Literature DB >> 29896517

Genome sequence data from 17 accessions of Ensete ventricosum, a staple food crop for millions in Ethiopia.

Zerihun Yemataw1,2, Sadik Muzemil1, Daniel Ambachew1, Leena Tripathi3, Kassahun Tesfaye4,5, Alemayheu Chala6, Audrey Farbos7,8, Paul O'Neill7,8, Karen Moore7,8, Murray Grant9, David J Studholme7.   

Abstract

We present raw sequence reads and genome assemblies derived from 17 accessions of the Ethiopian orphan crop plant enset (Ensete ventricosum (Welw.) Cheesman) using the Illumina HiSeq and MiSeq platforms. Also presented is a catalogue of single-nucleotide polymorphisms inferred from the sequence data at an average density of approximately one per kilobase of genomic DNA.

Entities:  

Year:  2018        PMID: 29896517      PMCID: PMC5996239          DOI: 10.1016/j.dib.2018.03.026

Source DB:  PubMed          Journal:  Data Brief        ISSN: 2352-3409


Specifications Table Value of the data Here we present the first genome-wide sequence data available for enset accessions cultivated or growing wild in Ethiopia. There is potential to exploit genetic diversity (e.g. large numbers of single-nucleotide polymorphisms) to generate markers to assist enset selection for key agronomic traits. Given the long lifespan of enset, patterns of genetic variation can be used to classify germplasm and to prioritise and select germplasm for use in breeding.

Data

The data presented here include enset genomic resequencing data, in the form of sequence reads generated using the Illumina massively parallel deoxyribonucleic acid (DNA) sequencing platform. Also included are draft genome assemblies, a catalogue of single-nucleotide polymorphisms (SNPs) inferred from the sequence data, and images of agarose gels containing results of genotyping assays for several SNPs. Enset (Ensete ventricosum (Welw.) Cheesman) is a perennial, herbaceous plant belonging to the same botanical family as bananas and plantains, namely the Musaceae [1]. Although it does not yield edible fruits, it is the most important cultivated staple food crop in the highlands of central, south and southwestern Ethiopia with cultural significance [2] as well as a key role in food security [3], [4]. The main food value is in the large starch-rich corm, which can be boiled and consumed in a similar manner to tubers such as potato or can be used to generate a fermented product known as kocho [3], [5], [6], [7], [8], [9]. Enset varieties display a great range of genetic and phenotypic variation [7], [10], [11], [12], [13], [14], [15], [16] (Fig. 1) and 15 phenotypic traits have been assayed for a collection of 387 enset accessions [17]. Integration of phenotypic measurements with genetic markers could be of great value in breeding improved varieties with enhanced resistance to abiotic and biotic stresses. Despite its importance for food security of millions in Ethiopia, enset has been relatively neglected in molecular research and few genomic resources are available. We previously published a first draft genome sequence of E. ventricosum [18], but the sequenced individual was obtained from the nursery trade (from the UK-based company Jungle Seeds) and its provenance is unknown and therefore its relevance to Ethiopian agriculture is uncertain. Its phylogenetic relationship with Ethiopian varieties is rather distant (Fig. 2), clustering much more closely with E. ventricosum e4 (GenBank: FJ428156.1) [19], whose provenance is also unknown. In contrast, the data presented here originate from enset accessions collected in Ethiopia. Most of these enset accessions are sourced from the germplasm collection of the Southern Agricultural Research Institute (SARI), with the exception of Bedadeti, which originated from the collection of the International Institute for Tropical Agriculture (IITA). The data presented here complement previously published genomic resequencing data from Ensete species: targetted sequencing of repeats in Ensete gilletii [20] and E. ventricosum variety Gena [21] and exon sequencing of Ensete superbum and E. ventricosum [22].
Fig. 1

Phenotypic variation among sequenced accessions of E. ventricosum. Panels A, B and C shows cultivars Mazia, Lochingie and Nobo respectively.

