László Ivanizs1, András Farkas1, Gabriella Linc1, Márta Molnár-Láng1, István Molnár1,2. 1. Agricultural Institute, Centre for Agricultural Research, Hungarian Academy of Sciences, Martonvásár, Brunszvik u. 2, Hungary. 2. Institute of Experimental Botany of the Czech Academy of Sciences (IEB), Centre of the Region Haná for Biotechnological and Agricultural Research, Šlechtitelů 31, Olomouc-Holice, Czech Republic.
Abstract
Barley chromosome 5H, carrying important QTLs for plant adaptation and tolerance to abiotic stresses, is extremely instable in the wheat genetic background and is eliminated in the early generations of wheat-barley crosses. A spontaneous wheat-barley 5HS-7DS.7DL translocation was previously obtained among the progenies of the Mv9kr1 x Igri hybrid. The present work reports on the transfer of the 5HS-7DS.7DL translocation into a modern wheat cultivar, Mv Bodri, in order to use it in the wheat breeding program. The comparison of the hybridization bands of DNA repeats HvT01, pTa71, (GAA)n and the barley centromere-specific (AGGGAG)n in Igri barley and the 5HS-7DS.7DL translocation, together with the visualization of the barley chromatin made it possible to determine the size of the introgressed barley segment, which was approximately 74% of the whole 5HS. Of the 29 newly developed PCR markers, whose source ESTs were selected from the Genome Zipper of barley chromosome 5H, 23 were mapped in the introgressed 1-0.26 FL 5HS bin, three were located in the missing C-0.26 FL region, while three markers were specific for 5HL. The translocation breakpoint was flanked by markers Hv7502 and Hv3949. A comparison of the parental wheat cultivars and the wheat-barley introgression lines indicated that the presence of the translocation improved tillering ability in the Mv9kr1 and Mv Bodri genetic background. The similar or better yield components under high- or low-input cultivation environments, respectively, indicated that the 5HS-7DS.7DL translocation had little or no negative effect on yield components, making it a promising genotype to improve wheat genetic diversity. These results promise to accelerate functional genomic studies on barley chromosome 5H and to support pre-breeding and breeding research on wheat.
Barley chromosome 5H, carrying important QTLs for plant adaptation and tolerance to abiotic stresses, is extremely instable in the wheat genetic background and is eliminated in the early generations of wheat-barley crosses. A spontaneous wheat-barley 5HS-7DS.7DL translocation was previously obtained among the progenies of the Mv9kr1 x Igri hybrid. The present work reports on the transfer of the 5HS-7DS.7DL translocation into a modern wheat cultivar, Mv Bodri, in order to use it in the wheat breeding program. The comparison of the hybridization bands of DNA repeats HvT01, pTa71, (GAA)n and the barley centromere-specific (AGGGAG)n in Igri barley and the 5HS-7DS.7DL translocation, together with the visualization of the barley chromatin made it possible to determine the size of the introgressed barley segment, which was approximately 74% of the whole 5HS. Of the 29 newly developed PCR markers, whose source ESTs were selected from the Genome Zipper of barley chromosome 5H, 23 were mapped in the introgressed 1-0.26 FL 5HS bin, three were located in the missing C-0.26 FL region, while three markers were specific for 5HL. The translocation breakpoint was flanked by markers Hv7502 and Hv3949. A comparison of the parental wheat cultivars and the wheat-barley introgression lines indicated that the presence of the translocation improved tillering ability in the Mv9kr1 and Mv Bodri genetic background. The similar or better yield components under high- or low-input cultivation environments, respectively, indicated that the 5HS-7DS.7DL translocation had little or no negative effect on yield components, making it a promising genotype to improve wheat genetic diversity. These results promise to accelerate functional genomic studies on barley chromosome 5H and to support pre-breeding and breeding research on wheat.
The genetic diversity of common wheat (Triticum aestivum L.) can be extended via interspecific hybridization. One of the promising crossing partners is barley (Hordeum vulgare L.), which has many agronomically useful traits, such as earliness [1], tolerance of biotic [2,3] and abiotic (Al and salt) stress [4-7], good tillering ability [8,9] and high grain protein [10] and dietary fiber content [11,12], which it would be desirable to transfer into wheat.The first wheat-barley hybrids and addition lines (2H, 3H, 4H, 5H, 6H, 7H) were obtained from crosses between wheat genotype Chinese Spring and spring barley genotype Betzes [13].In order to produce introgressions with higher breeding value, the winter wheat line Mv9kr1, which has good crossability characters, and the German two-rowed winter barley genotype Igri were crossed to produce new wheat-barley hybrids and disomic addition lines (2H, 3H, 4H, 6HS, 7H, 1HS isochromosome) [14]. Unfortunately, the barley chromosome 5H was not represented in either set of addition lines, because the 5H chromosome is eliminated at high frequency in the early generations of wheat-barley crosses [15,16]. On the other hand, it would be highly desirable to utilize the genetic potential of barley chromosome 5H in wheat breeding, because several important QTLs responsible for salt and drought tolerance have been mapped on the short arm of this chromosome [17,18].Other studies also reported the extremely high elimination frequency of barley chromosome 5H [13,19,20], which makes it very difficult to develop a wheat-barley introgression line involving the 5H chromosome. The spontaneous, non-compensating wheat-barley translocation selected by genomic in situ hybridization (GISH) from Mv9kr1 x Igri progenies [21] is thus of great importance. The 5HS-7DS.7DL translocation was identified by Nagy et al. [22] using fluorescence in situ hybridization (FISH) and 5H barley chromosome-specific SSR (Simple Sequence Repeat) markers. It was found that the proximal half of the 5HS arm is missing from the translocation [22]. The wheat 7DS chromosome arm involved in this translocation was also characterized using physically mapped SSR markers in order to determine the size of the deleted 7DS fragment [23]. The absence of certain 7DS-specific marker products indicated the elimination of the terminal region of the 7D chromosome [23].Although Mv9kr1 is an easily crossable wheat genotype, containing the major crossability gene Kr1 transferred from Chinese Spring in recessive homozygous form (kr1kr1) [24], it has some disadvantageous traits, such as larger plant height and sensitivity to diseases due to the presence of Chinese Spring alleles. The second step in the utilization of wheat-alien introgression lines in breeding programs is the transfer of the translocated chromosome into an elite wheat genotype.The linear gene order (Genome Zipper) of the barley chromosome 5H contains mapped ESTs [25,26] which may have insertion/deletion (InDel) polymorphisms relative to wheat. These InDel polymorphisms can be used as gene-specific molecular markers for the precise mapping of barley chromosome segments in the wheat background as well as to support introgression breeding by the marker-assisted selection of wheat-barley introgression lines.In the present work, newly developed EST-derived InDel markers were used, together with in situ hybridization techniques, to precisely characterize the structure of the barley 5HS chromosome segment transferred into Mv Bodri. The effect of the 5HS-7DS.7DL translocation on the agronomic traits of Mv Bodri was compared with its effect in the original crossing partner Mv9kr1.
