Literature DB >> 29910522

Zombie-ant fungi across continents: 15 new species and new combinations within Ophiocordyceps. I. Myrmecophilous hirsutelloid species.

J P M Araújo1, H C Evans2, R Kepler3, D P Hughes1.   

Abstract

Ophiocordyceps species infecting ants - the so-called zombie-ant fungi - comprise one of the most intriguing and fascinating relationships between microbes and animals. They are widespread within tropical forests worldwide, with relatively few reports from temperate ecosystems. These pathogens possess the ability to manipulate host behaviour in order to increase their own fitness. Depending on the fungal species involved the infected ants are manipulated either to leave the nest to ascend understorey shrubs, to die biting onto vegetation, or descend from the canopy to die at the base of trees. Experimental evidence has demonstrated that the behavioural change aids spore dispersal and thus increases the chances of infection, because of the existing behavioural immunity expressed inside ant colonies that limits fungal development and transmission. Despite their undoubted importance for ecosystem functioning, these fungal pathogens are still poorly documented, especially regarding their diversity, ecology and evolutionary relationships. Here, we describe 15 new species of Ophiocordyceps with hirsutella-like asexual morphs that exclusively infect ants. These form a monophyletic group that we identified in this study as myrmecophilous hirsutelloid species. We also propose new combinations for species previously described as varieties and provide for the first time important morphological and ecological information. The species proposed herein were collected in Brazil, Colombia, USA, Australia and Japan. All species could readily be separated using classic taxonomic criteria, in particular ascospore and asexual morphology.

Entities:  

Keywords:  Behaviour manipulation; Camponotini; Entomopathogenic fungi; Host association; Hypocreales; Insect pathogen; Multigene phylogeny; O. albacongiuae Araújo, H.C. Evans & D.P. Hughes; O. blakebarnesii Araújo, H.C. Evans & D.P. Hughes; O. camponoti-chartificis Araújo, H.C. Evans & D.P. Hughes; O. camponoti-femorati Araújo, H.C. Evans & D.P. Hughes; O. camponoti-floridani Araújo, H.C. Evans & D.P. Hughes; O. camponoti-hippocrepidis Araújo, H.C. Evans & D.P. Hughes; O. camponoti-nidulantis Araújo, H.C. Evans & D.P. Hughes; O. camponoti-renggeri Araújo, H.C. Evans & D.P. Hughes; O. camponoti-sexguttati Araújo, H.C. Evans & D.P. Hughes; O. daceti Araújo, H.C. Evans & D.P. Hughes; O. kimflemingiae Araújo, H.C. Evans & D.P. Hughes; O. monacidis (H.C. Evans & Samson) Araújo, H.C. Evans & D.P. Hughes; O. naomipierceae Araújo, H.C. Evans & D.P. Hughes; O. oecophyllae Araújo, S. Abell, T. Marney, R. Shivas H.C. Evans & D.P. Hughes; O. ootakii Araújo, H.C. Evans & D.P. Hughes.; O. satoi Araújo, H.C. Evans & D.P. Hughes; Ophiocordyceps; Ophiocordyceps dolichoderi (H.C. Evans & Samson) Araújo, H.C. Evans & D.P. Hughes; Ophiocordyceps unilateralis; Zombie-ant fungi

Year:  2018        PMID: 29910522      PMCID: PMC6002356          DOI: 10.1016/j.simyco.2017.12.002

Source DB:  PubMed          Journal:  Stud Mycol        ISSN: 0166-0616            Impact factor:   16.097


Introduction

Fungi associated with insects are one of the most spectacular and diverse interactions found in nature. There is an enormous variety to consider: mutualistic symbionts (Suh ); fungi serving as an obligate food source, such as those found in fungus-gardening ants (Currie ); sexually- and behaviourally-transmitted parasites – e.g. Laboulbeniales (De Kesel 1996); and entomopathogenic fungi that are highly virulent and are considered to have pronounced effects on host populations (Evans 1974). Despite this increasing knowledge, fungal-insect associations still remain an understudied area of fungal biodiversity and likely harbour one of the largest reservoirs of undocumented species among Fungi. Insects, with more than a million described species (Foottit & Adler 2009) are distributed among 29 orders (Misof ). The fungal pathogens are able to colonize 19 of these orders, resulting in the evolution of a wide diversity of morphologies and strategies that enable infection and onward transmission using the insect body as the ecological niche (Araújo & Hughes 2016). Among these different strategies, one of the most impressive and sophisticated interactions between insects and entomopathogenic fungi is that involving ants and species of fungi in the genus Ophiocordyceps (Andersen ). The genus is estimated to have arisen about 100 million years ago (Sung ) and since then has colonized 10 orders of insects (Sanjuan et al., 2015, Araújo and Hughes, 2016), comprising about 200 species of entomopathogens (Crous ). Although ants account for less than 2 % of insect species, they contribute as much as 50 % of animal biomass in tropical forests (Hölldobler ). Ants occupy a wide range of habitats, from high canopy to the leaf litter, forming colonies comprising from a few dozen (Jahyny ) to millions of individuals (Currie ), especially in tropical forests. As such dominant members of most terrestrial biomes, ants are the most commonly encountered hosts for species in the genus Ophiocordyceps in tropical forests worldwide. The genus Ophiocordyceps was erected by Petch (1931) to accommodate species of Cordyceps that exhibited clavate thick-walled asci and ascospores that do not disarticulate into part-spores. Kobayasi (1941) used the term as a subgeneric classification, based solely on ascospore morphology. However, in more recent years, Sung proposed separation of the family Clavicipitaceae into three monophyletic families: Clavicipitaceae, Cordycipitaceae and Ophiocordycipitaceae, based on well-supported molecular data. The same study also proposed the re-establishment of Ophiocordyceps as a genus. All species forming a sister clade with Tolypocladium (former Elaphocordyceps, see Quandt ) were transferred from Cordyceps s.l. to Ophiocordyceps, including all species infecting ants. Included within that is the relatively well-known and iconic species O. unilateralis, which infects ants and dramatically alters their behaviour as a developmental necessity (Evans ). From the time when O. unilateralis sensu stricto was originally published – as Torrubia unilateralis (Tulasne & Tulasne 1865) – few species have been described belonging to this group, despite their diversity being estimated at about 580 species worldwide (Araújo & Hughes, unpublished data), and separation was considered to be premature – due to lack of data – or, at the best, at the varietal level (Evans & Samson 1984). Species delimitation in this group started to be investigated based on fresh specimens, where ascospore morphology and the germination process could be studied in depth (Evans ). In that study, four new species were described from Atlantic rainforest in Brazil, in which it was posited that each species within the tribe Camponotini could host a different species of Ophiocordyceps. Subsequently, with the support of molecular data, six species were described from Thailand (Luangsa-ard et al., 2011, Kobmoo et al., 2012), one from Japan (Kepler ) and three from the Brazilian Amazon (Araújo ). Consequently, there is increasing support for the “one ant-one Ophiocordyceps species” hypothesis as proposed by Evans . The present paper builds on the hypothesis. Asexual morphs associated with Ophiocordyceps, include Sorosporella, Syngliocladium, Paraisaria, Stilbella, Hymenostilbe and Hirsutella (Quandt ). With the exception of Sorosporella and Syngliocladium, all are recorded to be associated with ants. The asexual morphs Hymenostilbe and Hirsutella are commonly found associated with Ophiocordyceps infecting ants (myrmecophilous species) (Evans and Samson, 1982, Evans and Samson, 1984, Araújo et al., 2015, Araújo and Hughes, 2017). The two distinct clades that these asexual morphs form include the vast majority of myrmecophilous species within Ophiocordyceps: 1) O. unilateralis clade: O. unilateralis core clade + O. kniphofioides sub-clade, classified here as myrmecophilous hirsutelloids; 2) Species within Ophiocordyceps subg. Neocordyceps or “sphecocephala clade” sensu Sung , classified here as myrmecophilous hymenostilboids (see Araújo & Hughes 2017). This study focuses exclusively on myrmecophilous hirsutelloids. Both the O. unilateralis core clade and O. kniphofioides sub-clade can easily be distinguished in the field, based on macro-morphological and ecological characters. For instance, the typically orange ascoma produced by species within O. kniphofioides sub-clade develops on a stroma that emerges laterally from the host’s thorax with the fertile part covering 360° of the stalk. The hosts often die among the moss carpets at the base of large trees in the Amazon rainforest. Conversely, the stroma of species within O. unilateralis core clade consistently arises from the dorsal pronotum and produces a brown to black ascoma, attached laterally on the stalk (hence the “unilateralis” epithet). The hosts are exclusively Camponotini species (i.e. Camponotus, Colobopsis, Dinomyrmex and Polyrhachis) that once killed by the fungus, always die biting onto the substrate. Other characters such as ascospore morphology and germination, asexual morphs and differences in behaviour manipulation are also important criteria used to separate the species within these clades, discussed in detail below. The 15 new species proposed herein were collected during field surveys in five countries across four continents: South America (Brazil, Colombia), North America (USA), Oceania (Australia) and Asia (Japan). Based on macro-morphological characters, most species were readily identified as being part of the O. unilateralis core clade, with just one new species belonging to the O. kniphofioides sub-clade. The present work extends our understanding of this unique group of entomopathogens, providing novel insights into their morphology, ecology and evolution.

Material and methods

Sampling

Surveys were undertaken in the central Amazonian region of Brazil (Reserva Ducke, Manaus, Amazonas), Colombia (Canyon Rio Claro, Antioquia), USA (South Carolina, Florida and Missouri), Japan (Matsuoyama and ArimaFuji Park, Kyoto) and Australia (Licuala State Forest and Kuranda, Queensland). Reserva Ducke (Brazil) comprises ca. 10 000 ha of terra-firme forest with plateaus, lowlands and campinarana vegetation, characterized by areas of sandy soil across the Rio Negro basin. Canyon Rio Claro Reserve (Colombia) encompasses 450 ha of tropical forest and canyons along the Magdalena River with marble caves and a rich diversity of plants and animals. The Japanese species were collected at Matsuoyama (Mt. Matsuo), a mountainous area with up to 687 m elevation, on the west side of Kyoto and Arima Fuji Park, located at the base of Mt. Arimafuji, Sanda, Hyogo Prefecture. In Australia, two places served as collecting sites: Licuala State Forest comprising almost 900 000 ha of lowland tropical forest dominated by the native fan palm Licuala ramsayi, but also areas of eucalyptus forest, wetlands and mangrove forests. Kuranda is a tropical rainforest on the eastern edge of the Atherton Tablelands at an elevation of 380 m. The North American sites are composed of deciduous forests with snowfall and below-zero temperatures during winter (Missouri and South Carolina), which contrast with the Florida site, composed of ever-green tropical rainforest. Our sampling protocol consisted of a careful inspection of the soil, leaf litter, shrub leaves and tree trunks, up to ca. 2 m high. Infected ants – and the substrata they were attached to – were collected in plastic containers, transported to the laboratory and, when possible, examined the same day. During longer surveys, the samples that exhibited informative taxonomic characters were air-dried overnight to prevent growth of opportunistic fungi. For molecular work, samples were placed in plastic tubes with 100–200 μL CTAB (G-Biosciences) for further DNA extraction. All specimens were photographed individually, using a Canon 7D camera equipped with EF-100 mm macro lens or MP-E 65 mm (×5) with a MT-24EX Canon macro lite flash attached.

Morphological studies

For macro-morphological characterization, specimens were examined using a stereoscopic microscope Olympus SZX16 and sorted for further micro-morphological studies. The characters investigated were: host location (e.g. leaf, spine, trunk, moss, base of trunk, soil); interaction between fungus/substrate (e.g. presence or absence of attachment structures); ascomatal size, colour, position, presence/absence and characterization of asexual morphs and perithecial insertion (e.g. immersed, semi-immersed, erumpent, superficial). For micro-morphological characterization, either free-hand or cryosectioning of the ascoma was performed using a Leica CM1950 Cryostat. Samples were mounted on a slide with lacto-fuchsin (0.1 g of acid fuchsin in 100 mL of lactic acid) for light microscopy examination using an Olympus BX61. In order to obtain naturally released ascospores, infected ants with mature ascomata were attached to the lid of a plastic Petri plate (9 cm diam) using tape, and suspended above a plate containing either distilled water agar (DWA) or potato-dextrose agar (PDA). Plates were transferred to sheltered stands installed in the forest, subject to natural temperature and light fluctuations. The plates containing the infected ants were examined twice a day for the presence of ascospores, once in the morning and again after sunset. When present, ejected ascospores form sub-hyaline halos on the agar surface. Part of the freshly deposited ascospores was removed with a sterile hypodermic needle under a stereoscopic microscope, and mounted on a slide with lacto-fuchsin for light microscopy examination (Olympus BX61). The remaining ascospores were left on the agar surface and examined over a number of days in order to follow germination events. A minimum of 50 naturally released (mature) ascospores was measured for morphological comparison (Table 1).
Table 1

Comparison of morphological characters, host and geographical location of myrmecophilous hirsutelloid species of Ophiocordyceps.

