Literature DB >> 29915502

Isolation and identification of Mannheimia haemolytica by culture and polymerase chain reaction from sheep's pulmonary samples in Shiraz, Iran.

Mohammad Tabatabaei1, And Fatemeh Abdollahi1.   

Abstract

BACKGROUND AND AIM: Mannheimia haemolytica is a Gram-negative, non-motile, and non-spore-forming rod-shaped coccobacillus bacterium. On blood agar plate, it shows complete hemolysis. This bacterium constitutes a part of normal flora of the upper respiratory system of ruminants. It is considered as the opportunistic pathogen and the main factor of pneumonic pasteurellosis, which has caused a severe economic loss in sheep and cattle industries. Considering the prevalence of the disease in sheep and goat population in the dry and hot regions of the country in general and in Fars province in particular in the form of pneumonia, the purpose of this study was to isolate and identify the bacterium M. haemolytica from the lung tissues of sheep slaughtered in Shiraz abattoir through culturing and polymerase chain reaction (PCR) methods.
MATERIALS AND METHODS: In this study, a total of 2500 sheep's lungs were evaluated for finding pneumonic effects. Then, 161 infected pneumonic samples of lung tissues were investigated by culture and PCR methods.
RESULTS: After cultivation, purification, and DNA extraction, 38 samples were found positive for M. haemolytica by cultivation and then all the 38 isolates were confirmed by PCR and multiplex PCR (mPCR). Results of this study indicated that culture and PCR are both practical in identification and isolation of this bacterium though culture is more time-consuming. The utilized mPCR has been more successful in the identification of the bacteria since it requires less time and cost.
CONCLUSION: In this study, PCR as a superior method among other methods of bacteriology for fast examination of infectious diseases and mPCR, which is a valuable tool for identification of M. haemolytica in clinical samples of animals, was used.

Entities:  

Keywords:  Mannheimia haemolytica; Shiraz; pneumonia; polymerase chain reaction; sheep

Year:  2018        PMID: 29915502      PMCID: PMC5993753          DOI: 10.14202/vetworld.2018.636-641

Source DB:  PubMed          Journal:  Vet World        ISSN: 0972-8988


Introduction

Mannheimia haemolytica is a Gram-negative, non-motile, non-spore-forming, and rod-shaped coccobacillus bacterium. The G+C content of the DNA is about 39-44% [1]. In 1999, Angen et al. [2] reclassified the A biotypes of Pasteurella haemolytica into a new genus named M. haemolytica after the name of German biologist Walter Mannheimia. He improved the study and classification of Pasteurellaceae family through his investigations [3]. M. haemolytica is found as a natural flora on the mucous membrane of the upper respiratory tract of ruminants. Most of its known species were isolated from cattle, sheep, and goats. Virulence factors of M. haemolytica include adhesins, capsule, lipopolysaccharide, outer membrane proteins, iron-regulated proteins, and leukotoxin. The main pathogen of bovine pneumonic pasteurellosis (shipping fever) is M. haemolytica which can be the causative agent of pasteurellosis in sheep and goats. In addition, it causes two syndromes of pneumonia and septicemia in sheep and goats, respectively, and leads to gangrenous mastitis in ewes [4]. Therefore, the purpose of the current study was to identify and isolate M. haemolytica from slaughtered sheep’s lungs in Shiraz abattoirs through culture and polymerase chain reaction (PCR). Considering the significant role of this bacterium in sheep pneumonia, the effectiveness of these two methods in bacterial identification with improved sensitivity and rapidity was investigated.

Materials and Methods

Ethical approval

Ethical approval was not necessary as samples were collected from dead animals.

Sample collection

From October 2015 to June 2016, following the slaughter of the apparently healthy animals, all the lungs (≈2500) were inspected according to the standard postmortem meat inspection procedure; and then, 161 lungs that contain hepatization and consolidation in cranioventral lobes were selected for further examination. Each lung sample was separately placed in sterile zip-lock plastic bags and transferred to the laboratory of Bacteriology, Faculty of Veterinary Medicine, Shiraz University, in about 2 h, in cool condition. Samples were collected from cranioventral lungs’ lobes with hyperemia, rough surface, and consolidation symptoms.