Material and methods
Plant material
A spontaneous 5HS-7DS.7DL translocation was produced from a hybrid between the winter wheat line Mv9kr1, and the barley cultivar Igri [21]. The translocation line, described as 5HS-7DS.7DL/Mv9kr1, was maintained by self-fertilization and crossed with a modern winter wheat cultivar, Mv Bodri, which has good agronomic performance. The F2 genotype carrying the translocation in disomic form was selfed three times to obtain a sufficient number of uniform progenies for agronomic investigation. These genotypes, containing a mixed wheat genetic backround originating from Mv9kr1 and Mv Bodri, were designated as 5HS-7DS.7DL/Mv9kr1/Mv Bodri.The barley cultivar Betzes (Hordeum vulgare L., 2n = 2x = 14) and the Chinese Spring-Betzes wheat–barley 5H disomic addition line [13] were used as positive controls and the wheat genotype Chinese Spring as negative control for the PCR validation of EST-derived markers.
Field trials and agronomic investigation of plants
Agronomic investigation of the genotypes was carried out in a low-input field (Tükrös Nursery, Martonvásár, Hungary; geographic coordinates: 47°18'40"N 18°46'56"E) in the 2015–2016 season and in a high-input location (Breeders nursery, Martonvásár, Hungary; 47°19'58"N 18°47'08"E) in 2016–2017. As both areas are owned by the Agricultural Institute, Centre for Agricultural Research, Hungarian Academy of Sciences, no specific permission was required for the experiments. It is also confirmed that the field studies did not involve endangered or protected species.The genotypes 5HS-7DS.7DL/Mv9kr1, 5HS-7DS.7DL/Mv9kr1/Mv Bodri, Mv9kr1 and Mv Bodri were grown in chernozem soil in both locations. In the low-input field, which was treated with herbicides [27], each genotype was sown in 5 × 1 m rows with 10 seeds per row and a row distance of 15 cm. In the high input field, each genotype was raised in a 4 m2 plot with 6 x 3 m rows, 50 seeds per row, and a row distance of 20 cm. Ten typical plants per genotype were randomly selected and analyzed for agronomic traits. Plant height and tillering were recorded directly before harvest, while seeds/spikelet, length of the main spike, number of seeds/main spike, number of spikelets/main spike and number of seeds/plant were assessed after harvest.
In situ hybridization
Root tip chromosome preparations of the genotypes 5HS-7DS.7DL/Mv9k1, 5HS-7DS.7DL/Mv9kr1/Mv Bodri and Igri were made according to Jiang et al. [28].Total genomic DNA was isolated from the barley genotype Igri using a DNA isolation kit (FujiFilm, Japan) and labeled with digoxigenin-11-dUTP (Roche Diagnostics, Mannheim, Germany) by nick translation. The HvT01 repeat was amplified from barley genomic DNA using PCR and labeled with digoxigenin-11-dUTP (Roche, Mannheim, Germany) [29]. The pTa71 probe was isolated from wheat [30] labeled with 50% biotin-16-dUTP and 50% digoxigenin-11-dUTP by nick translation (Roche). The (GAA)n microsatellite was amplified from barley [31] and labeled with biotin-16-dUTP (Roche) by PCR according to Vrána et al. [32], and the barley centromere-specific probe (AGGGAG)n was labeled with digoxigenin-11-dUTP by PCR as described by Hudakova et al. [33].GISH was carried out on genotypes 5HS-7DS.7DL/Mv9k1 and 5HS-7DS.7DL/Mv9kr1/Mv Bodri as described by Reader et al. [34] with minor modifications [35]. For the detection of the hybridization signals, 10 μg mL-1 each of streptavidin-FITC (Roche) and anti-digoxigenin-rhodamin (Roche) were used. The chromosomes were counterstained with 2 μg mL-1 DAPI (4′,6-diamidino-2-phenylindole, Amersham, Bucks., UK) and the slides were mounted in Vectashield fading inhibitor solution (Vector Laboratories, Burlingame, USA).After documentation of the GISH sites, the slides were washed and rehybridized using the repetitive DNA probes HvT01, pTa71 and (GAA)n and the barley centromere-specific sequence (AGGGAG)n. The FISH experiments was carried out according to the methods of Linc et al. [36] with modifications as described by Szakács and Molnár-Láng [14]. Pretreatments and stringency washings before the FISH experiments on the barley chromosome preparations were the same as those used for GISH and the same hybridization solutions containing repetitive DNA probes HvT01, pTa71, (GAA)n and (AGGGAG)n were used as for the 5HS-7DS.7DL translocation lines.Mitotic cells were examined with a Zeiss Axio Imager M2 fluorescence microscope equipped with the appropriate filter sets (Carl Zeiss Mikroskopie, Jena, Germany). Images were captured with a Zeiss AxioCam MRm CCD camera (Diagnostic Instruments, Sterling Heights, Mich., USA) and processed with Zeiss Axiovision 4.8.2. software.HvT01 is a barley-specific repetitive sequence located on the subtelomeric region of 5HS, pTa71 is an rDNA probe specific for the NOR region and able to detect the position of the secondary constriction on the 5HS arm, the (GAA)n oligonucleotide is located on the pericentric region of 5HS, while the (AGGGAG)n repeat is specific for the barley centromere. The length of the chromosome segments and the distances between the FISH signals were measured using Image Pro Plus 5.1 software. The positions of the translocation breakpoint and each of the FISH signals on the barley chromatin were expressed as fraction length (FL) values from the centromere relative to the length of the complete 5HS arm.