Fig. 2

Phylogenetic positions of the enset accessions sequenced here compared to that of the previously sequenced enset genome based on sequences of the trnF–trnT barcode voucher region of the chloroplast DNA. This locus has previously been used as a barcode and phylogenetic indicator and sequence data for this locus are available from previously published studies (Bekele and Shigeta, [36]; Li et al. [19]; Harrison et al. [18]). There was no sequence variation at this locus among the 17 genomes presented here, as judged by BWA alignments of raw sequence reads against trnF-trnT sequence. Thus, the branch indicated by the black circle represents the phylogenetic position of all 17 sequenced accessions. A black triangle highlights the position of the “Jungle Seeds” individual whose genome was previously sequenced. The Maximum Likelihood tree presented here is based on a multiple sequence alignment of trnF-trnT sequences generated using MUSCLE (Edgar, 2004). Evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model (Tamura and Nei [37]). The tree with the highest log likelihood (-1249.11) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 32 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 666 positions in the final dataset. Evolutionary analyses were conducted in MEGA7 (Kumar et al. [38]).

Phenotypic variation among sequenced accessions of E. ventricosum. Panels A, B and C shows cultivars Mazia, Lochingie and Nobo respectively. Phylogenetic positions of the enset accessions sequenced here compared to that of the previously sequenced enset genome based on sequences of the trnF–trnT barcode voucher region of the chloroplast DNA. This locus has previously been used as a barcode and phylogenetic indicator and sequence data for this locus are available from previously published studies (Bekele and Shigeta, [36]; Li et al. [19]; Harrison et al. [18]). There was no sequence variation at this locus among the 17 genomes presented here, as judged by BWA alignments of raw sequence reads against trnF-trnT sequence. Thus, the branch indicated by the black circle represents the phylogenetic position of all 17 sequenced accessions. A black triangle highlights the position of the “Jungle Seeds” individual whose genome was previously sequenced. The Maximum Likelihood tree presented here is based on a multiple sequence alignment of trnF-trnT sequences generated using MUSCLE (Edgar, 2004). Evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model (Tamura and Nei [37]). The tree with the highest log likelihood (-1249.11) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 32 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 666 positions in the final dataset. Evolutionary analyses were conducted in MEGA7 (Kumar et al. [38]).

Experimental design, materials and methods

Genomic DNA was extracted from the young emerging (cigar) leaves using a previously published mini-prep protocol [23]. Between 0.2 and 0.5 g of young and clean leaf was collected per plant and dried in silica gel. From these dried leaves 0.2 g was taken from each sample and ground with sterile pestle and mortar. Genomic DNA was isolated from about 0.2 g of pulverized leaf sample using a modified triple cetyltrimethyl ammonium bromide (CTAB) extraction technique [24]. The yield and quality of DNA were assessed by agarose gel electrophoresis and by a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, Delaware) and quantified by Qubit broad range assay (Thermo Fisher Scientific). Illumina sequencing libraries were prepared, after fragmenting 500 ng of DNA to an average size of 500 bp, using Nextflex Rapid DNAseq kit for Illumina sequencing (Bioo Scientific) with adapters containing indexes and 5–8 cycles polymerase chain reaction (PCR) [25]. Library quality was determined using D1000 screen-tapes (Agilent) and libraries were either sequenced individually or combined in equimolar pools. We sequenced the enset genomic DNA using a combination of Illumina [26], [27] MiSeq and/or Illumina HiSeq. 2500 in either normal or rapid-run modes, as detailed in Table 1. The 17 sequenced accessions included 15 distinct named varieties. We sequenced two different accessions for cultivar Mazia and two different accessions for cultivar Lochingie (a result of complex vernacular naming systems for enset landraces arising from multiple ethno-linguistic communities); one accession was sequenced for each of the other varieties. Raw sequence reads were submitted to the Sequence Read Archive (SRA) [28] under the accession numbers listed in Table 1.
Table 1

Illumina sequencing of E. ventricosum accessions. Pairs of 100-bp reads were generated using the Illumina HiSeq. 2500 in normal mode except where indicated. A single asterisk (*) indicates use of the Illumina HiSeq. 2500 in rapid-run mode to generate pairs of 300-bp reads and two asterisks (**) indicate use of the Illumina MiSeq to generate pairs of 300-bp reads.