SpeciesHostDeath positionAscospore
Hirsutella asexual morph
SourceComplexDistribution
Size (μm)CapilliconidiophoreSeptationABCParaisaria-likeStilbelliformis
Ophiocordyceps albacongiuaeCamponotus sp.biting epiphytes80–100 × 5na5–6This studyO. unilateralis s.l.Colombia
O. blakebarnesiiCamponotus sp.biting inside log140–160 × 4na6–7xThis studyUSA (Missouri)
O. camponoti-atricipisCamponotus atricepsbiting leaf80–85 × 3555xAraújo et al. (2015)Brazilian Amazon
O. camponoti-balzaniCamponotus balzanibiting leaf135–174 × 4–514–22xxEvans et al. (2011)Brazilian Atlantic Rainforest
O. camponoti-bispinosiCamponotus bispinosusbiting spines70–75 × 4.5654–5xAraújo et al. (2015)Brazilian Amazon
O. camponoti-chartificisCamponotus chartifexbiting leaf75–85 × 575–909–13xThis studyBrazilian Amazon
O. camponoti-femoratiCamponotus femoratusbiting leaf/spines75–90 × 335–405xThis studyBrazilian Amazon
O. camponoti-floridaniCamponotus floridanusbiting leaf75–90 × 4–5na5xThis studyUSA (Florida)
O. camponoti-hippocrepidisCamponotus hippocrepisbiting spines75–85 × 4–545–505xThis studyBrazilian Amazon
O. camponoti-indianiCamponotus indianusbiting leaf75 × 4.51305xxAraújo et al. (2015)Brazilian Amazon
O. camponoti-leonardiCamponotus leonardibiting leaf110–125 × 2–37–8xKobmoo et al. (2012)Thailand
O. camponoti-melanoticiCamponotus melanoticusbiting leaf170–210 × 4–520–2527–35xEvans et al. (2011)Brazilian Atlantic Rainforest
O. camponoti-nidulantisCamponotus nidulandbiting saplings90–105 (−115) × 3–450–605xxThis studyBrazilian Amazon
O. camponoti-novogranadensisCamponotus novogranadensisbiting epiphytes75–95 × 2.5–3.55–10xxEvans et al. (2011)Brazilian Atlantic Rainforest
O. camponoti-renggeriCamponotus renggeribiting leaf/moss90–120 × 45–8xThis studyBrazilian Amazon
O. camponoti-rufipedisCamponotus rufipesbiting leaf80–95 × 2–360–704–7xEvans et al. (2011)Brazilian Atlantic Rainforest
O. camponoti-saundersiCamponotus saundersibiting leaf75–85 × 2–37–8xKobmoo et al. (2012)Thailand
O. camponoti-sexguttatiCamponotus sexguttatusbiting leaf120–140 × 325–307xThis studyBrazilian Amazon
O. halabalaensisCamponotus gigasbiting leaf60–75 × 3–57–8xLuangsa-ard et al. (2011)Thailand
O. kimflemingiaeCamponotus castaneusbiting twig80–90 × 580–1005–6xxThis studyUSA (South Carolina)
O. naomipierceaePolyrhachis cf. robsoniibiting leaf75–105 × 5–6na4–6xxThis studyAustralia
O. oecophyllaeOecophylla smaragdinabiting leafxThis studyAustralia
O. ootakiiPolyrhachis sp.biting leaf85–100 × 3na5xThis studyJapan
O. polyrhachis-furcataPolyrhachis furcatabiting leaf90–100 × 2–30xKobmoo et al. (2012)Thailand
O. ramiCamponotus sp.biting green twigs200–215 × 2–37–8xKobmoo et al. (2015)Thailand
O. satoiPolyrhachis sp.biting twig85–100 × 440–505xThis studyJapan
O. septaCamponotus sp.biting leaf45–50 × 6–87–8xKobmoo et al. (2015)Thailand
O. sp. (Gh 41)Polyrhachis sp.biting trunknananaThis studyGhana
O. monacidisDolichoderus bispinosusbase of trunk (moss)95–110×?3–4xEvans & Samson (1982)/This studyO. kniphofioides s.l.Brazilian Amazon
O. dacetiDaceton armigerumleaf (not biting)xThis studyBrazilian Amazon, Colombia
O. kniphofioidesCephalotes atratusbase of trunk110–150 × 1.5–33–5xEvans & Samson (1982)Brazilian Amazon, Colombia
O. ponerinarumParaponera clavatabase of trunkxEvans & Samson (1982)Brazilian Amazon, Colombia

Bold represents species described in this study.

Comparison of morphological characters, host and geographical location of myrmecophilous hirsutelloid species of Ophiocordyceps. Bold represents species described in this study.

DNA extraction, PCR and sequencing

All the species proposed in this study were collected in their natural habitat. The DNA templates were obtained directly from the specimens with the following protocol: samples were placed in 1.5 mL Eppendorf tubes with 100–200 μL of CTAB immediately after collection. In the lab, the samples were ground mechanically, 400 μL of CTAB were added and samples were incubated at 60 °C for 20 min and then centrifuged for 10 min at 14 000 rpm. The supernatant (approx. 400 μL) was transferred to a new 1.5 mL Eppendorf tube, mixed with 500 μL of 24:1 Chloroform: Isoamyl-alcohol (Sigma) and mixed by inverting. The mix was then centrifuged for 20 min at 14 000 rpm and the supernatant transferred to a new 1.5 mL Eppendorf tube and further cleaned using the GeneCleanIII kit (MP Biomedicals), following the recommended protocol. The only step modified was the addition of 30 μL of GlassMilk per sample, instead of the recommended 10 μL, to increase yield. Five loci were used in the analyses, i.e. small subunit nuclear ribosomal DNA (SSU), large subunit nuclear ribosomal DNA (LSU), translation elongation factor 1-α (tef) and the largest and second largest subunits of RNA polymerase II (RPB1 and RPB2 respectively) with a total read length of approximately 4 600 bp. However, for our field collected samples, RPB2 could not be successfully amplified. The primers used were, SSU: NS1 (GTAGTCATATGCTTGTCTC) and NS4 (CTTCCGTCAATTCCTTTAAG) (White ); LSU: LR0R (5′-ACCCGCTGAACTTAAGC-3′) and LR5 (5′-TCCTGAGGGAAACTTCG-3′) (Vilgalys & Sun 1994); tef: 983F (5′-GCYCCYGGHCAYCGTGAYTTYAT-3′) and 2218R (5′-ATGACACCRACRGCRACRGTYTG-3′); RPB1: (5′-CCWGGYTTYATCAAGAARGT-3′) (Castlebury ) and RPB1Cr_oph was designed specifically to address the species proposed herein (5′-CTGVCCMGCRATGTCGTTGTCCAT-3′). All the RPB2 sequences were downloaded from GenBank. Each 25 μL-PCR reaction contained 4.5 μL of Buffer E (Premix E – Epicentre), 0.5 μL of each forward and reverse primer (10 mM), 1 μL of DNA template, 0.1 Platinum Taq Polymerase (Invitrogen) and 18.4 μL of Ultra Pure Distilled Water (Gibco). The PCR reactions were placed in a Biometra T300 thermocycler under the following conditions: for SSU and LSU (1) 2 min at 94 °C, (2) 4 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 2 min, followed by (3) 35 cycles of denaturation at 94 °C for 30 s, annealing at 50.5 °C for 1 min, and extension at 72 °C for 2 min and (4) 3 min at 72 °C. For tef and RPB1(1) 2 min at 94 °C, (2) 10 cycles of denaturation at 94 °C for 30 s, annealing at 64 °C for 1 min, and extension at 72 °C for 1 min, followed by (3) 35 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 1 min, and extension at 72 °C for 1 min and (4) 3 min at 72 °C. Each 25 μL PCR reaction was cleaned by adding 3.75 μL of Illustra ExoProStar enzymatic PCR clean up (1:1 mix of Exonuclease I and Alkaline Phosphatase) (GE Healthcare Life Sciences), incubated at 37 °C for 1 h and 80 °C for 15 min in the thermocycler. The clean PCR products were sequenced by Sanger DNA sequencing (Applied Biosystems 3730XL) at Genomics Core Facility service at Penn State University.

Phylogenetic analyses

The raw sequence reads (.ab1 files) were edited manually using Geneious v. 8.1.8 (Kearse ). Individual gene alignments were generated by MUSCLE (Edgar 2004). The alignment of every gene was improved manually, annotated and concatenated into a single combined dataset using Geneious v. 8.1.8 (Kearse ). Ambiguously aligned regions were excluded from phylogenetic analysis and gaps were treated as missing data. The final alignment length was 4598 bp: 1031 bp for SSU, 893 bp for LSU, 991 bp for tef, 641 bp for RPB1, and 1042 for RPB2. Maximum likelihood (ML) analysis was performed with RAxML v. 8.2.4 (Stamatakis 2006) on a concatenated dataset containing all five genes. The dataset consisted of 11 data partitions, these included one each for SSU and LSU, and three for each of the three codon positions of the protein coding genes, tef, RPB1 and RPB2. The GTRGAMMA model of nucleotide substitution was employed during the generation of 1 000 bootstrap replicates. Bayesian analyses were performed with MrBayes v. 3.2.6 (Ronquist ). The dataset was partitioned as in likelihood analyses. The GTRGAMMA model with invariant sites was applied separately to each model. Two independent runs of five million generations were executed simultaneously, with four chains per run, and trees were sampled and printed to output every 500 generations. After the analyses had stopped, runs were checked for convergence and sampling of model parameters. The first 25 % of trees sampled were discarded as burning. The remaining trees were used to create a consensus tree using the sumt function. Branches were considered strongly supported if posterior probabilities were 0.95 or higher. For this study, we generated 142 new sequences (40 for SSU, 37 for LSU, 33 for tef and 32 for RPB1), all deposited in GenBank (Table 2).
Table 2

Specimen information, GenBank accession number, host association and location. The species in bold are the new taxa presented in this study.