Development of EST-derived markers and PCR analysis
Genomic DNA was extracted from fresh young leaves (plants in the 2-leaf stage) from wheat genotypes Mv9kr1, Mv Bodri and Chinese Spring, barley cultivars Igri and Betzes, the Chinese Spring-Betzes 5H addition and the 5HS-7DS.7DL/Mv9kr1 and 5HS-7DS.7DL/Mv9kr1/Mv Bodri translocation lines using Quick Gene-Mini80 (FujiFilm, Japan) with a QuickGene DNA tissue kit (FujiFilm, Japan) according to the manufacturer’s instructions [37].The barley ESTs specific for chromosome 5H were selected from the publicly available barley Genome Zipper (http://pgsb.helmholtz-muenchen.de/plant/barley/gz/tablejsp/index.jsp) [26,38] and then aligned to the genomic sequences of the corresponding wheat homeologous chromosomes using BLASTn (https://urgi.versailles.inra.fr/blast/blast.php) to find ESTs showing polymorphism relative to wheat. BLASTn hits that met certain criteria (at least 7–8 bp InDel polymorphism and at least 80% homology between barley and wheat sequences) were considered as significant. The pairwise alignment of the selected ESTs and wheat contigs was carried out with UGENE software (v.1.23.0) to identify InDel regions between wheat and barley and to design barley-specific primers. The markers specific for barley chromosome 5H were validated by PCR on the genotypes Chinese Spring and Betzes and on the Chinese Spring-Betzes 5H addition lines. Two or three primer pairs were designed for each barley EST (Integrated DNA Technologies, Coralville, Iowa, USA) and the primer pair producing the most typical barley signal was chosen for subsequent analysis. The translocation genotypes were analyzed using primer pairs selected after the validation test.The PCR reactions were performed in a final volume of 15 μL containing 20 ng of template DNA, 1.5 μL of 10× key reaction buffer (MgCl2 final concentration of 1.5 mmol/L), 200 μmol/L of each dNTP, 0.2 μmol/L of forward and reverse primers, and 0.375 U of TEMPase Hot Start DNA Polymerase (VWR International, Belgium). The reactions were carried out in an Eppendorf Mastercycler (Eppendorf, Germany) using the following PCR profile: 15 min at 95°C, 35 cycles of 20 s at 95°C, 20 s at 58°C, 30 s at 72°C, and a final extension at 72°C for 5 min, following the manufacturer’s instructions (VWR International). All the molecular markers were constructed to have the same melting point (58 °C). The PCR products were separated using a Fragment Analyzer™ Automated CE System equipped with a 96-Capillary Array Cartridge (Advanced Analytical Technologies, USA). The separated nucleic acid fragments were visualized as digital capillary electrophoretic gel images, provided by the PROsize v2.0 software (Advanced Analytical Technologies, USA), in order to compare the size and concentration data of all the genotypes investigated.
Statistical analysis
In order to determine which fragment of 5HS was deleted in the wheat-barley translocation lines 5HS-7DS.7DL/Mv9kr1/Mv Bodri and 5HS-7DS.7DL/Mv9kr1, the length of the chromosome segments and the distances between the FISH signals were measured in 20 chromosomes from 5HS-7DS.7DL/Mv9kr1, 40 from 5HS-7DS.7DL/Mv9kr1/Mv Bodri and 30 from barley cultivar ‘Igri’ using Image Pro Plus 5.1 software.The amount of introgressed barley chromatin was compared in the two introgression lines 5HS-7DS.7DL/Mv9kr1/Mv Bodri and 5HS-7DS.7DL/Mv9kr1 using Student’s t-tests for paired data at the P = 0.05 significance level.The agronomic traits of lines 5HS-7DS.7DL/Mv9kr1/Mv Bodri and 5HS-7DS.7DL/Mv9kr1 and of parental wheat cultivars Mv9kr1 and Mv Bodri were compared pair-wise with each other. Differences in agronomic traits between the genotypes were evaluated by means of Tukey’s post hoc test (SPSS 16.0) at the P = 0.05 significance level.
Results
Transfer of the 5HS-7DS.7DL translocation into a modern wheat cultivar, Mv Bodri
In order to investigate the effect of the 5HS-7DS.7DL translocation on the agronomic performance of an elite wheat cultivar and to introduce this translocation into wheat breeding programs, a cross was made between 5HS-7DS.7DL/Mv9kr1 and Mv Bodri. The inheritance of the translocation was traced by GISH in 40 F2 progenies of this cross. Among the F2 genotypes the barley chromosome was eliminated from 27 plants, while 12 progeny carried the translocation in monosomic form and one in disomic form. As the 5HS-7DS.7DL/Mv9kr1 genotype was used as a crossing partner, the barley chromosome segment was regarded as originating from the 5HS-7DS.7DL translocation.
Physical characterization of the barley 5H chromatin using GISH and FISH
To study the structure of the introgressed 5HS chromatin and to obtain information about the missing part of the 5HS chromosome arm, the introgression lines were investigated with sequential FISH and GISH (Fig 1A–1D). The barley cultivar ‘Igri’ was also investigated with four repetitive DNA probes to obtain a reference karyotype for the 5H chromosome of barley (Fig 2). The hybridization signals of these probes served as cytogenetic landmarks for 5HS and their relative positions on the chromosome made it possible to calculate which part of the 5HS arm was missing in the translocation lines.
Fig 1
GISH and FISH analysis of the introgressed 5H barley chromatin in two genetic backgrounds.
(A) GISH was performed on mitotic metaphase cells of the 5HS-7DS.7DL/Mv9kr1/Mv Bodri and (C) 5HS-7Ds.7DL/Mv9kr1 translocation lines. The 5HS barley chromatin was visualized with rhodamine (red). (B) FISH analysis was carried out on metaphase chromosomes in the 5HS-7DS.7DL/Mv9kr1/Mv Bodri and (D) 5HS-7DS.7DL/Mv9kr1 translocation lines. In the FISH images, the 5HS barley segment was analyzed using the HvT01 (red) and pTa71 (green) probes. The wheat chromosomes were counterstained with DAPI (blue). Arrows indicate the 5HS-7DS.7DL introgressed chromosome. Scale bar = 10 μm.
Fig 2
FISH pattern of barley (Igri) chromosomes.
The 5H chromosomes could be identified and measured using repetitive DNA probes: HvT01 (red) in the subtelomeric region, pTa71 (green) in the satellite region, (GAA)n in the pericentric region (green) and (AGGGAG)n in the centromere (red). The 5H chromosomes are highlighted by arrows. Scale bar = 10 μm.
GISH and FISH analysis of the introgressed 5H barley chromatin in two genetic backgrounds.