Culture and isolation

Upon inspection, the surface of each suspected lung was sterilized with a hot iron blade and incised using sterile scalpel blade and the inner surface of the incision was sampled with a sterile swab. Following that, the swabs were streaked on blood agar plates and incubated aerobically at 37°C for 24-48 h. Then, for isolation, a loopful of the identified colonies were streaked over a new blood agar plate and incubated aerobically at 37°C for 24 h. Next, from culture-positive plates, typical colonies were subjected to Gram’s staining to study staining reactions and cellular morphology under a light microscope. Mixed and Gram-negative bacteria were further subcultured with due care, on both blood and MacConkey agar plates for final identification. The growth of typical colonies on both blood agar and MacConkey agar plates was characterized using blood agar plate for the presence of hemolysis, the type of hemolysis, the general appearance of colonies (morphology, color, shape, size, and consistency) and MacConkey agar plates for the ability to ferment lactose. Pure cultures of single colony type were further analyzed by catalase and oxidase tests. Final identification of bacteria to species level was aided using the biochemical tests including Metabolism of sugars such as glucose, sorbitol, lactose, sucrose, maltose, and mannose and tests for metabolic end products such as indole (Peptone water, Merck Co., Germany) following standard procedures. If the organism can produce a narrow zone of hemolysis on blood agar plate and grown on MacConkey agar plate, but unable to produce indole, it is interpreted as M. haemolytica [4].

DNA extraction

A few colonies from the phenotypically characterized pure cultures of M. haemolytica from 24-48 h growth on blood agar plates were transferred into 1.5-ml Eppendorf tubes. The bacterial genomic DNA was extracted according to Gram-negative DNA extraction kit (Cinnagen, Iran). The extracted DNA was determined to be of good quality according to A260/A280, and DNA concentration was measured using Nanodrop (10000 V 3.52). Finally, the extracted DNA was stored at −20°C until use.

PCR

The oligonucleotide primers used in this study are listed in Table-1 [5]. The reaction mixture solution for PCR was prepared using 2.5 μl of 10× PCR buffer, 1.5 μl (1.5 mM) MgCl, 1.5 μl (200 mM) dNTPs, 1.5 µl (100 nmol) each primer of M. haemolytica, 0.3 U of Taq DNA polymerase, 13.2 μl H2O, and 3 μl of DNA template to have a final volume of 25 μl. The master mix form mPCR is also shown in Table-2. PCR conditions were optimized by putting gradient PCRs with annealing temperature ranging from 50.5°C to 50.7°C using 0.2-ml thin-walled PCR tubes. After initial denaturation (at 94°C for 4 min), amplification conditions were as follows: Denaturation at 94°C for 40 s, annealing at 50.5-50.7°C for 40 s, and extension at 72°C for 40 s. This was repeated for 30 cycles in a Block assembly 96G thermocycler with a hot top assembly (Analytic Jena, Germany), with a final extension of 72°C for 6 min, and the PCR products remained in the thermal cycler at 4°C until they were collected (M. Tabatabaei, unpublished data). The preparation of the reagents for PCR, the addition of the DNA extracts to the mixture, and the PCR thermocycling was performed in three separate rooms to prevent crossover contamination by extraneous nucleic acids.
Table-1

The utilized PCR primers.

Primer namePrimer sequence 5′ to 3′Amplicon Size (bp)References
Lkt(F) GCAGGAGGTGATTATTAAAGTGG206[5]
(R) CAGCAGTTATTGTCATACCTGAAC
HP(F) CGAGCAAGCACAATTACATTATGC90[5]
(R) CACCGTCAAATTCCTGTGGATAAC
16S(F) GCTAACTCCGTGCCAGCAG304[5]
(R) CGTGGACTACCAGGGTATCTAATC
Table-2

The amount and characteristics of mPCR components.