SpeciesVoucher informationSSULSUTEFRPB1RPB2HostLocation
Hirsutella sp.NHJ 12525EF469125EF469078EF469063EF469092EF469111n/an/a
OSC 128575EF469126EF469079EF469064EF469093EF469110n/an/a
Ophiocordyceps acicularisOSC 128580DQ522543DQ518757DQ522326DQ522371DQ522423ColeopteraUSA
OSC 110987EF468950EF468805EF468744EF468852n/aColeopteraUSA
OSC 110988EF468951EF468804EF468745EF468853n/aColeopteraUSA
ARSEF 5692DQ522540DQ518754DQ522322DQ522368DQ522418ColeopteraKorea
O. albacongiuaeRC20KX713633n/aKX713670n/an/aHymenoptera (Camponotus sp.)Colombia
O. amazonicaHUA 186143KJ917562KJ917571KM411989KP212902KM411982OrthopteraColombia
HUA 186113KJ917566KJ917571n/aKP212903KM411980OrthopteraColombia
O. annulataCEM 303KJ878915KJ878881KJ878962KJ878995n/aColeopteraJapan
O. aphodiiARSEF 5498DQ522541DQ518755DQ522323n/aDQ522419Coleopteran/a
O. australisHUA 186147KC610784KC610764KC610734KF658678n/aHymenopteraColombia
HUA 186097KC610786KC610765KC610735KF658662n/aHymenopteraColombia
O. blakebarnesiiMISSOU5KX713641KX713610KX713688KX713716n/aHymenoptera (Camponotus sp.)USA (Missouri)
MISSOU4KX713642KX713609KX713685KX713715n/aHymenoptera (Camponotus sp.)USA (Missouri)
MISSOU3KX713643KX713608KX713687KX713714n/aHymenoptera (Camponotus sp.)USA (Missouri)
MISSOU1KX713644n/aKX713686KX713713n/aHymenoptera (Camponotus sp.)USA (Missouri)
O. monacidisMF74CKX713646KX713606n/an/an/aHymenoptera (Dolichoderus bispinosus)Brazil (Amazon)
MF74KX713647KX713605n/aKX713712n/aHymenoptera (Dolichoderus bispinosus)Brazil (Amazon)
O. brunneipunctataOSC 128576DQ522542DQ518756DQ522324DQ522369DQ522420Coleopteran/a
O. buquetiiHMAS_199613KJ878939KJ878904KJ878984KJ879019n/aHymenopteraChina
HMAS_199617KJ878940KJ878905KJ878985KJ879020n/aHymenopteraChina
O. camponoti-atricipisATRI3KX713666n/aKX713677n/an/aHymenoptera (Ophiocordyceps atriceps)Brazil (Amazon)
O. camponoti-balzaniG143KX713658KX713595KX713690KX713705n/aHymenoptera (Camponotus balzani)Brazil (Atlantic Rainforest)
G104KX713660KX713593KX713689KX713703n/aHymenoptera (Camponotus balzani)Brazil (Atlantic Rainforest)
O. camponoti-bispinosiOBIS5KX713636KX713616KX713693KX713721n/aHymenoptera (Camponotus bispinosus)Brazil (Amazon)
OBIS4KX713637KX713615KX713692KX713720n/aHymenoptera (Camponotus bispinosus)Brazil (Amazon)
OBIS3KX713638KX713614KX713695n/an/aHymenoptera (Camponotus bispinosus)Brazil (Amazon)
OBISKX713639KX713612KX713694KX713718n/aHymenoptera (Camponotus bispinosus)Brazil (Amazon)
BISPI2KX713665KX713588n/aKX713700n/aHymenoptera (Camponotus bispinosus)Brazil (Amazon)
OBIS2n/aKX713613KX713691KX713719n/aHymenoptera (Camponotus bispinosus)Brazil (Amazon)
O. camponoti-femoratiFEMO2KX713663KX713590KX713678KX713702n/aHymenoptera (Camponotus femoratus)Brazil (Amazon)
O. camponoti-floridaniFlx1KX713661n/an/an/an/aHymenoptera (Camponotus femoratus)Brazil (Amazon)
Flo4KX713662KX713591n/an/an/aHymenoptera (Camponotus femoratus)Brazil (Amazon)
Flx2n/aKX713592KX713674n/aHymenoptera (Camponotus femoratus)Brazil (Amazon)
O. camponoti-hippocrepidisHIPPOCKX713655KX713597KX713673KX713707n/aHymenoptera (Camponotus hippocrepis)Brazil (Amazon)
O. camponoti-indianiINDI2KX713654KX713598n/an/an/aHymenoptera (Camponotus indianus)Brazil (Amazon)
O. camponoti-nidulantisNIDUL2KX713640KX713611KX713669KX713717n/aHymenoptera (Camponotus nidulans)Brazil (Amazon)
O. camponoti-novogranadensisMal63KX713648KX713603n/an/an/aHymenoptera (Camponotus novogranadensis)Brazil (Atlantic Rainforest)
Mal4KX713649KX713602n/an/an/aHymenoptera (Camponotus novogranadensis)Brazil (Atlantic Rainforest)
O. camponoti-renggeriRENG2KX713632n/aKX713672n/an/aHymenoptera (Camponotus renggeri)Brazil (Amazon)
ORENGKX713634KX713617KX713671n/an/aHymenoptera (Camponotus renggeri)Brazil (Amazon)
O. camponoti-rufipedisG177KX713657KX713596KX713680n/an/aHymenoptera (Camponotus rufipes)Brazil (Atlantic Rainforest)
G108KX713659KX713594KX713679KX713704n/aHymenoptera (Camponotus rufipes)Brazil (Atlantic Rainforest)
O. citrinaTNS F18537n/aKJ878903KJ878983n/aKJ878954HemipteraJapan
O. clavataNBRC 106962JN941726JN941415n/aJN992460n/an/an/a
NBRC 106961JN941727JN941414n/aJN992461n/an/an/a
CEM1762KJ878916KJ878882KJ878963KJ878996n/aColeopteraChina
CEM1763n/aKJ878883KJ878964KJ878997n/aColeopteraChina
O. satoiJ19KX713650KX713601KX713684KX713710n/aHymenoptera (Polyrhachis lamellidens)Japan
J7KX713653KX713599KX713683KX713711n/aHymenoptera (Polyrhachis lamellidens)Japan
O. cochlidiicolaHMAS_199612KJ878917KJ878884KJ878965KJ878998n/aLepidopteraChina
O. communisNHJ 12581EF468973EF468831EF468775n/aEF468930Coleopteran/a
NHJ 12582EF468975EF468830EF468771n/aEF468926Coleopteran/a
O. curculionumOSC 151910KJ878918KJ878885n/aKJ878999n/aColeopteraGuyana
O. dacetiMF01n/aKX713604KX713667n/an/aHymenoptera (Daceton armigerum)Brazil (Amazon)
O. dipterigenaOSC 151911KJ878919KJ878886KJ878966KJ879000n/aDipteraUSA
OSC 151912KJ878920KJ878887KJ878967KJ879001n/aDipteraUSA
O. elongataOSC 110989n/aEF468808EF468748EF468856n/aLepidopteran/a
O. entomorrhizaKEW 53484EF468954EF468809EF468749EF468857EF468911Lepidopteran/a
TNS 16252KJ878941KJ878906KJ878986n/an/aColeopteraJapan
TNS 16250KJ878942n/aKJ878987KJ879021n/aColeopteraJapan
O. formicarumTNS F18565KJ878921KJ878888KJ878968KJ879002KJ878946HymenopteraJapan
O. formosanaTNM F13893KJ878908n/aKJ878956KJ878988KJ878943ColeopteraTaiwan
O. forquignoniiOSC 151902KJ878912KJ878876n/aKJ878991KJ878945DipteraFrance
OSC 151908KJ878922KJ878889n/aKJ879003KJ878947DipteraFrance
O. gracilisEFCC 3101EF468955EF468810EF468750EF468858EF468913Lepidopteran/a
EFCC 8572EF468956EF468811EF468751EF468859EF468912Lepidopteran/a
O. gracillisimaOphgrc679n/aKC610768KC610744KF658666n/aColeopteraColombia
O. heteropodaOSC 106404AY489690AY489722AY489617AY489651n/aHemipteraAustralia
EFCC 10125EF468957EF468812EF468752EF468860EF468914Hemipteran/a
O. irangiensisOSC 128577DQ522546DQ518760DQ522329DQ522374DQ522427Hymenopteran/a
OSC 128578DQ522556DQ518770DQ522345DQ522391DQ522445Hymenopteran/a
OSC 128579EF469123EF469076EF469060EF469089EF469107Hymenopteran/a
O. kimflemingiaeSC03BKX713619KX713619n/aKX713723n/aHymenoptera (Camponotus castaneus/americanus)USA (South Carolina)
SC30KX713629KX713622KX713699KX713727n/aHymenoptera (Camponotus castaneus/americanus)USA (South Carolina)
SC27KX713630KX713621n/aKX713726n/aHymenoptera (Camponotus castaneus/americanus)USA (South Carolina)
SC09BKX713631KX713620KX713698KX713724n/aHymenoptera (Camponotus castaneus/americanus)USA (South Carolina)
SC03An/an/aKX713697KX713722n/aHymenoptera (Camponotus castaneus/americanus)USA (South Carolina)
SC36n/aKX713623n/aKX713728n/aHymenoptera (Camponotus castaneus/americanus)USA (South Carolina)
SC100n/aKX713624KX713696KX713725n/aHymenoptera (Camponotus castaneus/americanus)USA (South Carolina)
SCXn/aKX713625n/aKX713729n/aHymenoptera (Camponotus castaneus/americanus)USA (South Carolina)
O. kniphofioidesOphkni975KC610790KF658679KC610739KF658667KC610717HymenopteraColombia
O. konnoanaEFCC 7295EF468958n/an/aEF468862EF468915ColeopteraKorea
EFCC 7315EF468959n/aEF468753EF468861EF468916ColeopteraKorea
O. lloydiiOSC 151913KJ878924KJ878891KJ878970KJ879004KJ878948HymenopteraEcuador
O. longissimaTNS F18448KJ878925KJ878892KJ878971KJ879005n/aHemipteraJapan
HMAS_199600KJ878926n/aKJ878972KJ879006KJ878949HemipteraChina
EFCC 6814n/aEF468817EF468757EF468865n/aHemipteraKorea
O. melolonthaeOSC 110993DQ522548DQ518762DQ522331DQ522376n/aColeopteran/a
O. myrmecophilaHMAS_199620KJ878927KJ878893KJ878973KJ879007n/aHymenopteraChina
CEM1710KJ878928KJ878894KJ878974KJ879008n/aHymenopteraChina
TNS 27120KJ878929KJ878895KJ878975KJ879009n/aHymenopteraJapan
O. naomipierceaeDAWKSANTKX713664KX713589n/aKX713701n/aHymenoptera (Polyrhachis cf. robsonii)n/a
O. neovolkianaOSC 151903KJ878930KJ878896KJ878976KJ879010n/aColeopteraJapan
O. nigrellaEFCC 9247EF468963EF468818EF468758EF468866EF468920Korea
O. nutansOSC 110994DQ522549DQ518763DQ522333DQ522378n/aHemipteran/a
O. odonataeTNS F18563n/aKJ878877n/aKJ878992n/aOdonataJapan
TNS 27117n/aKJ878878n/an/an/aOdonataJapan
O. oecophyllaeOECO1KX713635n/an/an/an/aHymenoptera (Oecophylla smaragdina)Australia
O. ootakiiJ14KX713651n/aKX713682KX713709n/aHymenoptera (Polyrhachis moesta)Japan
J13KX713652KX713600KX713681KX713708n/aHymenoptera (Polyrhachis moesta)Japan
O. ponerinarumHUA 186140KC610789KC610767KC610740KF658668n/aHymenoptera (Paraponera clavata)Brazil, Colombia, Ecuador
O. pulvinataTNS-F 30044GU904208GU904209GU904210n/aHymenoptera (Camponotus obscuripes)Japan
O. purpureostromataTNS F18430KJ878931KJ878897KJ878977KJ879011n/aColeopteraJapan
O. raveneliiOSC 110995DQ522550DQ518764DQ522334DQ522379DQ522430Coleopteran/a
OSC 151914KJ878932n/aKJ878978KJ879012KJ878950ColeopteraUSA
O. rhizoideaNHJ 12529EF468969EF468824EF468765EF468872EF468922Coleopteran/a
NHJ 12522EF468970EF468825EF468764EF468873EF468923Coleopteran/a
O. sinensisEFCC 7287EF468971EF468827EF468767EF468874EF468924Lepidopteran/a
O. soboliferaKEW 78842EF468972EF468828n/aEF468875EF468925Hemipteran/a
TNS F18521KJ878933KJ878898KJ878979KJ879013n/aHemipteraJapan
O. sp.Gh41KX713656n/aKX713668KX713706n/aHymenoptera (Polyrhachis sp.)Ghana (Atewa)
TNS F18495KJ878934KJ878899KJ878980KJ879014n/aHemipteraUSA
OSC 151904KJ878935n/aKJ878981KJ879015KJ878951HemipteraUSA
OSC 151905KJ878936KJ878900KJ878982KJ879016KJ878952HymenopteraGuyana
O. sphecocephalaOSC 110998DQ522551DQ518765DQ522336DQ522381DQ522432Hymenopteran/a
O. stylophoraOSC 111000DQ522552DQ518766DQ522337DQ522382DQ522433Coleopteran/a
OSC 110999EF468982EF468837EF468777EF468882EF468931Coleopteran/a
O. tricentriCEM 160AB027330AB027376n/an/an/aHemipteran/a
O. unilateralisOSC 128574DQ522554DQ518768DQ522339DQ522385DQ522436HymenopteraThailand
SERI2KX713627n/aKX713676KX713731n/aHymenoptera (Camponotus sericeiventris)n/a
SERI1KX713628KX713626KX713675KX713730n/aHymenoptera (Camponotus sericeiventris)Brazil (Atlantic Rainforest)
O. variabilisARSEF 5365DQ522555DQ518769DQ522340DQ522386DQ522437Dipteran/a
OSC 111003EF468985EF468839EF468779EF468885EF468933n/aUSA
O. yakusimensisHMAS_199604KJ878938KJ878902n/aKJ879018KJ878953HemipteraChina
Specimen information, GenBank accession number, host association and location. The species in bold are the new taxa presented in this study.

Results

DNA sequencing

We used a BLAST search in the GenBank nucleotide database to ensure the quality of the sequences generated in this study. Sequences that were identified as species not closely related to the species treated in this study were discarded and interpreted to be from a contaminant. All the sequences included here passed the above quality control checks.

Phylogenetic relationships

Phylogenetic analyses recovered the topology presented by Sung and Quandt with bootstrap proportions (BP=) of 99 % for family level, i.e. Ophiocordycipitaceae and 81 % for generic level, i.e. Ophiocordyceps. The O. unilateralis clade was resolved as a monophyletic group of 23 species with bs = 100 % and O. oecophyllae sp. nov. as its sister taxon with bs = 77 %. We refer to the O. unilateralis core clade as the clade formed by the following species: O. kimflemingiae sp. nov., O. camponoti-hippocrepidis sp nov., O. camponoti-renggeri sp. nov., O. albacongiuae sp. nov., O. camponoti-nidulantis sp. nov., O. camponoti-atricipis, O. camponoti-floridani sp. nov., O. camponoti-balzani, O. camponoti-rufipedis, O. camponoti-femorati sp. nov., O. camponoti-chartificis sp. nov., O. camponoti-bispinosi, O. pulvinata, O. blakebarnesii sp. nov., O. rami, O. naomipierceae sp. nov., O. ootakii sp. nov., O. halabalaensis, O. camponoti-saundersi, O. satoi nom. et. stat. nov., O. polyrhachis-furcata and O. camponoti-leonardi. There are three other species described previously that also belong to this clade but were not included in this study due to lack of molecular data: O. camponoti-melanotici, O. camponoti-indiani and O. camponoti-novogranadensis. Future field surveys will address the recollection of these species for molecular studies. The O. unilateralis clade is strongly supported (BP = 100), with an emergent internal structure. There is a strongly supported clade of Old World species (BP = 90), as well as a poorly supported node splitting species comprised largely of New World taxa, but also including O. pulvinata, a species known only from Japan. The species within the O. kniphofioides sub-clade share a broad range of morphological and ecological traits, which reflects in their phylogenetic placement as a monophyletic group.

Taxonomic treatment

Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822289. Fig. 1.
Fig. 1

Ophiocordyceps daceti. A. Infected Daceton armigerum on the leaf litter. B. Cross-section of the synnema. C. Close-up of synnema showing the Hirsutella hymenium. D–F. Verrucose phialides. G. Phialides at early developmental stage. H. Close-up of the hymenium of verrucose Hirsutella phialides. Scale bars: A = 5 mm, B = 200 μm, C = 50 μm, D–H = 10 μm.

Ophiocordyceps daceti. A. Infected Daceton armigerum on the leaf litter. B. Cross-section of the synnema. C. Close-up of synnema showing the Hirsutella hymenium. D–F. Verrucose phialides. G. Phialides at early developmental stage. H. Close-up of the hymenium of verrucose Hirsutella phialides. Scale bars: A = 5 mm, B = 200 μm, C = 50 μm, D–H = 10 μm. Etymology: Named after the ant host genus, Daceton. Specimens examined: Brazil, Reserva Adolpho Ducke, Manaus, Amazonas, on Daceton armigerum (Latreille) (Myrmicinae, Daceti), 15 Jan. 2016, J.P.M. Araújo, holotype INPA 274561. External mycelium scarce, ginger brown. Single synnema arising from the dorsal pronotum, 1.2 cm in length, cylindrical, velvety, ginger brown, covered with Hirsutella-like phialides. No sexual morph observed. Asexual morph: Hirsutella-like phialides; cylindrical to lageniform, averaging 16–18 × 4 μm, tapering to a long neck 4–6 μm in length; verrucose. Conidia cylindrical, smooth, 7–10 × 3 μm. Habitat: Brazilian Central Amazon rainforest. Host found attached to a leaf in the leaf litter. It was assumed the ant had died attached to the leaf when it was still on the plant. This is because other samples (n = 5) were found attached to the petiole or abaxial surface of leaves in the understorey vegetation (<1.5 m). No biting behaviour was observed, but attachment to the substrate was by the host’s legs. The highly distinctive trap- jawed ant is strictly arboreal (Dejean ), to such an extent that when an ant falls from the canopy it glides and can direct its descent enabling it to land on tree trunks (Yanoviak et. al. 2005). The fact that diseased ants are found in the litter and understorey layers indicates a dramatic behavioural change following infection. Additional specimens examined: Paratypes: Brazil, Reserva Adolpho Ducke: locality as above, 22 Jan. 2016, J.P.M. Araújo, U04 (INPA 274562). Araújo, S. Abell, T. Marney, R. Shivas, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822290. Fig. 2.
Fig. 2

A.Oecophylla smaragdina infected and biting the main vein of a leaf. B. Leg joints with phialides. C–D. Phialides. E. Phialides and conidia. Scale bars: A = 1 mm, B = 0.4 mm, C–E = 10 μm.