(A) GISH was performed on mitotic metaphase cells of the 5HS-7DS.7DL/Mv9kr1/Mv Bodri and (C) 5HS-7Ds.7DL/Mv9kr1 translocation lines. The 5HS barley chromatin was visualized with rhodamine (red). (B) FISH analysis was carried out on metaphase chromosomes in the 5HS-7DS.7DL/Mv9kr1/Mv Bodri and (D) 5HS-7DS.7DL/Mv9kr1 translocation lines. In the FISH images, the 5HS barley segment was analyzed using the HvT01 (red) and pTa71 (green) probes. The wheat chromosomes were counterstained with DAPI (blue). Arrows indicate the 5HS-7DS.7DL introgressed chromosome. Scale bar = 10 μm.
FISH pattern of barley (Igri) chromosomes.
The 5H chromosomes could be identified and measured using repetitive DNA probes: HvT01 (red) in the subtelomeric region, pTa71 (green) in the satellite region, (GAA)n in the pericentric region (green) and (AGGGAG)n in the centromere (red). The 5H chromosomes are highlighted by arrows. Scale bar = 10 μm.Measurements on 30 intact barley 5HS chromosomes showed that the region between the telomere and the satellite (pTA71 signal) represented 30.8% (FL: 0.692) of the entire 5HS arm and that between the centromere-specific and pericentric (GAA)n signals 14.7% (FL: 0.147) (Fig 3C). Sequential GISH and FISH indicated that the pericentric (GAA)n and centromeric (AGGGAG)n signals were missing in the 5HS-7DS.7DL translocation (Fig 3A and 3B), while the distance between the telomere and the satellite (pTa71 signal), which accounted for 30.8% of the intact 5HS arm, was the same for the translocation lines as for the introgressed 5HS chromatin. It was possible to measure the total length of the introgressed barley chromatin visualized by GISH. As the relative position of the pTa71 signal on 5HS was the same in both the intact chromosome and the translocated segment, the relative position of the translocation breakpoints could be calculated from the total length of intact 5HS and the translocation segments. Based on measurements on 20 and 40 chromosomes respectively, the position of the translocation breakpoint of the introgressed 5HS segment relative to the whole 5HS chromosome arm was 0.27 FL ± 0.027 in 5HS-7DS.7DL/Mv9kr1 and 0.26 FL ± 0.025 in 5HS-7DS.7DL/Mv9kr1/Mv Bodri, indicating that the size of the introgressed barley segment (~74% of the whole 5HS arm) remained constant despite changes in the wheat genetic background, approximately 26% of the proximal part of the 5H short arm being absent from the translocated chromosome. The lack of the (GAA)n and centromere-specific signals, also indicating that at least 14.7% of the proximal part of 5HS is missing, further supports these results.
Fig 3
Representative picture for the determination of cytogenetic landmarks in the barley 5H chromatin.
(A) The hybridization signals of GISH and (B) FISH on the introgressed barley chromatin were visualized in the 5HS-7DS.7DL/Mv9Kr1/Mv Bodri genotype. (C) The hybridization signals of FISH on the intact 5H chromosome indicate the physical position of the HvT01, pTa71, (GAA)n and (AGGGAG)n repetitive probes in the barley genotype Igri. The positions of the fluorescence signals were expressed as fraction length (FL) on the barley chromatin from the centromere (0 FL) to the telomere (1 FL). The length of the 5HS chromosome arm corresponds to the distance between the telomere and the centromeric repeat (AGGGAG)n. (B, C) The relative position of the satellite (pTa71 signal) is 0.692 FL, which is characterisitic of both intact and introgressed 5HS. (C) The region between the centromere-specific and pericentric (GAA)n signals, which is missing from the 5HS-7DS.7DL translocation chromosome, represents the C-0.147 FL interval. (A) The relative position of the translocation breakpoint (TB) is 0.26 FL. The 1–0.26 FL region represents the transferred barley segment, accounting for 74% of the whole chromosome arm.
Representative picture for the determination of cytogenetic landmarks in the barley 5H chromatin.
(A) The hybridization signals of GISH and (B) FISH on the introgressed barley chromatin were visualized in the 5HS-7DS.7DL/Mv9Kr1/Mv Bodri genotype. (C) The hybridization signals of FISH on the intact 5H chromosome indicate the physical position of the HvT01, pTa71, (GAA)n and (AGGGAG)n repetitive probes in the barley genotype Igri. The positions of the fluorescence signals were expressed as fraction length (FL) on the barley chromatin from the centromere (0 FL) to the telomere (1 FL). The length of the 5HS chromosome arm corresponds to the distance between the telomere and the centromeric repeat (AGGGAG)n. (B, C) The relative position of the satellite (pTa71 signal) is 0.692 FL, which is characterisitic of both intact and introgressed 5HS. (C) The region between the centromere-specific and pericentric (GAA)n signals, which is missing from the 5HS-7DS.7DL translocation chromosome, represents the C-0.147 FL interval. (A) The relative position of the translocation breakpoint (TB) is 0.26 FL. The 1–0.26 FL region represents the transferred barley segment, accounting for 74% of the whole chromosome arm.
Molecular marker analysis
A total of about a thousand barley ESTs were analyzed using BLASTn (https://urgi.versailles.inra.fr/blast/blast.php). The query sequences (barley ESTs) were compared with the genomic sequences of wheat chromosomes. Ninety-five barley ESTs containing insertion/deletion regions (>7–8 bp) and showing at least 80% homology relative to wheat were chosen. Pairwise alignment was performed between the 95 selected ESTs and the corresponding wheat genomic sequences. Primer pairs were designed for the identified InDel regions in order to obtain markers amplifying the barley-specific fragments.Primer sequences were developed for 35 of the 95 ESTs and these were validated by PCR on the control lines. The markers designed in the present study are listed in Table 1 together with their primer sequences and genetic positions. Six of the 35 EST-derived primer pairs either failed to produce a PCR amplicon in the barley genotypes or generated products non-polymorphic between the wheat and barley genotypes (Table 1).
Table 1
Validation of the EST-derived markers on the negative (Chinese Spring) and positive control lines (Betzes, Chinese Spring-Betzes 5H addition).
