaustorial membrane. This should be moved to main figures. We have revised the figure as suggested. These data are now presented in Figure 4. 6) In the Discussion section the authors allude to phylogenetic analyses that they have performed on the ATG8 family in plants. It would be helpful to explicitly state whether ATG8CL is conserved across flowering plants, or whether it is specific to the Solanaceae family. I gather that it is not broadly conserved. If it is not, do they speculate that other ATG8 members fulfill this role in other plant families? We included following text in the Discussion “The expansion of plant ATG8 members seems to have occurred earlier in evolution, and each plant family carries a unique set of ATG8 isoforms that have been diversifying over millions of years. Thus, it is likely that in different plant families different ATG8 isoforms are specialized to carry out defense-related tasks.” 7) Images in Figure 3 were collected 3-4 days post infection. Based on Figure 3—figure supplement 4, protein levels differ significantly. Please comment whether this affect interpretation of the data. We think this is unlikely because we excluded the cells that didn’t look healthy or showed no Joka2 expression. Additionally, we measured the frequency of haustoria that has Joka2 puncta rather than quantifying the abundance of Joka2 puncta/cell. Consistently, our image quantification does not show any significant differences in number of haustoria that accommodate Joka2:BFP puncta in images obtained three (32/35 of haustoria, 91.4%) vs four (14/15 of haustoria 93.3%) days post infection.
  29 in total

Review 1.  Ten things to know about oomycete effectors.

Authors:  Sebastian Schornack; Edgar Huitema; Liliana M Cano; Tolga O Bozkurt; Ricardo Oliva; Mireille Van Damme; Simon Schwizer; Sylvain Raffaele; Angela Chaparro-Garcia; Rhys Farrer; Maria Eugenia Segretin; Jorunn Bos; Brian J Haas; Michael C Zody; Chad Nusbaum; Joe Win; Marco Thines; Sophien Kamoun
Journal:  Mol Plant Pathol       Date:  2009-11       Impact factor: 5.663

Review 2.  Cargo recognition and trafficking in selective autophagy.

Authors:  Alexandra Stolz; Andreas Ernst; Ivan Dikic
Journal:  Nat Cell Biol       Date:  2014-06       Impact factor: 28.824

3.  Seeing is believing: cell biology at the plant-microbe interface.

Authors:  Mike Deeks; Clara Sánchez-Rodríguez
Journal:  New Phytol       Date:  2016-07       Impact factor: 10.151

4.  The ipiO gene of Phytophthora infestans is highly expressed in invading hyphae during infection.

Authors:  P van West; A J de Jong; H S Judelson; A M Emons; F Govers
Journal:  Fungal Genet Biol       Date:  1998-03       Impact factor: 3.495

5.  GATEWAY vectors for Agrobacterium-mediated plant transformation.

Authors:  Mansour Karimi; Dirk Inzé; Ann Depicker
Journal:  Trends Plant Sci       Date:  2002-05       Impact factor: 18.313

6.  Selective autophagy limits cauliflower mosaic virus infection by NBR1-mediated targeting of viral capsid protein and particles.

Authors:  Anders Hafrén; Jean-Luc Macia; Andrew J Love; Joel J Milner; Martin Drucker; Daniel Hofius
Journal:  Proc Natl Acad Sci U S A       Date:  2017-02-21       Impact factor: 11.205

7.  The Plant Membrane-Associated REMORIN1.3 Accumulates in Discrete Perihaustorial Domains and Enhances Susceptibility to Phytophthora infestans.

Authors:  Tolga O Bozkurt; Annis Richardson; Yasin F Dagdas; Sébastien Mongrand; Sophien Kamoun; Sylvain Raffaele
Journal:  Plant Physiol       Date:  2014-05-07       Impact factor: 8.340

8.  An effector of the Irish potato famine pathogen antagonizes a host autophagy cargo receptor.

Authors:  Yasin F Dagdas; Khaoula Belhaj; Abbas Maqbool; Angela Chaparro-Garcia; Pooja Pandey; Benjamin Petre; Nadra Tabassum; Neftaly Cruz-Mireles; Richard K Hughes; Jan Sklenar; Joe Win; Frank Menke; Kim Findlay; Mark J Banfield; Sophien Kamoun; Tolga O Bozkurt
Journal:  Elife       Date:  2016-01-14       Impact factor: 8.140

9.  Host protein BSL1 associates with Phytophthora infestans RXLR effector AVR2 and the Solanum demissum Immune receptor R2 to mediate disease resistance.