The utilized componentsDNA TemplateTaq DNA polymeraseReverse primer (Each)Forward primer (Each)dNTPsMgCl2PCR BufferH2O
Density-5 U/µl20 µM20 µM10 mM50 mM10×-
Amount (ml)20.31.51.521.82.57.4
The utilized PCR primers. The amount and characteristics of mPCR components. A negative control consisting of all components of reaction mixture except the DNA template was included in all PCR experiments. Positive controls were included in the PCR from colonies that were confirmed according to NCBI gene bank sequencing. After initial identification of isolates according to phenotypic characteristics and biochemical tests, some isolates and M. hemolytica from the bacterial collection of the Faculty of Veterinary Medicine, Shiraz University, were sent for sequencing of 16s DNA-PCR products, and then these bacterial strains were used as positive control in PCR. To evaluate the PCR results, electrophoresis in agarose gel was carried out. PCR amplicons were assessed by loading 8 µl of the PCR product plus 2 µl of loading buffer into separate wells of 2% (w/v) agarose gel (Agarose I; Cinnagen, Iran) containing ethidium bromide (0.5 µg/ml). A molecular weight marker (50 bp; Cinnagen, Iran) was loaded into the first well to determine the size of the amplified fragments. The gel was immersed in TBE buffer and subjected to a voltage difference of 100 V that led to the separation of the fragments. Visualization was undertaken using an ultraviolet transilluminator (BTS-20, Japan), and the resulting image was captured by a computer software program (AlphaEase; Alpha Innotech, Genetic Technologies, Inc. Miami). For the final confirmation of isolates of M. haemolytica, PCR products of some samples according to the Macrogene Company’s instructions were prepared at 50 μl volume and were transferred for sequencing. Sequence analysis was performed on an ABIPrism 3100 Genetic Analyzer (Applied Biosystems, Inc. Thermo Fisher Scientific Corporation. USA).

Results

Identification of the bacterial species was made by observation of their colonial morphology, Gram staining reaction, and biochemical characteristics [4]. Through culture, 38 isolates of M. haemolytica with small gray circle colonies with β-hemolysis were observed that were rod-shaped in Gram staining (Figure-1). Catalase and oxidase tests were positive, but indole test was negative. The highest level of isolation was observed in January, February, and March.
Figure-1

M. haemolytica colonies on (a) blood agar plate and (b) Gram staining smear.

M. haemolytica colonies on (a) blood agar plate and (b) Gram staining smear. In addition, among the cultured tissues of lungs studied in this research, other bacteria such as Staphylococcus, Streptococcus, Corynebacterium, Micrococcus, Rhodococcus, Acinetobacter, Bacillus, and Pasteurella were identified and isolated. These bacterial isolates were identified according to phenotypic characteristics and biochemical tests. According to PCR test, using the stated primers, all the 38 isolates tested for the presence of M. haemolytica were identified as 100% positive (Figures-2-4).
Figure-2

PCR amplification profile of M. haemolytica from DNA isolated directly from samples with HP primer. Lanes A to E: Positive samples (90 bp amplicon size), Lane F: Positive control, Lane G: Negative control, Lane H: 50 bp DNA marker.

Figure-4

PCR amplification profile of M. haemolytica from DNA isolated directly from samples with 16s primer. Lanes A to E: Positive samples (amplicon size 304bp), Lane F: Positive control, Lane G: Negative control, Lane H: 50 bp DNA marker.

PCR amplification profile of M. haemolytica from DNA isolated directly from samples with HP primer. Lanes A to E: Positive samples (90 bp amplicon size), Lane F: Positive control, Lane G: Negative control, Lane H: 50 bp DNA marker. PCR amplification profile of M. haemolytica from DNA isolated directly from samples with LKT primer. Lanes A to E: Positive samples (amplicon size 206 bp), Lane F: Positive control, Lane G: Negative control, Lane H: 50 bp DNA marker. PCR amplification profile of M. haemolytica from DNA isolated directly from samples with 16s primer. Lanes A to E: Positive samples (amplicon size 304bp), Lane F: Positive control, Lane G: Negative control, Lane H: 50 bp DNA marker. All the M. haemolytica were also positive with mPCR (Figure-5).
Figure-5

mPCR amplification profile of M. haemolytica from DNA isolated directly from samples. Lanes A to E: Positive samples (amplicon sizes 90 bp, 206 bp, and 304 bp), Lane F: positive control, Lane G: Negative control, Lane H: 50 bp DNA marker.

mPCR amplification profile of M. haemolytica from DNA isolated directly from samples. Lanes A to E: Positive samples (amplicon sizes 90 bp, 206 bp, and 304 bp), Lane F: positive control, Lane G: Negative control, Lane H: 50 bp DNA marker. It should be noted that four isolates were shown 100% homology with the documented genomic sequencing of M. haemolytica in NCBI database (Figures-6 and 7).
Figure-6

16S rRNA gene sequencing results of sample 55.

Figure-7

16S rRNA gene sequencing of M. haemolytica documented in NCBI database.

16S rRNA gene sequencing results of sample 55. 16S rRNA gene sequencing of M. haemolytica documented in NCBI database.