Markera
Forward primer
Reverse primer
Barley EST nameb
Position of the ESTs (cM)b
Barley-specific signal in the positive controlsc
Hv19657
AGGACAACATCTGCTTCTCG
ATACAATGCACAAATCGCAA
19657
0
+
Hv25687
ACCTAGTGGTGGCGTACCT
AGGTCGGCGTGGTCATGC
25687
2.81
-
Hv16076
TAAGCCAAGGAGATCACGTC
TACTTTACAACAACGACGGC
16076
25.23
+
Hv4027
ACTGGAGGAGAAAGTGAAGC
GTGCGAGTGCGAGTGCTCGT
4027
26.28
-
Hv1666
GATCTCAAGTCCATTTCACG
TCGCAATGTGTCGCATTGCT
1666
29.90
-
Hv16374
CCGGTTTGTGTAGAACCAAG
CCAAATCTCAGCTCGCGTGA
16374
29.97
+
Hv32679
GCGGTTACTCATCACCACTC
CAGTTGCTCCAGCACAACTG
32679
29.97
-
Hv48084
GAGGAAGCTCCTTACCAAGC
CTACAACAAGCCTGATCGAT
48084
29.97
+
Hv8574
TGGAACTGATGTGAGCAACA
ATCTTACCAGAACCTCCCTT
8574
29.97
+
Hv11893
GTGGAGGACGAAGAGATGG
TCAACGCACAGCAGCAACAC
11893
29.97
+
Hv1413
AAGAAGAAGAAGCAGCAGCA
AGCAGCAGCAGCAACGGTGA
1413
29.97
+
Hv4079
TTAACTTTGCTCCAGGGATG
GCTTCCTATAGTTTGATTGG
4079
33.09
+
Hv24684
CAGCTGAGCTCTGATGATGA
GACAGCCAGATAAGATCCAC
24684
33.09
+
Hv3528
TAAGGCGTTTGACATGGAAT
TGGTCTGAACTGCTAGATTA
3528
39.97
+
Hv19014
ACTGCACATGGTTCTCGACT
AGCATGTTCGTAAGTGGTCG
19014
39.97
+
Hv3781
TCCCATAACTGGTTCAGCTC
GAGAGCCACACTGCATATAT
3781
41.64
+
Hv34877
TGACAATACAGGCTGGGACT
GTAGCAGTGTGCAGTTTGTA
34877
41.64
+
Hv23691
TAAGCTATGGCGCTGCTG
TTCTACTCATTCAGAGATTACAC
23691
50.27
+
Hv7317
GGCCGTATGAGTTGCTAAGA
ACTGGTGAGTGGTAAATATC
7317
50.27
+
Hv4262
TGCAGCAGTTCGCTCTACTA
AACTGTCCAGGTGGCAGCTG
4262
50.27
+
Hv2530
ACCTGTCATGGGTTTCCATA
TATGGTACTTCTGAGAAGTA
2530
50.72
-
Hv14691
GCTCTACAGGAAGCTCGTGA
CTCTTCTCTTTGCATCTTGA
14691
51.30
+
Hv19799
CTGTTCCACATAGGCAGCTT
CTCGGAGGTTTCGCCGGAAG
19799
51.30
+
Hv2734
GATGGTAGCTTCACCCGTTA
ATTCGCTAGCAAAGGACTAT
2734
51.30
+
Hv8326
CATCTTCCCATCAATGATCC
ACTCTATTGCTACGACAACG
8326
51.30
+
Hv8011
GCAACATTAACCAGGGTCAG
CTGTGTAGTATGAGAAATTC
8011
51.30
+
Hv23495
AAGCAGAAGAGAAGGCTGGT
GCGGGAGCTGGAGCTTGAGC
23495
51.30
+
Hv7502
GCAAGTGAAAGTGACCAAGA
TTCTGAACCTGAGCCGCG
7502
51.30
+
Hv3949
AGGAAGTCACATGCTCGTCT
GCATAAGAACTACCAGGTATT
3949
51.30
+
Hv18070
TATCCACGACATACCCAAGC
ACCTTAGCTTATGTGCTGGA
18070
51.30
+
Hv18916
GCTTTGGCTGATGTCATCTT
AGGTGCACCTGACCACTGCA
18916
51.30
+
Hv26278
TACGGCATGAAGAGGAAGAG
ATCTCCTCGGTCGATCTACA
26278
52.02
+
Hv26490
CCATTGTCGTTGTCATGGA
CCGGCGTTCGTGTGCCGCG
26490
52.60
+
Hv18171
TCGAGAGACTGAGACGGAGA
GGAGTGCCAGCAGTGAAACG
18171
57.98
+
Hv15683
GGATCATGTCGGTAGAGGAA
TTGATACGATACATAGAAGA
15683
59.74
-
The names of the markers correspond to the identification number of the source barley EST, the ‘Hv’ prefix refers to the abbreviation of the species (Hordeum vulgare L).
Name and position of the barley ESTs on the Genom Zipper of chromosome 5H [26].
+/-: presence or absence of the barley-specific PCR product on the positive control genotypes (Betzes, Chinese Spring-Betzes 5H addition).
The names of the markers correspond to the identification number of the source barley EST, the ‘Hv’ prefix refers to the abbreviation of the species (Hordeum vulgare L).Name and position of the barley ESTs on the Genom Zipper of chromosome 5H [26].+/-: presence or absence of the barley-specific PCR product on the positive control genotypes (Betzes, Chinese Spring-Betzes 5H addition).The remaining 29 markers were tested in the translocation lines and twenty-three were found to map within the 0–51.30 cM interval in both 5HS-7DS.7DL/Mv9kr1 and 5HS-7DS.7DL/Mv9kr1/Mv Bodri (Table 2). Three markers (Hv3949, Hv18070, Hv18916) located in the most proximal EST bin (51.30 cM) at the centromere were missing from the translocation lines and three (Hv26278, Hv26490, Hv18171) mapped to the proximal region of 5HL gave no PCR product in either of the translocation lines (Fig 4). These results indicate that the translocation breakpoint is located in the 51.3 cM region. The breakpoint was delimited between markers Hv7502 and Hv3949, located at loci 653 and 725, respectively, which means that this part of the 51.3 cM region is equivalent to 73–74% of the 5HS chromosome arm (Fig 5). Marker analysis also revealed that the barley chromatin segment did not change in the modified wheat genetic background (Table 2).
Table 2
Analysis of the 5HS-7DS.7DL/Mv9kr1 and 5HS-7DS.7DL/Mv9kr1/Mv Bodri translocations with the negative (Mv9kr1, Mv Bodri) and positive control lines (Igri) using the molecular markers designed in the present study.