A.Oecophylla smaragdina infected and biting the main vein of a leaf. B. Leg joints with phialides. C–D. Phialides. E. Phialides and conidia. Scale bars: A = 1 mm, B = 0.4 mm, C–E = 10 μm. Etymology: Named after the host ant genus, Oecophylla. Specimens examined: Australia, Licuala State Forest, Wongaling Beach, Queensland, on Oecophylla smaragdina (Formicinae: Oecophyllini), 8 Jun. 2015, S. Abell, T.S. Marney, R.G. Shivas, holotype BRIP 62635. Mycelium emerging from leg joints and fissures, superficial on exoskeleton, white at early stages becoming brown with age. Conidiophores initially sterigmatic, integrated (not on synnemata), ampulliform, 3–10 × 3–4.5 μm, with an apical sterigma-like appendage up to 10 μm, at maturity phialidic, integrated in hyphae, gradually tapering 30–80 μm long, 5–7 μm at base, septate, pale brown at base becoming subhyaline at apex, straight or slightly curved, occasionally branched one or more times forming more complex structures. Conidiogenous cells 30–50 μm, 3–4 μm at base, tapering evenly to 1–1.5 μm at apex, terminal, subhyaline. Conidia ovoid to cylindrical, 5.5–10 × 1.5–3 μm, hyaline, smooth, rounded at apex, truncate at base, slightly darkened periclinally at base. No sexual morph observed in any of the infected Oecophylla smaragdina collected. Habitat: Tropical Australia, rainforest. Found biting leaves at elevated positions on understorey shrubs in coastal forest; common, associated with epizootics, and characterized by the absence of the abdomen, whole or part legs, antennae (see Fig. 2A), or with only the head remaining. We suggest that the activity of other Oecophylla ants resulted in the loss of body parts. This may be because of an anti-parasite behaviour by the uninfected colony members or it may be a parasite strategy where onward infection requires close contact between susceptible ants and cadavers. Whatever possible explanation, it is likely that onward transmission requires contact and this contact is aggressive behaviour by the healthy ants leading to extensive cadaver damage. Such behaviour may explain the absence of the sexual morph and the dominance of the asexual morph due to insufficient nutrients. Typically, the abdomen of infected ants is packed with lipid-filled hyphal bodies providing the resources for stromatal development. Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822291. Fig. 3.
Fig. 3

Ophiocordyceps camponoti–sexguttati. A.Camponotus sexguttatus biting into vegetation with the long stroma arising from its dorsal pronotum. B. Close-up of the ascoma. C. Section through ascoma showing the perithecial arrangement. D. Close-up of perithecium. E. Long ascospores with the straight capilliconidiophore bearing an apical capilliconidium. F. Ascus. Scale bars: A = 5 mm, B = 1 mm, C = 100 μm, D = 50 μm, E–F = 20 μm.

Ophiocordyceps camponoti–sexguttati. A.Camponotus sexguttatus biting into vegetation with the long stroma arising from its dorsal pronotum. B. Close-up of the ascoma. C. Section through ascoma showing the perithecial arrangement. D. Close-up of perithecium. E. Long ascospores with the straight capilliconidiophore bearing an apical capilliconidium. F. Ascus. Scale bars: A = 5 mm, B = 1 mm, C = 100 μm, D = 50 μm, E–F = 20 μm. Etymology: Named after the host ant species, Camponotus sexguttatus. Specimen examined: Brazil, Reserva Adolpho Ducke, Manaus, Amazonas, on Camponotus sexguttatus (Formicidae: Camponotini), 16 Jan. 2015, J.P.M. Araújo, holotype INPA 274563. Mycelium produced sparsely from joints, not covering the host body, dense when touching the substrate, dark brown. Stroma single, arising from the dorsal pronotum, never branching, averaging 1.8–2 cm in length, 0.2 mm thick, dark brown at the base turning lighter brown towards the apex; fertile part consisting of a single lateral cushion, disc-shaped, chestnut-brown, averaging 1 × 1 mm. Perithecia immersed to partially erumpent, flask-shaped, (205–) 225–230 (–265) × 135 (–180) μm with short neck. Asci 8-spored, hyaline, cylindrical, 150–160 × 8–9 μm; apical cap prominent, 6 × 3 μm. Ascospores hyaline, thin-walled, multiguttulate, cylindrical, 120–140 × 3 μm, 7-septate, straight or curved tapering to the apex. Asexual morph: Hirsutella A-type associated with apical region of stroma; phialides lageniform, 5–8 × 3–4 μm, tapering to a long neck, 8–12 μm; conidia hyaline, limoniform, 5 × 2 μm. Germination process: Ascospores released on agar germinated after 72 h to produce a single, straight capilliconidiophore; 25–30 μm, bearing a terminal capilliconidium, hyaline, smooth-walled, guttulate, 5–9 × 2 μm, narrowing apically. Habitat: Brazilian Central Amazon, rainforest. Infected ants of this ground-dwelling species found biting onto palm-tree leaves, rare. Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822292. Fig. 4, Fig. 5.
Fig. 4

Ophiocordyceps camponoti–renggeri. A.Camponotus renggeri, dead and attached to bryophytes on the base of trees. B. Close-up of the fertile part (ascoma). C. Section through ascoma showing the perithecial arrangement. D. Close-up of perithecium. E. Asci. F. Ascospores. Scale bars: A = 5 mm, B = 1 mm, C = 250 μm, D = 50 μm, E = 70 μm, F = 20 μm.

Fig. 5

Ophiocordyceps camponoti–renggeri (asexual morph). A. Ant biting into the moss carpet with the antennae raised, showing detail of the sporodochia. B. Phialides (hirsutella B-type). Scale bars: A = 1 mm, B = 30 μm.

Ophiocordyceps camponoti–renggeri. A.Camponotus renggeri, dead and attached to bryophytes on the base of trees. B. Close-up of the fertile part (ascoma). C. Section through ascoma showing the perithecial arrangement. D. Close-up of perithecium. E. Asci. F. Ascospores. Scale bars: A = 5 mm, B = 1 mm, C = 250 μm, D = 50 μm, E = 70 μm, F = 20 μm. Ophiocordyceps camponoti–renggeri (asexual morph). A. Ant biting into the moss carpet with the antennae raised, showing detail of the sporodochia. B. Phialides (hirsutella B-type). Scale bars: A = 1 mm, B = 30 μm. Etymology: Named after the host ant species, Camponotus renggeri. Specimen examined: Brazil, Reserva Adolpho Ducke, Manaus, Amazonas, on Camponotus renggeri (Formicinae: Camponotini), 17 Jan. 2015, J.P.M. Araújo, holotype INPA 274564. External mycelium covering most of the host, produced from all orifices and sutures, brown at maturity. Stroma single, rarely branched, produced from dorsal pronotum, averaging 15–20 mm, up to 30 mm, cylindrical, velvety and dark brown, tapering towards the apex; Fertile region (ascoma) of lateral cushions, 1–2, hemispherical to globose, dark-brown to black, variable in size, averaging 1–1.5 × 0.8–1 mm. Perithecia immersed to partially erumpent, flask-shaped, 220–250 × 100–165 μm, with pronounced ostiole. Asci 8-spored, hyaline, cylindrical, (110–)130–145 × 8–10 μm; with prominent cap, 7–8 × 3 μm. Ascospores hyaline, thin walled, vermiform, 90–120 × 4 μm, 5–8-septate, straight to sinuous, round to slightly tapered at apex. Asexual morph: Hirsutella A-type not observed. Hirsutella C-type, produced from brown cushions (sporodochia) on leg and antennal joints; phialides subulate at base, 40–60 × 3–5 μm long, tapering to a long, hyaline neck. Conidia not observed. Germination process: All the ascospores remained unchanged after five days on water-agar plates. Similar non-germination has been reported in O. camponoti-melanotici (Evans ). Habitat: Brazilian Central Amazon, rainforest. Consistently associated with and biting onto moss at the base of upperstorey trees; sometimes buried underneath the moss mat. This ground-nesting ant is closely related to and frequently confused with C. rufipes, but infection behaviour is different with the latter species always found 1.5–2 m above the ground biting into branches and leaves of understorey shrubs (Evans ). Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822293. Fig. 6.
Fig. 6

Ophiocordyceps camponoti–chartificis. A.Camponotus chartifex biting onto a palm leaf. B. Close-up of the ascoma. C. Cross section of the ascoma showing the perithecial arrangement. D. Close-up of the perithecium. E. Ascus with ascospores arranged within. F. Non-germinated ascospore. G. Ascospore with long capilliconidia. H. Hirsutella A-type phialides on the stroma. Scale bars. A = 5 mm, B = 1 mm, C = 200 μm, D = 30 μm, E–F = 5 μm, G–H = 10 μm.

Ophiocordyceps camponoti–chartificis. A.Camponotus chartifex biting onto a palm leaf. B. Close-up of the ascoma. C. Cross section of the ascoma showing the perithecial arrangement. D. Close-up of the perithecium. E. Ascus with ascospores arranged within. F. Non-germinated ascospore. G. Ascospore with long capilliconidia. H. Hirsutella A-type phialides on the stroma. Scale bars. A = 5 mm, B = 1 mm, C = 200 μm, D = 30 μm, E–F = 5 μm, G–H = 10 μm. Etymology: Named after the host ant species, Camponotus chartifex. Specimen examined: Brazil, Reserva Adolpho Ducke, Manaus, Amazonas, on Camponotus chartifex (Formicidae: Camponotini), 2 Feb. 2015, J.P.M. Araújo & H.C. Evans, holotype INPA 274566. Mycelium growing from all inter-segmental membranes, often covering the host body; initially white turning brown. Stroma single, produced from dorsal pronotum, averaging 10 mm, up to 15 mm in length, cylindrical, velvety and ginger brown, becoming cream-pinkish at the apical part; fertile region of lateral cushions, 1–2, hemispherical, chocolate brown, darkening with age, slightly variable in size, averaging 1.5 × 1 mm. Perithecia immersed to partially erumpent, globose-hemispherical shaped, 200–235 × 135–175 μm, with short neck. Asci 8-spored, hyaline, cylindrical to clavate, 100–125 × 6 μm; with prominent cap, 6–7 × 3–4 μm. Ascospores hyaline, thin-walled, vermiform 75–85 × 5 μm, 9–13-septate, sinuous to curved, never straight at maturity; rounded to acute apex. Asexual morph: Hirsutella A-type associated with apical region of stromata; phialides lageniform, 5–6 × 3 μm, tapering to a robust neck, 4–8 μm in length; conidia fusiform to limoniform, averaging 7 × 2.6 μm. Germination process: The released ascospores germinated within 24 h to produce a single, long and extremely narrow hair-like capilliconidiophore; variable in length (65–)75–90(–95) μm; bearing a single terminal capilliconidium, hyaline, smooth-walled, uni- or biguttulate, fusoid, narrowing apically. Habitat: Brazilian Central Amazon, rainforest. Biting exclusively on palm-tree parts, especially the spines and leaves. This species was relatively rare and the host is an arboreal species which weaves primitive carton nests in the canopy; found 1–1.5 m above the ground. Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822294. Fig. 7, Fig. 8.
Fig. 7

Ophiocordyceps camponoti–nidulantis (sexual morph). A.Camponotus nidulans infected and biting into a leaf (with fly larvae on the stroma). B. Close-up of the ascoma. C. Section through ascoma showing the perithecial arrangement. D. Close-up of perithecium. E. Asci. F. Ascospore with capilliconidium. Scale bars: A = 3 mm, B = 1 mm, C = 200 μm, D = 75 μm, E=F = 20 μm.

Fig. 8

Ophiocordyceps camponoti–nidulantis (asexual morph). A. Leg joints with hirsutella-like phialides. B. Close-up of leg phialides. C. Close-up of antenna covered with Hirsutella phialides. D. Antenna covered with phialides. E. Typical antennal display exhibited by the ant after being killed by O. camponoti-nidulantis, exposing the Hirsutella hymenium. Scale bars: A = 1 mm, B = 40 μm, C = 100 μm, D = 0.5 mm, E = 0.5 mm.

Ophiocordyceps camponoti–nidulantis (sexual morph). A.Camponotus nidulans infected and biting into a leaf (with fly larvae on the stroma). B. Close-up of the ascoma. C. Section through ascoma showing the perithecial arrangement. D. Close-up of perithecium. E. Asci. F. Ascospore with capilliconidium. Scale bars: A = 3 mm, B = 1 mm, C = 200 μm, D = 75 μm, E=F = 20 μm. Ophiocordyceps camponoti–nidulantis (asexual morph). A. Leg joints with hirsutella-like phialides. B. Close-up of leg phialides. C. Close-up of antenna covered with Hirsutella phialides. D. Antenna covered with phialides. E. Typical antennal display exhibited by the ant after being killed by O. camponoti-nidulantis, exposing the Hirsutella hymenium. Scale bars: A = 1 mm, B = 40 μm, C = 100 μm, D = 0.5 mm, E = 0.5 mm. Etymology: Named after the host ant species, Camponotus nidulans. Specimen examined: Brazil, Reserva Adolpho Ducke, Manaus, Amazonas, on Camponotus nidulans (Formicinae: Camponotini), 20 Jan. 2015, J.P.M. Araújo, holotype INPA 274568. External mycelium produced from all orifices and sutures; initially white, becoming ginger brown, covering the host body, notably the abdominal part. Stroma single, produced from dorsal pronotum, 10–15 × 0.2 mm, cylindrical, black, covered with ginger velvety hyphae fading away towards the apex; fertile region of lateral cushions, 1–2, disc-shaped to hemispherical, light brown, darkening with age, averaging 1.5 × 1 mm. Perithecia immersed to partially erumpent, flask-shaped, (170–)200–240 × 100–150(–180) μm, with short, exposed neck or ostiole. Asci 8-spored, hyaline, thin-walled, vermiform to clavate, 110–145 × 6–8 μm; cap prominent, 4 × 6 μm; Ascospores hyaline, thin-walled, vermiform, 90–105(–115) × 3–4 μm, 5-septate, gently curved, rarely straight; tapering to a round apex. Asexual morph: Hirsutella A-type associated with the apical part of stroma. Hirsutella C-type, produced from light brown cushions on leg and antennal joints; phialides subulate, robust, 70–120 × 4–6(–8) μm. Conidia limoniform, averaging 8 × 3 μm. Germination process: Ascospores germinating after 24–72 h to produce 1–3, uniformly straight, extremely narrow hair-like capilliconidiophores, 50–60 μm; bearing a single terminal capilliconidium, hyaline, smooth-walled, biguttulate, clavate, 9 × 2 μm, narrowing apically. Habitat: Brazilian Central Amazon, rainforest. Biting sapling leaves and petioles, always at lower heights, 20–30 cm above the ground; forming local epizootics or aggregations of up to 20–30 individuals in about 10 m2. Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822295. Fig. 9.
Fig. 9

Ophiocordyceps camponoti–femorati. A.Camponotus femoratus biting a palm leaf. B. Close-up of the ascoma. C. Cross section showing the perithecial arrangement. D. Ascospore with capilliconidia E. Hirsutella A-type phialide on the stroma. Scale bars: A = 1 mm, B = 0.3 mm, C = 200 μm, D = 20 μm, E = 5 μm.