Discussion

Sheep and goat pneumonia is a syndrome that is caused by the reaction between factors of environmental stress, microorganisms, and host defensive ability. Pneumonia occurs in all ages of sheep and goats, in all breeds, and in every country of the world [6]. The high incidence of disease in warm regions and exhibition of a positive correlation with the area, suggesting the climatic condition, play a role in respiratory problems in that area. Factors such as crowding, dust, damp humid weather, or stress all can increase the disease [7]. Mortality caused by this disease has produced a serious economic loss and it can also lead to an enormous loss in the livestock industry. According to the reports of the veterinary organization in the project of sheep and goat pasteurellosis, Fars province was recognized as one of the most susceptible provinces to this disease. Considering the role of M. haemolytica in sheep pneumonia, identification and isolation of this bacterium can be effective in preventing this disease. In general, many studies have been carried out regarding the isolation and identification of M. haemolytica using different methods [8-12]. As a result, in the present study, 38 M. haemolytica were isolated from 161 samples through culture and biochemical experiments that were finally confirmed through PCR test. Although results of PCR using specified primers provided the sufficient decimation for identifying the bacterium, mPCR was also utilized. Abera et al. conducted a similar study in Ethiopia. They investigated 329 samples (185 nasal swabs and 144 lung tissues from abattoir) to identify Pasteurella. Among the 329 samples examined through PCR and culture, 14 samples (46.4%) were identified as M. haemolytica [10]. Results of our study support these findings, that is, all the 38 samples examined by PCR were positive for the presence of M. haemolytica. It should be noted that in our study, in addition to culture and PCR, mPCR was also utilized for more accurate identification and determination. Findings of the current study were in line with the findings of a study by Kumar et al. in India. In their study, 12 isolates with culture and phenotypic characteristics of M. haemolytica were isolated, all of which according to PCR test were positive as M. haemolytica [13]. In another study carried out in the northeast region of Ethiopia aimed at identifying and isolating Pasteurella species through culture and biochemical experiments and determining the prevalence of them in pneumonia risk factors in sheep and goats of 988 nasal swabs and blood samples, 322 samples were pneumonic, while 79.5% of isolates were M. haemolytica [8]. Still, in another study conducted in Ethiopia, sheep pneumonic pasteurellosis was examined. A total of 256 samples were collected. Pasteurella and M. haemolytica were isolated from 64 samples (38 [59.4%] lung tissues and 26 [40.6%] nasal swabs). It is worth noting that all samples isolated from lung tissues were M. haemolytica, while 69% of nasal samples were M. haemolytica, which is strongly in line with our findings. Based on the findings of that study and the present study, it can be concluded that M. haemolytica is the main factor of pneumonic pasteurellosis in sheep [9]. Moreover, in a similar study by Alexander et al., using the same primers as in our study, an mPCR was run and 15 previously isolated bacteria and 44 new isolates studied in their study were found to be positive as M. haemolytica [5]. Our findings showed that culture and PCR could be used for detection of M. haemolytica, but culture is very time-consuming, and PCR is very useful for fast identification of infectious agents. In addition, findings of the present study agree with the findings of Sabiel et al. who indicated that PCR is very useful and time saving for the identification of P. multocida and M. haemolytica [14].

Conclusion

The present study indicated that culture and PCR are both practical in identification and isolation of this bacterium though culture is more time-consuming. The utilized mPCR has been more successful in the identification of the bacteria since it requires less time and cost. Furthermore, we propose the PCR as a superior method among other methods of bacteriology for fast examination of infectious diseases and mPCR, which is a valuable tool for identification of M. haemolytica in clinical samples of animals.

Authors’ Contributions

This study is the major component of the work toward the M.Sc. thesis of FA. MT as supervisor of this work provided guidance during the entire experiment. FA wrote the first draft of the manuscript. Then, the whole manuscript was critically revised by MT. All authors have read and approved the final version of the manuscript.
  7 in total

Review 1.  How Mannheimia haemolytica defeats host defence through a kiss of death mechanism.

Authors:  Laurent Zecchinon; Thomas Fett; Daniel Desmecht
Journal:  Vet Res       Date:  2005 Mar-Apr       Impact factor: 3.683

2.  Taxonomic relationships of the [Pasteurella] haemolytica complex as evaluated by DNA-DNA hybridizations and 16S rRNA sequencing with proposal of Mannheimia haemolytica gen. nov., comb. nov., Mannheimia granulomatis comb. nov., Mannheimia glucosida sp. nov., Mannheimia ruminalis sp. nov. and Mannheimia varigena sp. nov.