Authors:  Diane G O Saunders; Susan Breen; Joe Win; Sebastian Schornack; Ingo Hein; Tolga O Bozkurt; Nicolas Champouret; Vivianne G A A Vleeshouwers; Paul R J Birch; Eleanor M Gilroy; Sophien Kamoun
Journal:  Plant Cell       Date:  2012-08-10       Impact factor: 11.277

10.  Plasmodium UIS3 sequesters host LC3 to avoid elimination by autophagy in hepatocytes.

Authors:  Eliana Real; Lénia Rodrigues; Ghislain G Cabal; Francisco J Enguita; Liliana Mancio-Silva; João Mello-Vieira; Wandy Beatty; Iset M Vera; Vanessa Zuzarte-Luís; Tiago N Figueira; Gunnar R Mair; Maria M Mota
Journal:  Nat Microbiol       Date:  2017-11-06       Impact factor: 17.745

View more
  26 in total

Review 1.  Combating stress: the interplay between hormone signaling and autophagy in plants.

Authors:  Ching-Yi Liao; Diane C Bassham
Journal:  J Exp Bot       Date:  2020-03-12       Impact factor: 6.992

2.  An oomycete effector subverts host vesicle trafficking to channel starvation-induced autophagy to the pathogen interface.

Authors:  Pooja Pandey; Alexandre Y Leary; Yasin Tumtas; Zachary Savage; Bayantes Dagvadorj; Cian Duggan; Enoch Lh Yuen; Nattapong Sanguankiattichai; Emily Tan; Virendrasinh Khandare; Amber J Connerton; Temur Yunusov; Mathias Madalinski; Federico Gabriel Mirkin; Sebastian Schornack; Yasin Dagdas; Sophien Kamoun; Tolga O Bozkurt
Journal:  Elife       Date:  2021-08-23       Impact factor: 8.140

3.  A bacterial effector counteracts host autophagy by promoting degradation of an autophagy component.

Authors:  Jia Xuan Leong; Margot Raffeiner; Daniela Spinti; Gautier Langin; Mirita Franz-Wachtel; Andrew R Guzman; Jung-Gun Kim; Pooja Pandey; Alyona E Minina; Boris Macek; Anders Hafrén; Tolga O Bozkurt; Mary Beth Mudgett; Frederik Börnke; Daniel Hofius; Suayib Üstün
Journal:  EMBO J       Date:  2022-05-27       Impact factor: 14.012

Review 4.  NBR1: The archetypal selective autophagy receptor.

Authors:  Nikoline Lander Rasmussen; Athanasios Kournoutis; Trond Lamark; Terje Johansen
Journal:  J Cell Biol       Date:  2022-10-18       Impact factor: 8.077

5.  New insights into AtNBR1 as a selective autophagy cargo receptor in Arabidopsis.

Authors:  Youshun Lin; Rongfang Guo; Changyang Ji; Jun Zhou; Liwen Jiang
Journal:  Plant Signal Behav       Date:  2020-10-30

6.  AtNBR1 Is a Selective Autophagic Receptor for AtExo70E2 in Arabidopsis.

Authors:  Changyang Ji; Jun Zhou; Rongfang Guo; Youshun Lin; Chun-Hong Kung; Shuai Hu; Wing Yin Ng; Xiaohong Zhuang; Liwen Jiang
Journal:  Plant Physiol       Date:  2020-08-05       Impact factor: 8.340

Review 7.  Plant Immune Mechanisms: From Reductionistic to Holistic Points of View.

Authors:  Jie Zhang; Gitta Coaker; Jian-Min Zhou; Xinnian Dong
Journal:  Mol Plant       Date:  2020-09-08       Impact factor: 13.164

8.  Host-interactor screens of Phytophthora infestans RXLR proteins reveal vesicle trafficking as a major effector-targeted process.

Authors:  Benjamin Petre; Mauricio P Contreras; Tolga O Bozkurt; Martin H Schattat; Jan Sklenar; Sebastian Schornack; Ahmed Abd-El-Haliem; Roger Castells-Graells; Rosa Lozano-Durán; Yasin F Dagdas; Frank L H Menke; Alexandra M E Jones; Jack H Vossen; Silke Robatzek; Sophien Kamoun; Joe Win
Journal:  Plant Cell       Date:  2021-07-02       Impact factor: 11.277

9.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

10.  Vacuolar processing enzyme translocates to the vacuole through the autophagy pathway to induce programmed cell death.

Authors:  Paula Teper-Bamnolker; Raz Danieli; Hadas Peled-Zehavi; Eduard Belausov; Mohamad Abu-Abied; Tamar Avin-Wittenberg; Einat Sadot; Dani Eshel
Journal:  Autophagy       Date:  2020-12-19       Impact factor: 16.016

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.