Ophiocordyceps camponoti–femorati. A.Camponotus femoratus biting a palm leaf. B. Close-up of the ascoma. C. Cross section showing the perithecial arrangement. D. Ascospore with capilliconidia E. Hirsutella A-type phialide on the stroma. Scale bars: A = 1 mm, B = 0.3 mm, C = 200 μm, D = 20 μm, E = 5 μm. Etymology: Named after the host ant species, Camponotus femoratus. Specimen examined: Brazil, Reserva Adolpho Ducke, Manaus, Amazonas, on Camponotus femoratus (Formicidae: Camponotini), 22 Jan. 2015, J.P.M. Araújo, holotype INPA 274570. External mycelium produced from all the orifices and sutures; initially white, becoming ginger brown, covering the host body with sparse hyphae. Stroma single, produced from dorsal pronotum, averaging 3.5 × 0.25, up to 6 mm in length, cylindrical to laterally compressed, ginger to dark-brown; fertile part terminal of lateral cushions, 1–3, disc-shaped to hemispherical, chestnut-brown, darkening with age, 1.2–2.2 × 0.8–1.4 mm. Perithecia immersed to partially erumpent, flask-shaped, 200–230(–250) × 135–165 μm, with short, exposed neck or ostiole. Asci 8-spored, hyaline, cylindrical to clavate, 110–130 × 8–9 μm; cap prominent, 6 × 3 μm; Ascospores hyaline, sinuous to curved, rarely straight, 75–90 × 3 μm, 5-septate; apex round to acute. Asexual morph: Hirsutella A-type only; produced laterally on upper stroma; phialides rare, cylindrical to lageniform, 7–10 × 3–4 μm, tapering to a long neck, 10–15 μm; conidia limoniform, averaging 7–9 × 3 μm. Germination process: Ascospores germinated in 24–48 h to produce a single, narrow capilliconidiophore, 35–40 μm long; bearing a single capilliconidium, hyaline, smooth-walled, uni–to biguttulate, clavate, 9 × 3 μm, narrowing apically. Habitat: Brazilian Central Amazon, rainforest. Often associated with palm-trees, commonly on spines towards the tip, where droplets of dew collect. Abundant species, forming epizootics. The ant C. femoratus is an arboreal species involved in an unusual mutualism (parabiosis) with other ants in which it constructs carton nests embedded with epiphytes that it “gardens” (Vantaux ). This suggests that infected ants move away from their arboreal nests among the epiphytes on upperstorey trees and die biting onto palm vegetation. Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822296. Fig. 10.
Fig. 10

Ophiocordyceps camponoti-hippocrepidis. A. Minute Camponotus hippocrepis (ca. 1.5 mm) biting onto a palm spine. B. Close-up of the ascoma. C. Cross-section of the ascoma showing the perithecial arrangement. D. Ascospore with capilliconidiophore with verrucose apical portion. E. Ascus. F. Ascospores just after being released . Scale bars: A = 1 mm, B = 0.5 mm, C = 100 μm, D–E = 20 μm, F = 20 μm.

Ophiocordyceps camponoti-hippocrepidis. A. Minute Camponotus hippocrepis (ca. 1.5 mm) biting onto a palm spine. B. Close-up of the ascoma. C. Cross-section of the ascoma showing the perithecial arrangement. D. Ascospore with capilliconidiophore with verrucose apical portion. E. Ascus. F. Ascospores just after being released . Scale bars: A = 1 mm, B = 0.5 mm, C = 100 μm, D–E = 20 μm, F = 20 μm. Etymology: Named after the host ant species, Camponotus hippocrepidis. Specimen examined: Brazil, Reserva Adolpho Ducke, Manaus, Amazonas, on Camponotus (Myrmorhachis) hippocrepidis (Formicidae: Camponotini), 22 Jan. 2015, J.P.M. Araújo, holotype INPA 274572. External mycelium produced from all the orifices and sutures; initially white, becoming ginger brown, covering the host body with sparse hyphae. Stroma single, produced from dorsal pronotum, 5–7 × 0.15 mm, cylindrical ginger to dark-brown, characteristically swollen terminal part, clavate; ascomatal plate consistently produced at the middle part of stroma, laterally attached, circular, chestnut brown, darkening with age, averaging 2–2.5 × 0.25–0.45 mm; Perithecia immersed to partially erumpent, flask-shaped, averaging 225–250 × 135–165 μm, with short, exposed neck or ostiole. Asci 8-spored, cylindrical to clavate, 115–135 × 7–10 μm, cap prominent, 6–7 × 4 μm; Ascospores hyaline, cylindrical, robust, straight to gently curved, 75–85 × 4–5 μm, 5-septate, tapering to a round or slightly acute apex. Asexual morph: Hirsutella A-type only; produced on the clavate part of upper stroma; phialides cylindrical to lageniform, 8–9 × 4 μm, tapering to a long neck 9–10 μm in length; conidia limoniform, averaging 5 × 2 μm. Germination process: Ascospores germinated within 24–48 h to produce a straight, robust capilliconidiophore, verrucose near the apex, 45–50 μm long; bearing a single capilliconidium, hyaline, smooth-walled, guttulate, 10–11 × 4 μm, truncate at base, narrowing apically. Habitat: Brazilian Central Amazon, rainforest. Predominantly associated with spiny palms. Found often at the tip of spines, where drops of dew accumulate and surround the whole ant. Abundant species, 10–20 infected ants commonly found on a single palm tree. Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822297. Fig. 11.
Fig. 11

Ophiocordyceps albacongiuae. A.Camponotus sp. with two fruiting bodies emerging from its dorsal pronotum and petiole. B. Sterile synnema with its hairy surface. C. Cross-section of the ascoma. D. Ascus. E. Ascospore. F. Close-up of the perithecium. Scale bars: A = 0.2 mm, B = 100 μm, C = 200 μm, D = 20 μm, E = 10 μm, F = 30 μm.

Ophiocordyceps albacongiuae. A.Camponotus sp. with two fruiting bodies emerging from its dorsal pronotum and petiole. B. Sterile synnema with its hairy surface. C. Cross-section of the ascoma. D. Ascus. E. Ascospore. F. Close-up of the perithecium. Scale bars: A = 0.2 mm, B = 100 μm, C = 200 μm, D = 20 μm, E = 10 μm, F = 30 μm. Etymology: Named after Alba Congiu, wife of David Hughes, who has contributed so much to our understanding of Ophiocordyceps by facilitating the extensive travels of the senior author (Hughes) in SE Asia, Australia and South America in search of behaviourally-manipulated ants. Specimen examined: Colombia, Rio Claro, Reserva Nacional Canyon Rio Claro, Antioquia, on Camponotus sp., 14 Nov. 2014, J.P.M. Araújo & T.I. Sanjuán, holotype HUA 186117. External mycelium scarce, producing one or two stromata, never branching, dark brown, basal part velvety, tapering towards the apex; producing single ascoma laterally attached, disc-shaped, dark brown; Perithecia semi-immersed, flask-shaped, 240–290 × 105–135 μm, with prominent, exposed neck or ostiole. Asci 8-spored, cylindrical to clavate, 130–160 × 8–11 μm. Ascospore hyaline, cylindrical, slightly curved in “S”, 80–100 × 5 μm, 5–6-septate, tapering towards the apex. Asexual morph: No phialides or conidia observed. Germination process: No ascospores naturally released from dried herbarium material. Habitat: In tropical lowland forest along Rio Claro. Typically found biting on epiphytes on tree trunks at elevated positions, ranging from 0.5 m up to 2 m in height. Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822299. Fig. 12.
Fig. 12

Ophiocordyceps camponoti–floridani. A.Camponotus floridanus infected, biting into a plant. B. Close-up of the disc-shape ascoma attached to the stroma. C. Cross-section of the ascoma. D. Ascus. E. Ascospore. F–G.Hirsutella phialides. H–I. Limoniform conidia. Scale bars: A = 2 mm, B = 1 mm, C = 100 μm, D–F = 10 μm, G–I = 5 μm.

Ophiocordyceps camponoti–floridani. A.Camponotus floridanus infected, biting into a plant. B. Close-up of the disc-shape ascoma attached to the stroma. C. Cross-section of the ascoma. D. Ascus. E. Ascospore. F–G.Hirsutella phialides. H–I. Limoniform conidia. Scale bars: A = 2 mm, B = 1 mm, C = 100 μm, D–F = 10 μm, G–I = 5 μm. Etymology: Named after the host ant species, Camponotus floridanus. Specimen examined: USA, Broward County, Florida, on Camponotus floridanus (Formicidae: Camponotini), 15 Nov. 2015, Colbie Reed, holotype INPA 274575. Abundant external mycelium produced from the sutures and joints. Stroma single, never branching, ginger to light brown, basal part velvety, apical part cream; fertile part laterally attached, disc-shaped, chocolate brown; Perithecia immersed to partially erumpent, flask-shaped, (253–)265 (–300) × 100(–125) μm, with short, exposed neck or ostiole. Asci 8-spored, cylindrical to clavate, 145 × 9–10 μm; Ascospore hyaline, cylindrical, straight, 75–90 × 4–5 μm, 5-septate, tapering towards the apices. Asexual morph: Hirsutella A-type present along the stroma. Phialides smooth, cylindrical to lageniform, averaging 8–9 × 3–4 μm, tapering to a long neck 8–12 μm in length. Conidia limoniform, biguttulate, 8–9 × 3 μm. Germination process: No ascospores released from dried herbarium material. Habitat. Florida (USA), lowland forests. A ground-dwelling ant, found biting leaves, predominantly palms. Dying in elevated position, ranging from 0.5 m up to 1.5 m in height. Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822300 Fig. 13.
Fig. 13

Ophiocordyceps kimflemingiae. A.Camponotus castaneus biting a twig. B. Close-up of the stroma showing two ascomatal plates attached on it. C. Ascoma section and Perithecia arranged on its surface. D. Perithecium. E. Cluster of ascospores. F–G. Ascus. H. Ascospore. I. Ascospore after 2–5 d on agar, exhibiting a swollen section and two capilliconidiophores. Scale bars: A = 2 mm, B = 0.5 mm, C = 300 μm, D = 100 μm, E–F = 20 μm, G = 10 μm, H = 20 μm, I = 40 μm.

Ophiocordyceps kimflemingiae. A.Camponotus castaneus biting a twig. B. Close-up of the stroma showing two ascomatal plates attached on it. C. Ascoma section and Perithecia arranged on its surface. D. Perithecium. E. Cluster of ascospores. F–G. Ascus. H. Ascospore. I. Ascospore after 2–5 d on agar, exhibiting a swollen section and two capilliconidiophores. Scale bars: A = 2 mm, B = 0.5 mm, C = 300 μm, D = 100 μm, E–F = 20 μm, G = 10 μm, H = 20 μm, I = 40 μm. Etymology: Named after Kim Fleming, a naturalist, who has made a significant contribution to the studies between this fungus and Camponotus species in the USA. An image posted by Kim Fleming on the photosharing site Flickr (https://www.flickr.com/) alerted Hughes to the widespread occurrence of this system in temperate woods in South Carolina. Kim has subsequently taken thousands of images and recordings of the phenology of Ophiocordyceps in South Carolina. Material examined: USA, Donalds County, South Carolina, on Camponotus castaneus (Formicinae: Camponotini), 15 Aug. 2014, J.P.M. Araújo & K. Fleming, holotype INPA 274577. External mycelium produced mostly on the ventral part of the host and head. Sparse mycelium produced on joints. Stroma single, rarely branched, produced from dorsal pronotum, 11–17 × 0.3–0.45 mm, cylindrical, ginger to light brown, basal part velvety, apical part cream to purple; fertile part laterally attached, disc-shaped, dark-brown to black, averaging 1.5–2 × 1.3 mm; Perithecia immersed to partially erumpent, flask-shaped, 250–275 × (100–)120–160 μm, with short, exposed neck or ostiole. Asci 8-spored, cylindrical to clavate, (100–)120–150 × 10–11 μm, cap prominent; Ascospore hyaline, cylindrical, straight, 80–90 × 5 μm, 5–6-septate, tapering towards the apices; Asexual morph: Hirsutella A-type present on the stroma, Hirsutella C-type occurring exclusively at early stages of development, produced from leg joints and dorsal pronotum. Germination process: Ascospores germinating from the first 24 h up to the 5th day. Germination occurred in two different manners: capilliconidiophores or germination into vegetative hyphae, separately or both on the same ascospores. Capilliconidiophores 1–3, 80–100 μm long, with a terminal capilliconidium, 10–13 × 2–3 μm. Habitat: South Carolina (USA), temperate deciduous forest. Found biting underside of twigs, never leaves. Dying in elevated position, ranging from 0.5 m up to 1.5 m in height; forming patches, or graveyards, of infected ants where the species is found. Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822301. Fig. 14.
Fig. 14

Ophiocordyceps blakebarnesii. A.Camponotus cf. chromaoides with the stroma arising from the dorsal pronotum. B. Close-up showing the biting behaviour inside the log. C. Stroma. D. Cross-section of the ascoma. E. Ascus. F–G. Ascospores. H–K. Phialides. L. Multi guttulate conidia. Scale bars: A = 2 mm, B = 0.5 mm, C = 0.3 mm, D = 200 μm, E–G = 5 μm, H–K = 10 μm, L = 5 μm.