Marker
Barley EST locia
Location on the 5H chromosomea
Barley-specific signal in the 5HS-7DS.7DL/Mv9kr1 translocation lineb
Barley-specific signal in the 5HS-7DS.7DL/Mv9kr1/Mv Bodri translocation lineb
Hv19657
4
5HS
+
+
Hv16076
81
5HS
+
+
Hv16374
118
5HS
+
+
Hv48084
123
5HS
+
+
Hv8574
124
5HS
+
+
Hv11893
126
5HS
+
+
Hv1413
133
5HS
+
+
Hv4079
137
5HS
+
+
Hv24684
138
5HS
+
+
Hv3528
165
5HS
+
+
Hv19014
166
5HS
+
+
Hv3781
176
5HS
+
+
Hv34877
180
5HS
+
+
Hv23691
466
5HS
+
+
Hv7317
473
5HS
+
+
Hv4262
489
5HS
+
+
Hv14691
542
5HS
+
+
Hv19799
547
5HS
+
+
Hv2734
621
5HS
+
+
Hv8326
646
5HS
+
+
Hv8011
650
5HS
+
+
Hv23495
653
5HS
+
+
Hv7502
653
5HS
+
+
Hv3949
725
5HS
-
-
Hv18070
770
5HS
-
-
Hv18916
945
5HS
-
-
Hv26278
979
5HL
-
-
Hv26490
987
5HL
-
-
Hv18171
1053
5HL
-
-
Barley EST loci and their distribution over the 5H barley chromosome according to Genom Zipper [26]
Comparison of the two introgressions using 5H-specific EST markers. +/-: presence or absence of the barley-specific signal in the 5HS-7DS.7DL translocation lines.
Fig 4
Digital capillary electrophoretic pattern of the barley EST-derived markers.
The Hv23495, Hv7502, Hv3949 and Hv18916 markers specific for barley chromosome 5H were tested on wheat cultivars Mv9kr1 and Mv Bodri, barley cultivar Igri and the introgression lines 5HS-7DS.7DL/Mv9kr1 and 5HS-7DS.7DL/Mv9kr1/Mv Bodri. The plus or minus sign next to the arrow indicates the presence or absence of a barley-specific PCR product in the tested translocation lines. A 35–500 bp DNA ladder was used as a molecular-weight size marker to estimate the fragment size.
Fig 5
Comparison of genetic linkage and physical maps for the barley 5H chromosome.
(A) The distribution of the EST-derived markers over the intact 5H chromosome of the barley genotype Igri is illustrated based on the high-resolution EST map found in Genom Zippers. The marker distance was expressed in centimorgans (cM) from the telomere of 5HS (0 cM) to the telomere of 5HL. (B) In the physical map of barley chromosome 5H the introgressed part of the 5HS chromosome arm and the molecular markers mapped on it are highlighted in red. The missing parts of 5HS and 5HL and the molecular markers specific to these regions are shown in black. The size of the introgressed and missing parts of 5H were expressed as fraction length (FL). The putative centromere position estimated by the cytogenetic landmarks is labeled C.
Digital capillary electrophoretic pattern of the barley EST-derived markers.
The Hv23495, Hv7502, Hv3949 and Hv18916 markers specific for barley chromosome 5H were tested on wheat cultivars Mv9kr1 and Mv Bodri, barley cultivar Igri and the introgression lines 5HS-7DS.7DL/Mv9kr1 and 5HS-7DS.7DL/Mv9kr1/Mv Bodri. The plus or minus sign next to the arrow indicates the presence or absence of a barley-specific PCR product in the tested translocation lines. A 35–500 bp DNA ladder was used as a molecular-weight size marker to estimate the fragment size.
Comparison of genetic linkage and physical maps for the barley 5H chromosome.
(A) The distribution of the EST-derived markers over the intact 5H chromosome of the barley genotype Igri is illustrated based on the high-resolution EST map found in Genom Zippers. The marker distance was expressed in centimorgans (cM) from the telomere of 5HS (0 cM) to the telomere of 5HL. (B) In the physical map of barley chromosome 5H the introgressed part of the 5HS chromosome arm and the molecular markers mapped on it are highlighted in red. The missing parts of 5HS and 5HL and the molecular markers specific to these regions are shown in black. The size of the introgressed and missing parts of 5H were expressed as fraction length (FL). The putative centromere position estimated by the cytogenetic landmarks is labeled C.Barley EST loci and their distribution over the 5H barley chromosome according to Genom Zipper [26]Comparison of the two introgressions using 5H-specific EST markers. +/-: presence or absence of the barley-specific signal in the 5HS-7DS.7DL translocation lines.
Agronomic investigation
In order to clarify whether the translocation or the modification of the wheat genetic background had a greater influence on agronomic traits, the agronomic performance of the two translocation genotypes 5HS-7DS.7DL/Mv9kr1 and 5HS-7DS.7DL/Mv9kr1/Mv Bodri was compared, together with that of the parental wheat genotypes Mv9kr1 and Mv Bodri, in two field trials representing high-input (Table 3) and low-input (Table 4) conditions.
Table 3
Morphological traits of the two translocation lines and the parental wheat cultivars in the high-input field (Breeders Nursery) in the 2016–2017 growing season.
Genotype
Plant height (cm)
Length of the main spike (cm)
Spikes/plant
Seeds/mainspike
Spikelets/ main spike
Seeds/ spikelet
Seeds/plant
1000-Kernel weight (g)
Mv9kr1
94.1 ± 2.8a
10.9 ± 0.7a
10.8 ± 1.5b
58.1 ± 7.6a
23.0 ± 1.1a
2.5 ± 0.3b
512 ± 89b
38.7 ± 1.3a
Mv Bodri
83.2 ± 4.4b
10.4 ± 0.3a
10.9 ± 1.4b
65.4 ± 3.3a
21.6 ± 1.1ab
3.1 ± 0.2a
540 ± 68b
37.5 ± 2.8ab
5HS-7DS.7DL/Mv9kr1
78.1 ± 4.5c
8.6 ± 0.4b
13.1 ± 1.8a
47.4 ± 8.2b
18.1 ± 1.1c
2.6 ± 0.4b
550 ± 109b
35.3 ± 1.8b
5HS-7DS.7DL/Mv9kr1/ Mv Bodri
76.1 ± 3.3c
8.5 ± 0.6b
15.1 ± 2.2a
59.1 ± 7.6a
20.6 ± 1.6b
2.9 ± 0.3ab
681 ± 104a
38.4 ± 3.4a
Data represent mean ± standard deviation of 10 plants per genotype for each agronomic parameter. Different letters indicate significant differences between the genotypes at P<0.05, using Tukey’s post hoc test.
Table 4
Morphological traits of the two translocation lines and the parental wheat cultivars in the low-input field (Tükrös Nursery) in the 2015–2016 growing season.