SARI IDNameCollected fromDepth of coverage of genomeSRA accession numbers
362ArkiyaDawro7.36×SRR4304969, SRR4304970
455ArkiyaWolaita8.04×SRR4304981*, SRR4304987
112AstaraSidama15.64×SRR4304989
n/aBedadetiUnknown45.81×SRR1515268, SRR1515269**
406BufferoWest Arsi18.25×SRR4304990
435DereaGurage18.43×SRR4308285, SRR4308286
451Erpha 13Dawro9.21×SRR4304991*, SRR4304992
449Erpha 20Dawro9.43×SRR4304971, SRR4304993*
221LochingieDawro8.86×SRR4304972*, SRR4304973
253LochingieWolaita8.66×SRR4304974*, SRR4304975
208MaziaWolaita7.00×SRR4304976*, SRR4304977
429MaziaDawro8.24×SRR4304978*, SRR4304979
39NechuweGurage20.69×SRR4304982
49NoboSheka17.16×SRR4304983
170OnjamoKembata-Tembaro21.75×SRR4308284
183SiyutiWolaita16.54×SRR4304984
54YakoKaffa17.96×SRR4304985
Illumina sequencing of E. ventricosum accessions. Pairs of 100-bp reads were generated using the Illumina HiSeq. 2500 in normal mode except where indicated. A single asterisk (*) indicates use of the Illumina HiSeq. 2500 in rapid-run mode to generate pairs of 300-bp reads and two asterisks (**) indicate use of the Illumina MiSeq to generate pairs of 300-bp reads. Prior to further analysis, sequence reads were trimmed and filtered using TrimGalore with options “-q 30 --paired”. We performed de novo sequence assembly for sequence reads from Bedadeti, Derea and Onjamo (Table 2). For Bedadeti, we used St. Petersburg genome assembler (SPAdes) v. 3.6.1 [29] to assemble contigs and then scaffolded these using Short Sequence Assembly by progressive K-mer search and 3′ read Extension (SSAKE)-based Scaffolding of Pre-Assembled Contigs after Extension (SSPACE) v. 3.0 [30]. For Onjamo, we generated contigs and scaffolds using SPAdes v. 3.9.0 and for Derea generated contigs only using SPAdes v. 3.9.0. SPAdes assemblies were performed using the “--careful” option.
Table 2

Assembly statistics for E. ventricosum genomes.

GenBank accession numberEnset accessionTotal length (bp)Contig N50 (bp)Scaffold N50 (bp)
GCA_000818735.2Bedadeti451,284,01820,94321,097
GCA_001884805.1Derea (435)429,479,73810,278n.d.
GCA_001884845.1Onjamo (170)444,841,97015,54616,208
Assembly statistics for E. ventricosum genomes. We identified single-nucleotide polymorphisms by alignment against the reference genome sequence, according to the following procedure. After trimming and filtering with TrimGalore, sequence reads were aligned against the Bedadeti reference genome sequence (GenBank: GCA_000818735.2) using Burrows-Wheeler Aligner (BWA) mem [31], [32] version 0.7.15-r1140 with default options and parameter values. Candidate SNVs were identified using Sequence Alignment/Map tools (SAMtools)/binary call format tools (BCFtools) package [33], version 1.6, using the following command-lines: samtools mpileup -u -f genome.fasta alignment.bam > alignment.bcf and. bcftools call -m -v --Ov alignment.bcf > alignment.vcf The candidate variants were then filtered using the following command line: bcftools filter --SnpGap 100 --include '(REF="A" | REF="C" | REF="G" | REF="T") & %QUAL>=35 & MIN(IDV)>=2 & MIN(DP)>=5 & INDEL=0' alignment.vcf > alignment.filtered.vcf This filtering step eliminates indels with low-confidence single-nucleotide variant calls. It also eliminates candidate SNVs within 10 base pairs of an indel, since alignment artefacts are relatively common in the close vicinity of indels. Allele frequencies at each SNP site were estimated from frequencies of each base (adenine (A), cytosine (C), guanine (G) or thymine (T)) among the aligned reads. Thus, we would expect an allele frequency of close to zero or one for homozygous sites and approximately 0.5 for heterozygous sites in a diploid genome. The binary alignment/map (BAM)-formatted BWA-mem alignments were converted to pileup format using the samtools mpileup command in SAMtools [33] version 1.6 with default options and parameter values. From the resulting pileup files, we used a custom Perl script (included in Supplementary material) to detect SNPs. For SNP detection, we considered only sites where depth of coverage by aligned reads was at least 5× for all 17 datasets. The distribution of a random sample of variants across the 17 accessions is summarized in Fig. 3.
Fig. 3