Authors:  O Angen; R Mutters; D A Caugant; J E Olsen; M Bisgaard
Journal:  Int J Syst Bacteriol       Date:  1999-01

3.  Characterization of Pasteurella multocida associated with pneumonia in bighorn sheep.

Authors:  Glen C Weiser; Walter J DeLong; Julia L Paz; Bahman Shafii; William J Price; Alton C Ward
Journal:  J Wildl Dis       Date:  2003-07       Impact factor: 1.535

4.  Identification of a novel Mannheimia granulomatis lineage from lesions in roe deer (Capreolus capreolus).

Authors:  Anders M Bojesen; Jesper Larsen; Anders G Pedersen; Torsten Mörner; Roland Mattson; Magne Bisgaard
Journal:  J Wildl Dis       Date:  2007-07       Impact factor: 1.535

5.  A multiplex polymerase chain reaction assay for the identification of Mannheimia haemolytica, Mannheimia glucosida and Mannheimia ruminalis.

Authors:  Trevor W Alexander; Shaun R Cook; L Jay Yanke; Calvin W Booker; Paul S Morley; Ron R Read; Sheryl P Gow; Tim A McAllister
Journal:  Vet Microbiol       Date:  2008-01-19       Impact factor: 3.293

6.  A study on ovine pneumonic pasteurellosis: isolation and identification of Pasteurellae and their antibiogram susceptibility pattern in Haramaya District, Eastern Hararghe, Ethiopia.

Authors:  Haimanot D Marru; Takele T Anijajo; Adem A Hassen
Journal:  BMC Vet Res       Date:  2013-12-01       Impact factor: 2.741

7.  Rapid detection of Mannheimia haemolytica in lung tissues of sheep and from bacterial culture.

Authors:  Jyoti Kumar; Shivendra Kumar Dixit; Rajiv Kumar
Journal:  Vet World       Date:  2015-09-15
  7 in total
  5 in total

1.  Changes in selected cytokines, acute-phase proteins, gonadal hormones and reproductive organs of non-pregnant does challenged with Mannheimia haemolytica serotype A2 and its LPS endotoxin.

Authors:  Mat Isa Kamarulrizal; Eric Lim Teik Chung; Faez Firdaus Abdullah Jesse; Bura Thlama Paul; Amira Nur Azhar; Mohd Azmi Mohd Lila; Annas Salleh; Yusuf Abba; Mohd Shafarin Shamsuddin
Journal:  Trop Anim Health Prod       Date:  2022-04-15       Impact factor: 1.559

2.  Development and validation of an insulated isothermal PCR assay for the rapid detection of Mannheimia haemolytica.

Authors:  Xiaofang Dao; Chien-Che Hung; Youwen Yang; Juan Wang; Falong Yang
Journal:  J Vet Diagn Invest       Date:  2022-02-10       Impact factor: 1.279

3.  Isolation of the various serotypes of Mannheimia haemolytica and preparation of the first vaccine candidate in Iran.

Authors:  Hajar Molaee; Yahya Tahamtan; Ehlam Saeednezhad; Masoumeh Hayati
Journal:  Mol Biol Rep       Date:  2022-09-12       Impact factor: 2.742

4.  Isolation and molecular characterization of Mannheimia haemolytica and Pasteurella multocida associated with pneumonia of goats in Chhattisgarh.

Authors:  Nidhi Rawat; Varsha Rani Gilhare; Krishna Kumar Kushwaha; Deeksha Dipak Hattimare; Foziya Farzeen Khan; Rajesh Kumar Shende; Dhananjay Kumar Jolhe
Journal:  Vet World       Date:  2019-02-24

5.  Biological and molecular characterization of a sheep pathogen isolate of Mannheimia haemolytica and leukotoxin production kinetics.

Authors:  Dounia Bkiri; Noha Semmate; Zineb Boumart; Najete Safini; Fatima Zohra Fakri; Zahra Bamouh; Khalid Omari Tadlaoui; Siham Fellahi; Noursaid Tligui; Ouafaa Fassi Fihri; Mehdi El Harrak
Journal:  Vet World       Date:  2021-08-07
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.