Genotype
Plant height (cm)
Length of the main spike (cm)
Spikes/plant
Seeds/main spike
Spikelets/ main spike
Seeds/ spikelet
Seeds/plant
1000-Kernel weight (g)
Mv9kr1
88.8 ± 5.3a
9.0 ± 0.9a
5.1 ± 1.3b
37.6 ± 6.0ab
17 ± 1.3a
2.2 ± 0.4ab
146 ± 53b
39.5 ± 2.5a
Mv Bodri
61.8 ± 4.6c
8.5 ± 0.6ab
5.3 ± 1.5b
32.0 ± 11.4b
16.6 ± 1.5ab
2.0 ± 0.8b
158 ± 31b
39.1 ± 3.3ab
5HS-7DS.7DL/Mv9kr1
68.0 ± 3.5b
7.7 ± 0.4bc
6.7± 0.7ab
33.5 ± 4.6ab
14.2 ± 1.2c
2.4 ± 0.3ab
166 ± 16ab
36.4 ± 1.5b
5HS-7DS.7DL/Mv9kr1/ Mv Bodri
70.0 ± 3.5b
7.3 ± 0.6c
8.7 ± 2.6a
40.7 ± 3.6a
15.1 ± 1.1bc
2.7 ± 0.3a
211 ± 56a
38.7 ± 1.8ab
Data represent mean ± standard deviation of 10 plants per genotype for each agronomic parameter. Different letters indicate significant differences between the genotypes at P<0.05, using Tukey’s post hoc test.
Data represent mean ± standard deviation of 10 plants per genotype for each agronomic parameter. Different letters indicate significant differences between the genotypes at P<0.05, using Tukey’s post hoc test.Data represent mean ± standard deviation of 10 plants per genotype for each agronomic parameter. Different letters indicate significant differences between the genotypes at P<0.05, using Tukey’s post hoc test.In the two field experiments Tukey’s post-hoc analysis classified the plant height of both translocation lines in the same category, which differed from that of the wheat cultivars. Mv9kr1 was the tallest in both field trials. Mv Bodri was the shortest genotype in the low-input organic nursery, but grew much taller in the high-input area, where Mv Bodri was also taller than the two translocation genotypes. The length of the main spike was smaller in the introgression lines than in the wheat cultivars. 5HS-7DS.7DL/Mv9kr1/Mv Bodri had the highest number of spikes per plant at both locations, showing a significant difference compared with the parental lines. Both translocation lines had fewer spikelets per main spike than the wheat cultivars, indicating the effect of the introgressed barley chromatin or the loss of the 7DS wheat chromatin. It is important that the line 5HS-7DS.7DL/Mv9kr1/Mv Bodri had a higher number of seeds per main spike and spikelets per main spike than the initial introgression line indicating the positive effect of the Mv Bodri background under high imput conditions. The 5HS-7DS.7DL/Mv9kr1/Mv Bodri genotype had the most seeds per plant in both field trials, differing significantly from the other three lines. The 5HS-7DS.7DL/Mv9kr1/Mv Bodri genotype had higher thousand-kernel weight (TKW) than the 5HS-7DS.7DL/Mv9kr1 genotype in both field experiments. The two locations had similar average TKW values despite the different nutrient supplies.The spike of 5HS-7DS.7DL/Mv9kr1/Mv Bodri had a dense structure with awned spikes, like those of the Mv Bodri wheat genotype. However, 5HS-7DS.7DL/Mv9kr1 had a main spike with apical awn stubs, like that of Mv9kr1 wheat (Fig 6).
Fig 6
Spike morphology of the wheat cultivars and the wheat-barley translocation lines.
The plants were grown in the Organic Nursery (Tükrös) in Martonvásár, Hungary in the 2015–2016 growing season.
Spike morphology of the wheat cultivars and the wheat-barley translocation lines.
The plants were grown in the Organic Nursery (Tükrös) in Martonvásár, Hungary in the 2015–2016 growing season.
Discussion
As the 5H chromosome is eliminated most frequently in wheat x barley crossing programs [13,19,20], the importance of the 5HS-7DS.7DL translocation is underlined by the fact that this translocation has exhibited stable inheritance through 15 generations. In the present study, the 5HS chromosome segment of Igri barley was transferred into an elite wheat genetic background to obtain a genotype suitable for direct use in wheat breeding programs.The structure of the introgressed barley chromatin was compared in the two different wheat genetic backgrounds, Mv9kr1 and Mv Bodri. Both molecular marker and molecular cytogenetic analysis confirmed that the size of the 5HS chromatin segment did not change when the wheat genetic background was modified. GISH and FISH determined the physical position of the translocation breakpoint at 0.26 FL of the whole 5HS arm. As the estimated length of the 5H short arm is 301 Mbp, compared with 5100 Mbp for the barley genome [39,40], it is estimated that the 74% of the whole 5HS arm transferred into wheat corresponds to 223 Mbp. The PCR analysis showed that 23 markers developed in the present study were mapped in the introgressed 1–0.26 FL (223 Mbp) bin, while three markers (Hv3949, Hv18070, Hv18916) were located in the missing C-0.26 FL region (78 Mbp) in both translocation genotypes. Interestingly, the translocation breakpoint was flanked by markers Hv7502 and Hv3949, and seven of the ten markers, whose source ESTs were previously mapped within the centromeric region of 5HS (51.3–52.02 cM) [26,41], were located in the 1–0.26 FL region. These results indicate that the chromosomal breakage must be more distal from the centromere than was suggested by the genetic position of the source ESTs on the high-resolution EST map. In an earlier study Nagy et al. [22] delimited the position of this translocation breakpoint between the microsatellite markers Bmag387 and Bmag337, so the present results also indicate that the Bmag387 marker was located distally and the Bmag337 marker proximally from the 0.26 FL position. It was also hypothesized earlier that the terminal region of 5HS had already been deleted in the barley genotype Igri due to a chromosomal rearrangement with a breakpoint near the satellite [22]. However, the telomere specific EST-derived marker (Hv19657) amplified a 5HS-specific fragment in the introgression lines and in Igri barley, indicating that the terminal segment of 5HS is present in the translocation.This study supports the previous opinion that the linearly ordered virtual gene map of barley (Genome Zipper) is extremely useful in both fundamental and applied barley research [42]. The new EST-derived markers developed in this study will be used in wheat prebreeding programs aimed at shortening the introgressed 5HS segment. This marker development approach can also be applied for the marker saturation of 5HS chromosome regions containing desirable agronomic traits for wheat improvement. In this context, several QTLs related to abiotic stress tolerance were mapped on