Overview of genetic variation in the sequenced E. ventricosum genomes. Each column in the heat-map represents one of 20,000 single-nucleotide variant sites. Each row represents one of the sequenced genomes. Colour indicates the relative frequency of aligned sequence reads with the variant nucleotide at that site in that genome, on a yellow-orange-red palette. Thus, heterozygous sites would be expected to be orange, while homozygous sites would be yellow (same as Bedadeti reference genome sequence) or red (variant from the Bedadeti reference genome sequence). These frequency values were inferred from mpileup-formatted files, generated by aligning genomic sequence reads against the Bedadeti reference genome sequence. The Perl script used to extract these from the mpileup files is included in the Supplementary Material.

Overview of genetic variation in the sequenced E. ventricosum genomes. Each column in the heat-map represents one of 20,000 single-nucleotide variant sites. Each row represents one of the sequenced genomes. Colour indicates the relative frequency of aligned sequence reads with the variant nucleotide at that site in that genome, on a yellow-orange-red palette. Thus, heterozygous sites would be expected to be orange, while homozygous sites would be yellow (same as Bedadeti reference genome sequence) or red (variant from the Bedadeti reference genome sequence). These frequency values were inferred from mpileup-formatted files, generated by aligning genomic sequence reads against the Bedadeti reference genome sequence. The Perl script used to extract these from the mpileup files is included in the Supplementary Material. The identification of relatively high-confidence SNPs, distributed throughout the genome at a density of approximately one SNP per kilobase, provides the possibility to develop markers that could be used for genotyping large numbers of plant accessions without the need for large-scale sequencing. One straightforward approach is polymerase chain reaction restriction fragment digest polymorphism (PCR-RFLP) [34]. Another is co-dominant amplified polymorphism (CAPS) [35]. In the PCR-RFLP assay, oligonucleotide primers are designed to amplify a PCR product that flanks a SNP that falls within the recognition site for a restriction enzyme such that one variant is cleavable by the restriction enzyme whilst the other variant is not. Thus, by examining the pattern of bands in agarose electrophoresis of the product after restriction digestion, it is possible to assess the genotype at that SNP location. As a proof of principle, we designed 22 pairs of oligonucleotide primers targeting SNPs identified from the genome sequencing data; these are listed in Table 3. We applied 5 of these assays to several hundred E. ventricosum accessions; agarose gels showing the products of digesting the PCR products can be found in the Supplementary material.
Table 3

Oligonucleotide primers for PCR-RFLP genotyping assays.