Ophiocordyceps blakebarnesii. A.Camponotus cf. chromaoides with the stroma arising from the dorsal pronotum. B. Close-up showing the biting behaviour inside the log. C. Stroma. D. Cross-section of the ascoma. E. Ascus. F–G. Ascospores. H–K. Phialides. L. Multi guttulate conidia. Scale bars: A = 2 mm, B = 0.5 mm, C = 0.3 mm, D = 200 μm, E–G = 5 μm, H–K = 10 μm, L = 5 μm. Etymology: Named after the collector, Blake Barnes, a medical doctor and citizen scientist who discovered this species and made important observations on its ecology. Specimen examined: USA, North of the Indian Hills Park, Missouri, on Camponotus cf. chromaiodes (Formicinae, Camponotini), 15 Nov. 2015, Blake Barnes, holotype INPA 274581. Abundant external mycelium produced from the sutures and joints. Stroma single, sinuous, never branching, dark brown, apical part lighter and velvety; fertile part laterally attached, disc-shaped to irregular, black, averaging 1.5 × 1 mm; Perithecia immersed to slightly erumpent, elongated, flask-shaped, 300-320(–350) × 105–120 μm, with short, exposed neck or ostiole. Asci 8-spored, cylindrical to clavate, 220–250 × 12–14 μm. Ascospore hyaline, cylindrical, straight, 140–160 × 4 μm, 6–7- septate, tapering towards the apices. Asexual morph: Hirsutella A-type present along the stroma. Phialides smooth, cylindrical to lageniform, 75(–90) × 3-4 μm, tapering to a very long neck. Conidia limoniform, multi guttulate, 8–9 × 3 μm. Germination process: No germination observed because the specimens studied were dried previously. Habitat: Missouri (USA), temperate forest. Found biting inside logs. The log-biting behaviour is highly unusual and is also found in samples from Michigan Herbaria. The host ant, Camponotus cf. chromaiodes, nests in wood and the position of the ant inside logs suggests that manipulation involves nest desertion and dying in logs where spores are distributed. Although evidence is still lacking, we suggest log-biting as an adaptation to very low temperatures and exposure on twigs (which occurs in the southern species O. kimflemingiae). Araújo, R. Shivas, S. Abell, T. Marney, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822302. Fig. 15, Fig. 16.
Fig. 15

Ophiocordyceps naomipierceae (sexual morph). A.Polyrhachis sp. biting the edge of a leaf. B. Close-up of the orange ascoma. C. Cross-section of the ascoma. D. Perithecium. E. Ascus. F. Ascospore. Scale bars: A = 0.5 mm, B = 1 mm, C = 100 μm, D = 50 μm, E–F = 20 μm.

Fig. 16

Ophiocordyceps naomipierceae (asexual morph). A.Polyrhachis sp. with stromata arising from leg joints and dorsal pronotum. B. Synnema. C. Close-up of synnema. D. Close-up phialides E. Phialides. F. Close-up synnema showing apical phialides. G. Individual long phialide with multiple verrucose necks. Scale bars: A = 0.5 mm, B = 100 μm, C = 20 μm, D = 15 μm, E–G = 10 μm.

Ophiocordyceps naomipierceae (sexual morph). A.Polyrhachis sp. biting the edge of a leaf. B. Close-up of the orange ascoma. C. Cross-section of the ascoma. D. Perithecium. E. Ascus. F. Ascospore. Scale bars: A = 0.5 mm, B = 1 mm, C = 100 μm, D = 50 μm, E–F = 20 μm. Ophiocordyceps naomipierceae (asexual morph). A.Polyrhachis sp. with stromata arising from leg joints and dorsal pronotum. B. Synnema. C. Close-up of synnema. D. Close-up phialides E. Phialides. F. Close-up synnema showing apical phialides. G. Individual long phialide with multiple verrucose necks. Scale bars: A = 0.5 mm, B = 100 μm, C = 20 μm, D = 15 μm, E–G = 10 μm. Etymology: Named after Naomi Pierce, Evolutionary Biologist at Harvard University who has mentored Hughes and many other biologists to consider ant-symbiont interactions in the deep time framework provided by phylogenetic studies. Specimen examined: Australia, Kuranda, Queensland, on Polyrhachis sp., 22 May 2010, R. Shivas, T. Marney & S. Abell, holotype BRIP 53385. External mycelium produced mostly on the ventral part of the host, also present on joints. Stromata ginger to light-brown, commonly clavate, produced always from dorsal pronotum, frequently on leg joints, 1.5–2.25 × 0.45–0.75 mm, branching into nodules formed along the stromata, 120–150 × 35–50 μm, phialides very abundant along the whole stromata; Fertile part single, attached laterally, hemispheric to irregular shape, orange, averaging 0.75 × 0.5–0.65 mm. Perithecia immersed, flask-shaped, 260–320 × (–130)150–200 μm, with prominent neck. Asci 8-spored, hyaline, vermiform, cylindrical, 150–180 × 7 μm. Ascospore hyaline, straight to gently curved, vermiform, 75–105 × 5–6 μm, 4–6-septate; tapering at apex. Asexual morph: Paraisaria-like phialides produced profusely along the whole stromata; phialides abundant, cylindrical to clavate, 15–35 × 3 μm, producing up to 10 needle-like, verrucose conidiophores, averaging 10 μm, bearing a terminal conidium, 5–7 × 3 μm. Germination process: No germination could be observed since the material examined was dried. Habitat: Tropical Australia, rainforest. Found biting leaves at elevated positions on understorey shrub in coastal forest; very common, associated with epizootics. Araújo, H.C. Evans & D.P. Hughes, sp. nov. MycoBank MB822303. Fig. 17.
Fig. 17

Ophiocordyceps ootakii. A.Polyrhachis moesta biting on a leaf edge. B. Close-up showing two ascomatal plates attached to the stroma. C. Cross-section of ascoma. D. Ascus. E. Ascospore. F. Hirsutella A-type phialides on stroma. Scale bars: A–B = 1 mm, C = 250 μm, D–E = 20 μm, F = 10 μm.

Ophiocordyceps ootakii. A.Polyrhachis moesta biting on a leaf edge. B. Close-up showing two ascomatal plates attached to the stroma. C. Cross-section of ascoma. D. Ascus. E. Ascospore. F. Hirsutella A-type phialides on stroma. Scale bars: A–B = 1 mm, C = 250 μm, D–E = 20 μm, F = 10 μm. Etymology: Named after Shigeo Ootaki, an artist and amateur mycologist who has contributed significantly to the study of entomopathogenic fungi in Japan. Specimen examined: Japan, Matsuoyama (Mt. Matsuo), Kyoto, on Polyrhachis moesta (Formicinae, Camponotini), 20 Jul. 2014, R.G. Loreto & S. Ootaki, holotype INPA 274587. External mycelium produced from orifices and sutures; initially white, becoming light-brown with age. Stroma single or branched, produced from dorsal pronotum, averaging 6.5 × 0.3 mm, cylindrical, greyish to light brown; Fertile part produced laterally on the stroma, 1–3, disc-shaped, dark–brown, averaging 1.1 × 0.8 mm. Perithecia immersed to partially erumpent, flask-shaped, 230–260 × 120–150 μm, with short neck. Asci 8-spored, hyaline, cylindrical to clavate, 130–180 × 8–9 μm. Ascospore hyaline, vermiform, straight to gently curved, 85–100 × 3 μm, 5-septate, tapering at both ends. Asexual morph: Hirsutella type-A only. Phialides cylindrical to lageniform, 6–8 × 3–4 μm, tapering to a long neck, 9–10 μm long, bearing a terminal conidium, averaging 5x3 μm. Germination process: No germination could be observed since the material examined was dried. Habitat: Japan, temperate forest. Biting evergreen plants only in a deciduous forest where leaf fall occurs. This behaviour suggests that the ants are manipulated to choose leaves that remain on the trees. Araújo, H.C. Evans & D.P. Hughes, nom. nov. et stat. nov. MycoBank: MB822304. Basionym: Ophiocordyceps unilateralis var. clavata Kobayasi, Bull. Biogeogr. Soc. Japan: 272 (1939). Etymology: Name after Takuya Sato, a Japanese biologist working on behaviour manipulation by parasites who helped enormously in the collection of specimens for this study. Specimens examined: Japan, Honsyu, Province of Kazusa, Kimitu-gun, Tanjinyama-mura, Myôken-zan, on Polyrhachis lamellidens (Formicinae, Camponotini), 20 Jul. 2014, R.G. Loreto & T. Sato, INPA 274589. External mycelium scarce, produced mostly on ventral part of the host and mouth. Stromata produced from pronotum, dorsal– and laterally on both sides, clavate, 5–7.5 × 0.35–0.45 (–0.8) mm, never branching. Fertile part produced laterally on one or multiple stromata, 1–6, commonly 2 per stroma, averaging 1 × 0.8 mm, up to 2.5 mm in length. Perithecia immersed to partially erumpent, flask-shaped, 230–270 × 120–160 μm, with short, exposed neck. Asci 8-spored, cylindrical to clavate, 120–160 × 8–10 μm. Ascospores hyaline, cylindrical, straight, rarely curved, 85–100 × 4 μm, 5-septate, apex rounded, tapering at base. Asexual morph: Hirsutella type-A only. Phialides cylindrical to lageniform, averaging 12 × 7 μm, tapering to a long neck. No conidia observed. Germination process: Ascospores germinating in 24 h to produce 1–3 hair-like capilliconidiophores, 40–50 μm long, bearing a terminal, hemispheric capilliconidium, averaging 13 × 3 μm. Some ascospores germinating directly into germ tubes and vegetative hyphae. Habitat: Japan, temperate forest. A ground-dwelling ant species found consistently biting onto twigs in a deciduous forest where leaf fall occurs.

Discussion

Our results support the hypothesis that species of fungi in the Ophiocordyceps unilateralis complex are highly specific to each ant species in the tribe Camponotini. This work significantly expands our understanding of insect pathogenic fungi and can serve as a test case against which other investigations into fungal diversity, systematics and evolution can be compared. It remains to be seen if the very high specificity we found between Ophiocordyceps/ant associations is mirrored in species of fungi infecting other insect groups. In the next sections, we discuss some aspects of these fungi in more detail.

Morphology

The species within the O. unilateralis clade share many macro-morphological characteristics that make them easily recognized in the field. Morphologically unique features include the typical single stroma arising from dorsal pronotum with at least one ascoma growing, unilaterally, from the stroma. Although there are exceptions. For example, O. satoi from Japan that usually produces three clavate stromata, with up to six ascomata attached to it (Fig. 18). Other species such as O. camponoti-indiani (North Brazilian Amazon), O. halabalaensis, O. rami (Thailand) and O. naomipierceae (Australia) are similar to O. satoi regarding the production of multiple stalks (Luangsa-ard et al., 2011, Araújo et al., 2015). Moreover, this trait cannot be considered as a synapomorphic feature since those species are scattered along the O. unilateralis clade. Many samples of O. albacongiuae were collected exhibiting one stroma arising from the dorsal pronotum and another from the petiole (Fig. 11). All the other species within the O. unilateralis clade often produce a single stroma with the Hirsutella type-A asexual morph, with only rare occasional exceptions at the specimen level.
Fig. 18

Ophiocordyceps satoi. A.Polyrhachis lamellidens. with three stromata arising from its body. B. Close-up stroma with two ascomatal cushions. C. Cross-section of the ascoma, showing the perithecial arrangement. D. Close-up perithecium. E. Ascus. F. Ascospore germinating on agar plate after 3–5 d. G. Capilliconidium. H. Ascospore with two capilliconidiophores bearing one capilliconidium at their apices. Scale bars: A = 1 mm, B = 0.5 mm, C = 100 μm, D = 40 μm, E–F = 20 μm, G = 2 μm, H = 20 μm.

Ophiocordyceps satoi. A.Polyrhachis lamellidens. with three stromata arising from its body. B. Close-up stroma with two ascomatal cushions. C. Cross-section of the ascoma, showing the perithecial arrangement. D. Close-up perithecium. E. Ascus. F. Ascospore germinating on agar plate after 3–5 d. G. Capilliconidium. H. Ascospore with two capilliconidiophores bearing one capilliconidium at their apices. Scale bars: A = 1 mm, B = 0.5 mm, C = 100 μm, D = 40 μm, E–F = 20 μm, G = 2 μm, H = 20 μm. Furthermore, each species within the O. unilateralis clade exhibits unique micro-morphological traits. The most significant microscopic character used to split the species within this complex is the morphology of the ascospore, which includes septation, size, shape and germination process (Table 1). Other aspects such as the location where the host is attached (e.g. leaf edge, leaf middle-vein, palm spine, trunk, epiphyte), and morphology of the asexual morphs, are also valuable characters that may be used as information when distinguishing species but are less important than ascospore morphology and, of course, molecular data. Ophiocordyceps oecophyllae and O. daceti were found producing only the asexual morph. O. oecophyllae produces the phialides directly on the host, especially from joints, while O. daceti produces a single synnema from the dorsal pronotum covered with a hymenium of verrucose hirsutella-like phialides. Both species, although lacking the sexual morph, are easily recognized as new taxa based on host association, phialide morphology and habit, which were further confirmed by the molecular data (Fig. 19). Based on morphological and ecological data, our results suggest that O. oecophyllae is a sole early divergent lineage of the O. unilateralis core clade. This means that a common ancestral form, most likely infecting ants, diversified into the hyper-diverse O. unilateralis core clade. The discovery of O. oecophyllae should help us to trace the origin of the O. unilateralis clade and to test evolutionary hypotheses regarding the factors (e.g. morphological adaptations and host association) that led them to be one of the most diverse groups of entomopathogenic fungi. However, to test this hypothesis, and to confidently propose O. oecophyllae as an early diverging lineage of the O. unilateralis core clade, we need a broader gene sampling for this species, in order to have a strong support from the morphology, ecology and molecular data.
Fig. 19

Maximum Likelihood tree of Ophiocordyceps obtained with a combined dataset of SSU, LSU, tef, RPB1 and RPB2 based on Bayesian/RAxML analysis with only >0.95/70 shown. Species proposed in this study are highlighted. Ant figures correspond to the ant genera infected by each clade within hirsutelloid Ophiocordyceps. At the top right a round phylogeny showing the whole analyses with the entire dataset used in this study, which included Cordycipitaceae, Clavicipitaceae and Ophiocordycipitaceae species, with Ophiocordyceps highlighted. (ant images from www.AntWeb.org and the photographers: Oecophylla, Camponotus, Dolichoderus, Cephalotes, Paraponera and Daceton: April Nobile, Polyrhachis: Will Ericson.