the 5HS barley chromatin. On the distal half of 5HS, two QTLs related to the osmotic adjustment of plant cells under water-limited and well-watered conditions were located [17]. Some physiological traits connected to the salt tolerance in barley were also mapped near the centromere of 5HS [18], such as a QTL affecting proline content and another related to the water-soluble carbohydrate content, which may facilitate heat or salt tolerance in the grain-filling period. Further studies will be needed in the future to prove that the introgressed 5HS segment has a real effect on the abiotic stress tolerance of wheat.The present study also investigated how the presence of barley 5HS chromatin affects agronomic parameters as compared with the changes caused by the modification of the wheat genetic background. The number of spikes per plant is one of the most important parameters determining the yield of cereals. Both translocation lines had a higher number of spikes per plant than the wheat cultivars in both field trials, indicating that this parameter was influenced predominantly by the introgressed barley chromatin. The results for the effect of 5HS on tillering ability are in agreement with previous data published by Naz et al. [43], who identified five QTLs associated with tiller number per plant on barley chromosomes 1H, 2H, 4H and 5H, among which the strongest locus (QTil.S42IL.5H) was localized on 5H. Other studies also reported QTLs affecting tillering ability on chromosome 5H [44], such as the locus spp-5H-1, mapped close to the 50 cM region [45].As no significant difference was observed in other yield components (seeds/main spike, seeds/spikelet and thousand-kernel weight) between 5HS-7DS.7DL/Mv9kr1/MvBodri and Mv Bodri, it can be concluded that increased tillering ability is the main yield component responsible for the higher yield (expressed as seeds/plant) in the 5HS-7DS.7DL/Mv9kr1/MvBodri genotype relative to the corresponding wheat genotype Mv Bodri under high-input field conditions. On the other hand, the increased fertility indicated by higher values of seeds per main spike and spikelets per main spike might have contributed to the increased yield of 5HS-7DS.7DL/Mv9kr1/MvBodri in comparison with 5HS-7DS.7DL/Mv9kr1, especially under high-input conditions, indicating the positive effect of the advanced wheat (Mv Bodri) genetic background. Further field trials using a larger plot area/genotype will be needed for a more exact comparison of yield parameters in 5HS-7DS.7DL/Mv9kr1/MvBodri and Mv Bodri.Wheat genotype Mv Bodri was found to have lower plant height than Mv9kr1, which could be related to the fact that Mv Bodri carries the mutant allele of the semi-dwarfing gene RhtD1b on the short arm of 4D [46-48]. However, the deletion of the terminal region of 7DS in the translocation genotypes may also result in shorter plants. Khlestkina et al. [49] mapped the Ent-kaurenoic acid oxidase-coding (KAO) genes determining the gibberellin biosynthesis pathway and identified the KAO-D1 gene on the terminal segment of 7DS. Later, Kruppa et al. [23] reported that the two microsatellite markers (Xgwm1258, Xgwm1250) flanking the KAO-D1 locus were missing in the 5HS-7DS.7DL/Mv9kr1 genotype. Thus, the absence of the terminal region of the 7DS chromosome arm and consequently the absence of the KAO-D1 gene may also contribute to the reduced plant height of 5HS-7DS.7DL/Mv9kr1/MvBodri.
Conclusions
The improved tillering ability, together with the similar or better yield components under high- or low-input cultivation environments, respectively, indicate that the 5HS-7DS.7DL translocation in the Mv Bodri genetic background has small or negligible disadvantageous effects relative to the parental wheat Mv Bodri, which makes it a promising genotype for use in crossing and selection programs aimed at wheat improvement.The exact size of the translocation was determined using in situ hybridization and molecular markers. As the new 5HS-7DS.7DL/Mv9kr1/MvBodri translocation, representing 74% of the whole 5HS arm, has stable inheritance in the wheat genetic background, this work represents an important step forward in the integration of the extremely instable barley chromosome 5H, carrying potential alleles for abiotic stress tolerance, into wheat breeding programs. The new EST-derived markers will be useful in pre-breeding programs to select wheat genotypes with introgressed 5HS chromatin or to identify genotypes with a shortened 5HS segment.Altogether, the agronomic performance of the translocation line was improved by crossing it with a high-yielding wheat cultivar and the 5HS segment had a positive effect on tillering ability, which will be further tested in field experiments in the future. The new translocation line promise to accelerate functional genomic studies on barley chromosome 5H and the new molecular markers will support pre-breeding and breeding research on wheat, which will be required to meet the future challenges of food security and sustainable agriculture.
Authors: S Hudakova; W Michalek; G G Presting; R ten Hoopen; K dos Santos; Z Jasencakova; I Schubert Journal: Nucleic Acids Res Date: 2001-12-15 Impact factor: 16.971
Authors: M I Vales; C C Schön; F Capettini; X M Chen; A E Corey; D E Mather; C C Mundt; K L Richardson; J S Sandoval-Islas; H F Utz; P M Hayes Journal: Theor Appl Genet Date: 2005-11-15 Impact factor: 5.699
Authors: Klaus F X Mayer; Mihaela Martis; Pete E Hedley; Hana Simková; Hui Liu; Jenny A Morris; Burkhard Steuernagel; Stefan Taudien; Stephan Roessner; Heidrun Gundlach; Marie Kubaláková; Pavla Suchánková; Florent Murat; Marius Felder; Thomas Nussbaumer; Andreas Graner; Jerome Salse; Takashi Endo; Hiroaki Sakai; Tsuyoshi Tanaka; Takeshi Itoh; Kazuhiro Sato; Matthias Platzer; Takashi Matsumoto; Uwe Scholz; Jaroslav Dolezel; Robbie Waugh; Nils Stein Journal: Plant Cell Date: 2011-04-05 Impact factor: 11.277
Authors: Klaus F X Mayer; Stefan Taudien; Mihaela Martis; Hana Simková; Pavla Suchánková; Heidrun Gundlach; Thomas Wicker; Andreas Petzold; Marius Felder; Burkhard Steuernagel; Uwe Scholz; Andreas Graner; Matthias Platzer; Jaroslav Dolezel; Nils Stein Journal: Plant Physiol Date: 2009-08-19 Impact factor: 8.340
Authors: Edina Türkösi; Eva Darko; Marianna Rakszegi; István Molnár; Márta Molnár-Láng; András Cseh Journal: PLoS One Date: 2018-11-05 Impact factor: 3.240