No.Forward and reverse primer sequencesPCR product size (bp)Restriction enzymeGenomic coordinates of PCR target (GenBank accession number: start-end)Corresponding location in banana genome
1TAGACTGCCAAGAGACTGCC, GAGTTTGTTCTCCACTTGCTG395EcoRVJTFG02000023: 86778–87172Chromosome 9
2CAATGAAATGAGCTCTCGAATGA, CCTCCCTCCCTCTACACAAG453ClaIJTFG02000451: 2383–2835Chromosome 3
3AGCTGCCTACTTATGTGCCA, AGGATGGGAGGATTTCACTCA296ClaIJTFG02001079: 44094–44389No match
4GAAAGATTCAACCACGCAACA, CAAAGTTGCCCAAATAATAGGGG100HindIIIJTFG02001701: 16598–16697Chromosome 9
5ACGTAGGAAACAGAAGGCGT, AGAATGAAAACCGGACAGATGA400BglIIJTFG02004430: 21696–22095Chromosome 10
6GACCAAGGTTGCAACGATGT, AACTCCCTAAAGTGGACCCG296HindIIIJTFG02004708: 2865–3160No match
7TGCCAATTGTAGCACGCTTT, TCCCAATGATCAGGATGTCATC321BglIIJTFG02007725: 4758–5078Chromosome 4
8AGCTGATCGGTAGGCTGTTT, TGTTCACTTGCTCAACTTCAATG329EcoRVJTFG02008123: 5568–5896Chromosome 4
9CGAAGGAACAAGAGGACGT, CGGCATGAACTAACCGCTTA380BglIIJTFG02010045: 2436–2815No match
10AGAGTAGAGGTCAGCGCATC, AGGCGAGTGACTAAAGTGCT385HindIIIJTFG02015245: 4512–4896No match
11GTCATGTAGAATTCAAAAGCCCA, ACCCATGACCAAGACTTTTCT458ClaIJTFG02000797: 35394–35851Chromosome 10
12GCAGAATCCCGTGAACCATC, TGTAAGTTTCTTCTCCTCCGCT377BglIIJTFG02001387: 44650–45026Chromosome 10
13TGCTTTAACCTAGTGAGCTACAA, ACGTCGCCCTTTTACTTTTCT400BamHIJTFG02001793: 29736–30135Chromosome 7
14GCCCATGCCATTCTTAAGGA, TCCAATTCCATCCTTCTTCATCT398BglIIJTFG02003127: 17456–17853Matches multiple chromosomes
15ACTACACAATCCTGGTCCAAAA, CGTAGTTTCCGCCCTTTGAG113EcoRVJTFG02004277: 15220–15332Chromosome 5
16CCTGGTTGAGAATGCGGATG, CGACCAATTACACTAAGCCCA419BglIIJTFG02006088: 4069–4489Matches several chromosomes
17TCCAGCCCAACAATTGATTCTT, CTGAACCTCGGCCAACCT400ClaIJTFG02006206: 13985–14384Matches several chromosomes
18TGCCAACCGAACCTCTCAG, TCAGCCATCTACGACATTTACA400PstIJTFG02010369: 10275–10674No match
19TGCTTACTGACTATGGAGAGCT, TGCCTGTTTGAGTCCATATAAGT487BamHIJTFG02011833: 6273–6759Matches several chromosomes
20CTCGTTAAGGTTCCCCATGC, CCAGCGTGGGAGATCTTTTG452EcoRVJTFG02024842: 425–876No match
21CGAGGGCTTCATCGAAAAGG, GCTGCCGACGAGTTGTTC391BamHIJTFG02043259: 629–1019No match
22CGATCGTTACGTTGCTTCAG, GGAGCCACAACCAACCAATT446PstIJTFG02009519: 11979–12424No match
Oligonucleotide primers for PCR-RFLP genotyping assays.
Subject areaBiology
More specific subject areaGenomics of crop plants
Type of dataDeoxyribonucleic acid (DNA) sequence
How data was acquiredIllumina HiSeq. 2500; Illumina MiSeq
Data formatRaw sequence reads; genome sequence assemblies
Experimental factorsGenomic DNA was extracted from a selection of 15 enset cultivars and two wild accessions
Experimental featuresGenome sequencing
Data source locationEthiopia
Data accessibilitySequence data are available from the Sequence Read Archive via BioProjects PRJNA344540https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA344540, PRJNA342253https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA342253, PRJNA341828https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA341828, PRJNA252658https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA252658
  20 in total

1.  Molecular phylogeny and systematics of the banana family (Musaceae) inferred from multiple nuclear and chloroplast DNA fragments, with a special reference to the genus Musa.

Authors:  Lin-Feng Li; Markku Häkkinen; Yong-Ming Yuan; Gang Hao; Xue-Jun Ge
Journal:  Mol Phylogenet Evol       Date:  2010-06-30       Impact factor: 4.286

Review 2.  The new paradigm of flow cell sequencing.

Authors:  Robert A Holt; Steven J M Jones
Journal:  Genome Res       Date:  2008-06       Impact factor: 9.043

Review 3.  Genotypic mutation analysis by RFLP/PCR.

Authors:  C Pourzand; P Cerutti
Journal:  Mutat Res       Date:  1993-07       Impact factor: 2.433

4.  Nutritional and chemical properties of fermented food of wild and cultivated genotypes of enset (Ensete ventricosum).

Authors:  Abraham Bosha; Abitew Lagibo Dalbato; Tamado Tana; Wassu Mohammed; Buzayew Tesfaye; Laila M Karlsson
Journal:  Food Res Int       Date:  2016-10-12       Impact factor: 6.475

Review 5.  Next-generation sequencing platforms.