Maximum Likelihood tree of Ophiocordyceps obtained with a combined dataset of SSU, LSU, tef, RPB1 and RPB2 based on Bayesian/RAxML analysis with only >0.95/70 shown. Species proposed in this study are highlighted. Ant figures correspond to the ant genera infected by each clade within hirsutelloid Ophiocordyceps. At the top right a round phylogeny showing the whole analyses with the entire dataset used in this study, which included Cordycipitaceae, Clavicipitaceae and Ophiocordycipitaceae species, with Ophiocordyceps highlighted. (ant images from www.AntWeb.org and the photographers: Oecophylla, Camponotus, Dolichoderus, Cephalotes, Paraponera and Daceton: April Nobile, Polyrhachis: Will Ericson. Species of fungi within the O. kniphofioides clade share several morphological and ecological characters. All species within this clade are exclusively pathogens of Neotropical ants (i.e. Cephalotes atratus, Paraponera clavata, Dolichoderus bispinosus and Daceton armigerum) (Fig. 19). The sexual morph produces vermiform, multi-septate ascospores that do not germinate into secondary structures (e.g. capilliconidiophores) or into hyphae, despite multiple attempts. The failure of germination might indicate the need of biotic factors, possibly being triggered by contact with the host. Furthermore, the most evident morphological feature shared by all species in this clade is the Hirsutella stilbelliformis asexual morph, with its unique long verrucose phialides united into synnemata (Fig. 20). Typically, these arise from rhizoid-like outgrowths, formed on the substrate (tree bark) rather than directly on the host. This behaviour could be analogous to the “minefields” created by the germinating ascospores of O. unilateralis s.l., which produce sticky capilliconidia after landing on surrounding substrata (Araújo & Hughes 2017).
Fig. 20

Comparison of the phialide morphology for the species within the O. kniphofioides clade (A-phialides and conidia). A.O. kniphofioides sensu stricto. B.O. monacidis. C.O. ponerinarumD.O. kniphofioides var. gnamptogenyos. E.O. daceti sp. nov. (A–D. Evans & Samson 1984; E. This study). Scale bar = 10 μm.

Comparison of the phialide morphology for the species within the O. kniphofioides clade (A-phialides and conidia). A.O. kniphofioides sensu stricto. B.O. monacidis. C.O. ponerinarumD.O. kniphofioides var. gnamptogenyos. E.O. daceti sp. nov. (A–D. Evans & Samson 1984; E. This study). Scale bar = 10 μm. Although the topological relationship between O. unilateralis core clade and O. kniphofioides sub-clade corroborates the findings of Sanjuan , the bootstrap value was low (BP = 47 %). With the inclusion of O. monacidis and O. daceti in the analysis, O. tiputini infecting the larval stage of Megaloptera, was supported (BP = 71 %) as a sister group of the O. unilateralis core clade + O. oecophyllae + O. kniphofioides sub-clade, rather than a member of O. kniphofioides sub-clade as presented by Sanjuán . This novel result allows us to consider the monophyly of O. unilateralis core clade + O. oecophyllae + O. kniphofioides sub-clade, forming a strictly ant-pathogenic clade within Ophiocordyceps. However, this is still a working hypothesis and further more inclusive studies are needed. Thus, we currently refer to the O. kniphofioides sub-clade as the clade formed by the species: O. monacidis comb. nov. et stat. nov., O. kniphofioides s. s., O. ponerinarum, O. daceti sp. nov. and O. tiputini as incertae sedis regarding its position within the O. unilateralis clade.

Ascospores

All species belonging to the O. unilateralis and O. kniphofioides clades produce ascospores that do not disarticulate into part-spores. No species within the O. kniphofioides sub-clade has ascospores that germinate in vitro, to produce either capilliconidiophores or hyphae. Conversely, production of capilliconidiophore has been shown to be a common behaviour within the O. unilateralis core clade species (Evans et al., 2011, Araújo et al., 2015, Table 1). Unfortunately, we could not determine the germination process of some species because the specimens collected did not release spores on agar or because the samples sent by collaborators were dried (i.e. O. naomipierceae, O. camponoti-floridani, O. blakebarnesii, O. ootakii, O. albacongiuae). In addition, the description of species from Thailand does not include any information regarding ascospore behaviour, although it is probable that they also produce capilliconidiophores. Ophiocordyceps camponoti-indiani produces ascospores measuring 75 × 5 μm exhibiting up to three capilliconidiophores that are up to 130 μm in length, which is the longest described for the O. unilateralis group so far (Araújo ). Interestingly, Camponotus indianus is significantly bigger than other Amazonian Camponotus species infected by this group of pathogens. This could be posited to be a result of local adaptation between host and pathogen where fungal morphology matches the ant morphology/ecology in order to reach, infect and transmit the disease within that species. Future studies will test the hypothesis between capilliconidia size/shape and the ant morphology/ecology. Ascospores of O. camponoti-balzani and O. camponoti-melanotici produce either a small appressorial-like structure or a single short phialide respectively, even after an extended period of incubation on agar (Evans ). O. camponoti-sexguttati produces a large ascospore measuring 120–140 μm in length, but only small single 25–30 μm long capilliconidiophores, consistently formed in the first third of its length. O. camponoti-hippocrepidis and O. camponoti-bispinosi are very similar in size and shape, but the capilliconidiophore of O. camponoti-bispinosi is slightly bigger and smooth, in contrast with the terminal, verrucose capilliconidiophore produced by O. camponoti-hippocrepidis (Fig. 10). Only O. satoi and O. kimflemingiae germinated to form hyphae on agar; found in Japan and South Carolina (USA) respectively, both temperate forest locations. Another particular feature observed in both species was the swelling of the ascospores following germination. These traits might be related to adaptations to temperate forests since we never observed such behaviour in the ascospores of any of the tropical species.

Asexual morphs

Ophiocordyceps unilateralis core clade

There are many kinds of asexual spores or conidia produced by entomopathogenic species, from dry to mucilaginous, aseptate to septate, produced along the stroma on phialides in a palisade or hymenial layer, or on phialides arising from pulvinate structures (sporodochia). Most species within the O. unilateralis core clade form an asexual morph characterized by subulate phialides that bear a single conidium at their apices (Hirsutella type-A). There are also two other types of hirsutelloid morphs within O. unilateralis core clade species: Hirsutella type-B – found in O. camponoti-novogranadensis – is produced on lower joint/foot on all legs of the host, which is a solitary upright synnema with a globose head (Evans ). Hirsutella type-C, which is produced from brown cushions (sporodochia) on leg and antennal joints, is found in O. oecophyllae (early divergent lineage of the O. unilateralis core clade), O. camponoti-renggeri, O. camponoti-nidulantis, O. camponoti-balzani and O. camponoti-indiani. O. kimflemingiae exhibits type-C phialides during its early stages of development, but these gradually disappear as the stroma matures. Ophiocordyceps naomi-pierceae from Australia has a unique asexual morph within the O. unilateralis core clade, formed on the surface of synnemata arising from the dorsal pronotum and leg joints. The abundant, long phialides are polyphialidic, branching sympodially to produce up to 10 pointed necks (Fig. 16). A similar paraisaria-like asexual morph is associated with the red ant (Myrmica rubra) in the UK, which was found to lie within the Ophiocordyceps, close to O. gracilis from which the genus Paraisaria was erected (Samson & Brady 1983), but far from O. unilateralis core clade (Evans ). The role of these asexual morphs is not fully understood, but we suggest that because the conidia are usually encased in mucus, they are contact spores and adhere to foraging host ants.

Ophiocordyceps kniphofioides s.s.: a strategy to persist in the environment

This species, besides its characteristic Kniphofia-like (red-hot poker) sexual morph, is known to form four types of asexual morphs. One of these – Hirsutella stilbelliformis var. stilbelliformis – plays a remarkable role of transmission even after the host removal. Evans & Samson (1982) described a behaviour in which apparently non-infected Cephalotes atratus – not displaying symptoms of fungal infection – actively attempted to remove infected cadavers from the lower trunk of the so-called cemetery or graveyard tree, forming a necropolis of ant corpses just above the tree base (Fig. 21). However, this type of asexual morph serves as a perfect adaption against this behaviour displayed by the healthy workers. These asexual structures consist of prostrate rhizoid-like outgrowths from the host that creeps beneath the moss carpet and bark, giving rise to synnemata-like structures producing mucoid balls of conidia at their tips (Fig. 22 and Evans & Samson 1982 p. 436). Once the ant cadaver is removed, the fungal structures remain on the tree, serving as a persistent inoculum for future hosts that are constantly passing on the trunk on the way to their arboreal nest: a perfect hidden trap.
Fig. 21

Ophiocordyceps kniphofioides sensu stricto. A.Cephalotes atratus with the stroma arising laterally from pronotum. B. Close-up of the ascoma. C. Section of the ascoma showing the immersed perithecia. D. Ascospore. E. Ascus. F. Hirsutella-like phialides, present along the stroma (stalk). Scale bar: A = 2 mm. B = 1 mm. C = 200 μm. D–F = 20 μm.

Fig. 22

A. Synnemata of the asexual morph (Hirsutella type-C. arising from the moss/trunk which remain attached, even after removal of the corpse. B–C. Close-up of the infected ants with synnemata on the surrounding substrate.

Ophiocordyceps kniphofioides sensu stricto. A.Cephalotes atratus with the stroma arising laterally from pronotum. B. Close-up of the ascoma. C. Section of the ascoma showing the immersed perithecia. D. Ascospore. E. Ascus. F. Hirsutella-like phialides, present along the stroma (stalk). Scale bar: A = 2 mm. B = 1 mm. C = 200 μm. D–F = 20 μm. A. Synnemata of the asexual morph (Hirsutella type-C. arising from the moss/trunk which remain attached, even after removal of the corpse. B–C. Close-up of the infected ants with synnemata on the surrounding substrate.

New combinations

Based on morphological, ecological and molecular data, we do not support the previous designation of varieties within the O. unilateralis and O. kniphofioides complexes and the following species, new names and new combinations are now recognized: (H.C. Evans & Samson) G.H. Sung et al., Stud. Mycol. 57: 44. 2007. Fig. 23.
Fig. 23

Base of the tree, with corpses of infected Cephalotes atratus removed from the trunk by the activity of other workers (Araújo & Hughes 2017).

Base of the tree, with corpses of infected Cephalotes atratus removed from the trunk by the activity of other workers (Araújo & Hughes 2017). Basionym: Cordyceps kniphofioides H.C. Evans & Samson, Trans. Brit. Mycol. Soc. 79: 434. 1982, on Cephalotes atratus. (H.C. Evans & Samson) Araújo, H.C. Evans & D.P. Hughes, comb. et stat. nov. MycoBank MB822352. Basionym: Cordyceps kniphofioides var. dolichoderi H.C. Evans & Samson, Trans. Brit. Mycol. Soc. 79: 437. 1982, on Dolichoderus attelaboides. Synonym: Ophiocordyceps kniphofioides var. dolichoderi (H.C. Evans & Samson) G.H. Sung et al., Stud. Mycol. 57: 44. 2007. (H.C. Evans & Samson) T. Sanjuan & R.M. Kepler, Fungal Biol. 119: 911. 2015. Basionym: Cordyceps kniphofioides var. ponerinarum H.C. Evans & Samson, Trans. Brit. Mycol. Soc. 79. 441. 1982, on Paraponera clavata. Synonym: Ophiocordyceps kniphofioides var. ponerinarum (H.C. Evans & Samson) G.H. Sung et al., Stud. Mycol. 57: 44. 2007. (H.C. Evans & Samson) Araújo, H.C. Evans & D.P. Hughes, comb. MycoBank: MB822306. Fig. 24, Fig. 25.
Fig. 24

Ophiocordyceps monacidis. A.Dolichoderus (Monacis) bispinosus infected by O. monacidis. B. Cross-section of the ascoma. C. Ascomata arising from a carpet of moss. D. Ascus. E. Ascospore. Scale bars: A = 1 mm, B = 200 μm, C = 3 mm, D = 20 μm, E = 30 μm.

Fig. 25

A–B.Ophiocordyceps monacidis stromata among the moss Octoblepharum albidum. The ants die hidden underneath the moss carpet just exposing the fungal structures (white arrows). C–D.O. albidum on the tree surface with its orange sporophytes.

Ophiocordyceps monacidis. A.Dolichoderus (Monacis) bispinosus infected by O. monacidis. B. Cross-section of the ascoma. C. Ascomata arising from a carpet of moss. D. Ascus. E. Ascospore. Scale bars: A = 1 mm, B = 200 μm, C = 3 mm, D = 20 μm, E = 30 μm. A–B.Ophiocordyceps monacidis stromata among the moss Octoblepharum albidum. The ants die hidden underneath the moss carpet just exposing the fungal structures (white arrows). C–D.O. albidum on the tree surface with its orange sporophytes. Basionym (replaced name): Cordyceps kniphofioides var. monacidis H.C. Evans & Samson, Trans. Brit. Mycol. Soc. 79: 439. 1982. Synonym: Ophiocordyceps kniphofioides var. monacidis (H.C. Evans & Samson) G.H. Sung et al., Stud. Mycol. 57: 44. 2007. Etymology: Named after the host Monacis bispinosus, currently Dolichoderus (Monacis) bispinosus. Type: Brazil, Pará, Monte Dourado, 10 Jan. 1980, H.C. Evans, RS 1540A (CBS), on Dolichoderus (Monacis) bispinosus (Dolichoderinae: Dolichoderini). Paratypes: INPA 274591, INPA 274592. The stroma, usually single, emerges laterally from the pronotum – rarely from the gaster – with a dark orange fertile terminal ascoma. The ascospores measure 95–10 μm long, with no germination in vitro observed. Habitat: Brazil, Amazonian rainforest. One of the most interesting aspects of O. monacidis (Fig. 24) is the behavioural manipulation whereby the fungus consistently leads the host to die among/underneath moss, specifically Octoblepharum albidum Hedwig that is commonly found in clumps at the base of trees in the Amazon forest. After host death, the fungus produces its reproductive stroma that grows through the moss carpet, before exposing its fruiting body. The resemblance of the ascomata of O. monacidis and the sporophytes of O. albidum is striking (Fig. 25), which makes the fungus hard to detect in situ. We hypothesize that the fungus mimics the asexual reproductive structure of this species of moss, although future studies are needed to better understand the ecological relationship between the moss, O. monacidis and its host Dolichoderus bispinosus.