Authors:  Elaine R Mardis
Journal:  Annu Rev Anal Chem (Palo Alto Calif)       Date:  2013       Impact factor: 10.745

6.  The Sequence Alignment/Map format and SAMtools.

Authors:  Heng Li; Bob Handsaker; Alec Wysoker; Tim Fennell; Jue Ruan; Nils Homer; Gabor Marth; Goncalo Abecasis; Richard Durbin
Journal:  Bioinformatics       Date:  2009-06-08       Impact factor: 6.937

7.  Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees.

Authors:  K Tamura; M Nei
Journal:  Mol Biol Evol       Date:  1993-05       Impact factor: 16.240

8.  The sequence read archive.

Authors:  Rasko Leinonen; Hideaki Sugawara; Martin Shumway
Journal:  Nucleic Acids Res       Date:  2010-11-09       Impact factor: 16.971

9.  Development of SSR markers and genetic diversity analysis in enset (Ensete ventricosum (Welw.) Cheesman), an orphan food security crop from Southern Ethiopia.

Authors:  Temesgen Magule Olango; Bizuayehu Tesfaye; Mario Augusto Pagnotta; Mario Enrico Pè; Marcello Catellani
Journal:  BMC Genet       Date:  2015-08-05       Impact factor: 2.797

10.  Genome-wide analysis of repeat diversity across the family Musaceae.

Authors:  Petr Novák; Eva Hřibová; Pavel Neumann; Andrea Koblížková; Jaroslav Doležel; Jiří Macas
Journal:  PLoS One       Date:  2014-06-16       Impact factor: 3.240

View more
  6 in total

Review 1.  Enset in Ethiopia: a poorly characterized but resilient starch staple.

Authors:  James S Borrell; Manosh K Biswas; Mark Goodwin; Guy Blomme; Trude Schwarzacher; J S Pat Heslop-Harrison; Abebe M Wendawek; Admas Berhanu; Simon Kallow; Steven Janssens; Ermias L Molla; Aaron P Davis; Feleke Woldeyes; Kathy Willis; Sebsebe Demissew; Paul Wilkin
Journal:  Ann Bot       Date:  2019-05-20       Impact factor: 4.357

Review 2.  Orphan crops: their importance and the urgency of improvement.

Authors:  Zerihun Tadele
Journal:  Planta       Date:  2019-06-12       Impact factor: 4.116

3.  Identifying molecular markers suitable for Frl selection in tomato breeding.

Authors:  Zübeyir Devran; Erdem Kahveci; Yiguo Hong; David J Studholme; Mahmut Tör
Journal:  Theor Appl Genet       Date:  2018-07-07       Impact factor: 5.699

4.  The landscape of microsatellites in the enset (Ensete ventricosum) genome and web-based marker resource development.

Authors:  Manosh Kumar Biswas; Jaypal N Darbar; James S Borrell; Mita Bagchi; Dhiman Biswas; Gizachew Woldesenbet Nuraga; Sebsebe Demissew; Paul Wilkin; Trude Schwarzacher; J S Heslop-Harrison
Journal:  Sci Rep       Date:  2020-09-17       Impact factor: 4.379

Review 5.  Pangenomes as a Resource to Accelerate Breeding of Under-Utilised Crop Species.

Authors:  Cassandria Geraldine Tay Fernandez; Benjamin John Nestor; Monica Furaste Danilevicz; Mitchell Gill; Jakob Petereit; Philipp Emanuel Bayer; Patrick Michael Finnegan; Jacqueline Batley; David Edwards
Journal:  Int J Mol Sci       Date:  2022-02-28       Impact factor: 5.923

6.  A chromosome-level reference genome of Ensete glaucum gives insight into diversity and chromosomal and repetitive sequence evolution in the Musaceae.

Authors:  Ziwei Wang; Mathieu Rouard; Manosh Kumar Biswas; Gaetan Droc; Dongli Cui; Nicolas Roux; Franc-Christophe Baurens; Xue-Jun Ge; Trude Schwarzacher; Pat J S Heslop-Harrison; Qing Liu
Journal:  Gigascience       Date:  2022-04-30       Impact factor: 7.658

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.