Behaviour manipulation

All myrmecophilous hirsutelloid species (O. unilateralis core clade + O. oecophyllae + O. kniphofioides sub-clade) are known to alter the behaviour of their hosts. This phenomenon is called extended phenotype. The term was coined by Dawkins (1982) to describe the relationship between hosts and parasites, where the parasite genotype is expressed in any aspect of the host morphology or behaviour (phenotype). We found that species in the O. kniphofioides clade display a less sophisticated type of manipulation of the host compared to those in the O. unilateralis clade. O. kniphofioides s. s., O. ponerinarum and O. monacidis that lead their hosts to die typically at the base of lower trunks of upperstorey trees and attached to the substrate by their legs, which is further reinforced with fungal structures (Hughes , p. 443). O. daceti is an exception in the group and dies in the leaf litter or attached to the petiole or underside of leaves (Fig. 26). In the case of the species within the O. unilateralis clade, the behaviour manipulation occurs in a much more complex manner.
Fig. 26

Daceton armigerum infected by Ophiocordyceps daceti. A. Infected ant attached on the leaf petiole, in its original upside–down position. B. Close-up showing the attachment exclusively by the host legs with no apparent fungal attachment structures. C. Close-up showing the early stages of O. daceti emerging from the host’s dorsal pronotum.

Daceton armigerum infected by Ophiocordyceps daceti. A. Infected ant attached on the leaf petiole, in its original upside–down position. B. Close-up showing the attachment exclusively by the host legs with no apparent fungal attachment structures. C. Close-up showing the early stages of O. daceti emerging from the host’s dorsal pronotum. Every species within Ophiocordyceps unilateralis s.l. cause the infected ants to leave the colony and to ascend to the understorey vegetation, where they bite onto branches and leaves. However, each species occupies a characteristic niche and has a clear preference for certain substrates. O. camponoti-renggeri, for example, is often found biting onto moss carpets, at the base of upperstorey trees (Fig. 27 A–C). Fungi infecting very small ants such as O. camponoti-hippocrepidis, O. camponoti-bispinosi and O. camponoti-femorati often induce the host to bite onto the tips of palm needles (Fig. 27 D–E), especially spiny palms of the genus Astrocaryum. O. camponoti-atricipis and O. camponoti-floridani, sister species in the phylogeny, bite onto palm leaves, specifically close to the apical edge region; whilst, O. camponoti-leonardi in Thailand, invariably bites onto the underside of dicot leaves, precisely on the middle vein (Andersen ). O. camponoti-novogranadensis has a clear preference for epiphytes (lichens or small bromeliads) (Evans ). O. camponoti-nidulantis is often found at 25–40 cm above the ground, consistently biting onto the vegetation of tree saplings with both the antennae spread, possibly to facilitate conidia transmission (Fig. 8).
Fig. 27

Different behavioural manipulation within the O. unilateralis complex. A–C. Dead O. camponoti-renggeri as they are typically found, among moss at the base of trees. D–E. Smaller ants (e.g. O. camponoti–bispinosi, O. camponoti–hippocrepidis and O. camponoti–femorati) die often at the very tip of palm spines and epiphytes where water droplets form, providing continuous water resource.

Different behavioural manipulation within the O. unilateralis complex. A–C. Dead O. camponoti-renggeri as they are typically found, among moss at the base of trees. D–E. Smaller ants (e.g. O. camponoti–bispinosi, O. camponoti–hippocrepidis and O. camponoti–femorati) die often at the very tip of palm spines and epiphytes where water droplets form, providing continuous water resource.

Conclusions

Studies in biodiversity play an essential role in cataloguing and describing species, especially for understudied groups such as entomopathogenic fungi. Furthermore, by unravelling the true diversity of this group, more intriguing and complex questions will come to the light. The goal of this study is to document new taxa and help increase the knowledge necessary to answer questions related to the evolutionary history, host relationships and functional morphology of this group of pathogens. For example, which factors led to the hyper-diversity of the O. unilateralis clade? How did they reach the Camponotini ants and why this group of hosts is such a prolific environment for Ophiocordyceps radiation? Was it due to morphological adaptations such as capilliconidia? Was it due to the extremely sophisticated behavioural manipulation that arose in this group? Unfortunately, we are still unable to fully address these questions, but we hope that this study will contribute to answer these and other questions about this fascinating group of fungi.
  21 in total

1.  RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models.

Authors:  Alexandros Stamatakis
Journal:  Bioinformatics       Date:  2006-08-23       Impact factor: 6.937

2.  Phylogenomics resolves the timing and pattern of insect evolution.

Authors:  Bernhard Misof; Shanlin Liu; Karen Meusemann; Ralph S Peters; Alexander Donath; Christoph Mayer; Paul B Frandsen; Jessica Ware; Tomáš Flouri; Rolf G Beutel; Oliver Niehuis; Malte Petersen; Fernando Izquierdo-Carrasco; Torsten Wappler; Jes Rust; Andre J Aberer; Ulrike Aspöck; Horst Aspöck; Daniela Bartel; Alexander Blanke; Simon Berger; Alexander Böhm; Thomas R Buckley; Brett Calcott; Junqing Chen; Frank Friedrich; Makiko Fukui; Mari Fujita; Carola Greve; Peter Grobe; Shengchang Gu; Ying Huang; Lars S Jermiin; Akito Y Kawahara; Lars Krogmann; Martin Kubiak; Robert Lanfear; Harald Letsch; Yiyuan Li; Zhenyu Li; Jiguang Li; Haorong Lu; Ryuichiro Machida; Yuta Mashimo; Pashalia Kapli; Duane D McKenna; Guanliang Meng; Yasutaka Nakagaki; José Luis Navarrete-Heredia; Michael Ott; Yanxiang Ou; Günther Pass; Lars Podsiadlowski; Hans Pohl; Björn M von Reumont; Kai Schütte; Kaoru Sekiya; Shota Shimizu; Adam Slipinski; Alexandros Stamatakis; Wenhui Song; Xu Su; Nikolaus U Szucsich; Meihua Tan; Xuemei Tan; Min Tang; Jingbo Tang; Gerald Timelthaler; Shigekazu Tomizuka; Michelle Trautwein; Xiaoli Tong; Toshiki Uchifune; Manfred G Walzl; Brian M Wiegmann; Jeanne Wilbrandt; Benjamin Wipfler; Thomas K F Wong; Qiong Wu; Gengxiong Wu; Yinlong Xie; Shenzhou Yang; Qing Yang; David K Yeates; Kazunori Yoshizawa; Qing Zhang; Rui Zhang; Wenwei Zhang; Yunhui Zhang; Jing Zhao; Chengran Zhou; Lili Zhou; Tanja Ziesmann; Shijie Zou; Yingrui Li; Xun Xu; Yong Zhang; Huanming Yang; Jian Wang; Jun Wang; Karl M Kjer; Xin Zhou
Journal:  Science       Date:  2014-11-06       Impact factor: 47.728

Review 3.  From So Simple a Beginning: The Evolution of Behavioral Manipulation by Fungi.

Authors:  D P Hughes; J P M Araújo; R G Loreto; L Quevillon; C de Bekker; H C Evans
Journal:  Adv Genet       Date:  2016-02-19       Impact factor: 1.944

4.  Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA sequences.

Authors:  R Vilgalys; B L Sun
Journal:  Proc Natl Acad Sci U S A       Date:  1994-05-10       Impact factor: 11.205

5.  The beetle gut: a hyperdiverse source of novel yeasts.

Authors:  Sung-Oui Suh; Joseph V McHugh; David D Pollock; Meredith Blackwell
Journal:  Mycol Res       Date:  2005-03

6.  The life of a dead ant: the expression of an adaptive extended phenotype.

Authors:  Sandra B Andersen; Sylvia Gerritsma; Kalsum M Yusah; David Mayntz; Nigel L Hywel-Jones; Johan Billen; Jacobus J Boomsma; David P Hughes
Journal:  Am Nat       Date:  2009-09       Impact factor: 3.926

7.  Hidden diversity behind the zombie-ant fungus Ophiocordyceps unilateralis: four new species described from carpenter ants in Minas Gerais, Brazil.

Authors:  Harry C Evans; Simon L Elliot; David P Hughes
Journal:  PLoS One       Date:  2011-03-02       Impact factor: 3.240

8.  Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data.

Authors:  Matthew Kearse; Richard Moir; Amy Wilson; Steven Stones-Havas; Matthew Cheung; Shane Sturrock; Simon Buxton; Alex Cooper; Sidney Markowitz; Chris Duran; Tobias Thierer; Bruce Ashton; Peter Meintjes; Alexei Drummond
Journal:  Bioinformatics       Date:  2012-04-27       Impact factor: 6.937

9.  MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space.

Authors:  Fredrik Ronquist; Maxim Teslenko; Paul van der Mark; Daniel L Ayres; Aaron Darling; Sebastian Höhna; Bret Larget; Liang Liu; Marc A Suchard; John P Huelsenbeck
Journal:  Syst Biol       Date:  2012-02-22       Impact factor: 15.683

10.  Phylogenetic-based nomenclatural proposals for Ophiocordycipitaceae (Hypocreales) with new combinations in Tolypocladium.

Authors:  C Alisha Quandt; Ryan M Kepler; Walter Gams; João P M Araújo; Sayaka Ban; Harry C Evans; David Hughes; Richard Humber; Nigel Hywel-Jones; Zengzhi Li; J Jennifer Luangsa-Ard; Stephen A Rehner; Tatiana Sanjuan; Hiroki Sato; Bhushan Shrestha; Gi-Ho Sung; Yi-Jian Yao; Rasoul Zare; Joseph W Spatafora
Journal:  IMA Fungus       Date:  2014-06-19       Impact factor: 3.515

View more
  16 in total

1.  Zombie ant death grip due to hypercontracted mandibular muscles.

Authors:  Colleen A Mangold; Melissa J Ishler; Raquel G Loreto; Missy L Hazen; David P Hughes
Journal:  J Exp Biol       Date:  2019-07-17       Impact factor: 3.312

2.  Multi-locus phylogeny unmasks hidden species within the specialised spider-parasitic fungus, Gibellula (Hypocreales, Cordycipitaceae) in Thailand.

Authors:  W Kuephadungphan; B Petcharad; K Tasanathai; D Thanakitpipattana; N Kobmoo; A Khonsanit; R A Samson; J J Luangsa-Ard
Journal:  Stud Mycol       Date:  2022-04-29       Impact factor: 25.731

3.  https://invertebratefungi.org/: an expert-curated web-based platform for the identification and classification of invertebrate-associated fungi and fungus-like organisms.

Authors:  De-Ping Wei; Eleni Gentekaki; Kevin D Hyde; Yuan-Pin Xiao; Thatsanee Luangharn; Qing Tian; Yuan-Bing Wang; Saisamorn Lumyong
Journal:  Database (Oxford)       Date:  2022-04-01       Impact factor: 4.462

4.  Genetic Underpinnings of Host Manipulation by Ophiocordyceps as Revealed by Comparative Transcriptomics.

Authors:  Ian Will; Biplabendu Das; Thienthanh Trinh; Andreas Brachmann; Robin A Ohm; Charissa de Bekker
Journal:  G3 (Bethesda)       Date:  2020-07-07       Impact factor: 3.154

5.  Phylogenetic and morphological classification of Ophiocordyceps species on termites from Thailand.

Authors:  Kanoksri Tasanathai; Wasana Noisripoom; Thanyarat Chaitika; Artit Khonsanit; Sasitorn Hasin; Jennifer Luangsa-Ard
Journal:  MycoKeys       Date:  2019-07-29       Impact factor: 2.984

6.  Ophiocordyceps salganeicola, a parasite of social cockroaches in Japan and insights into the evolution of other closely-related Blattodea-associated lineages.

Authors:  João P M Araújo; Mitsuru G Moriguchi; Shigeru Uchiyama; Noriko Kinjo; Yu Matsuura
Journal:  IMA Fungus       Date:  2021-02-05       Impact factor: 3.515

7.  Empirical Support for the Pattern of Competitive Exclusion between Insect Parasitic Fungi.

Authors:  Shiqin Li; Wenjuan Yi; Siyi Chen; Chengshu Wang
Journal:  J Fungi (Basel)       Date:  2021-05-14

Review 8.  Hijacking time: How Ophiocordyceps fungi could be using ant host clocks to manipulate behavior.

Authors:  Charissa de Bekker; Biplabendu Das
Journal:  Parasite Immunol       Date:  2022-03       Impact factor: 2.206

9.  Ant-infecting Ophiocordyceps genomes reveal a high diversity of potential behavioral manipulation genes and a possible major role for enterotoxins.

Authors:  Charissa de Bekker; Robin A Ohm; Harry C Evans; Andreas Brachmann; David P Hughes
Journal:  Sci Rep       Date:  2017-10-02       Impact factor: 4.379

10.  The genus Simplicillium.

Authors:  De-Ping Wei; Dhanushka N Wanasinghe; Kevin D Hyde; Peter E Mortimer; Jianchu Xu; Yuan-Pin Xiao; Chitrabhanu S Bhunjun; Chaiwat To-Anun
Journal:  MycoKeys       Date:  2019-11-19       Impact factor: 2.984

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.