Literature DB >> 29862291

Tm-Shift Detection of Dog-Derived Ancylostoma ceylanicum and A. caninum.

Yeqi Fu1, Mingwei Wang1, Xinxin Yan1, Auwalu Yusuf Abdullahi1,2, Jianxiong Hang1, Pan Zhang1, Yue Huang1, Yunqiu Liu1, Yongxiang Sun1, Rongkun Ran1, Guoqing Li1.   

Abstract

To develop a Tm-shift method for detection of dog-derived Ancylostoma ceylanicum and A. caninum, three sets of primers were designed based on three SNPs (ITS71, ITS197, and ITS296) of their internal transcribed spacer 1 (ITS1) sequences. The detection effect of the Tm-shift was assessed through the stability, sensitivity, accuracy test, and clinical detection. The results showed that these three sets of primers could distinguish accurately between A. ceylanicum and A. caninum. The coefficient of variation in their Tm values on the three SNPs was 0.09% and 0.15% (ITS71), 0.18% and 0.14% (ITS197), and 0.13% and 0.07% (ITS296), respectively. The lowest detectable concentration of standard plasmids for A. ceylanicum and A. caninum was 5.33 × 10-6 ng/μL and 5.03 × 10-6 ng/μL. The Tm-shift results of ten DNA samples from the dog-derived hookworms were consistent with their known species. In the clinical detection of 50 fecal samples from stray dogs, the positive rate of hookworm detected by Tm-shift (42%) was significantly higher than that by microscopic examination (34%), and the former can identify the Ancylostoma species. It is concluded that the Tm-shift method is rapid, specific, sensitive, and suitable for the clinical detection and zoonotic risk assessment of the dog-derived hookworm.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 29862291      PMCID: PMC5971263          DOI: 10.1155/2018/7617094

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Hookworms are common intestinal parasites distributed globally, which can cause serious harm to the health of dogs, cats, and human beings. There are four species of hookworms, that is, Ancylostoma caninum, A. ceylanicum, A. braziliense, and Uncinaria stenocephala, that can infect dogs [1]. According to a recent survey, stray dogs are infected mainly by A. ceylanicum and A. caninum in China [2]. It was reported that A. ceylanicum has become the second most common species of hookworm that can infect humans in Asia [3, 4], especially in Southeast Asian countries such as China [5, 6], Japan [7], Malaysia [8], Laos [9], Thailand [10], and India [11]. Occasionally, A. caninum can reach adulthood in people [1]. These two hookworms are zoonotic parasites that can parasitize the host's intestinal tract and cause severe symptoms such as intestinal bleeding, anemia, malnutrition, and dermatitis [12, 13]. Therefore, it is very important to establish a rapid and accurate identification method for the two dog-derived hookworms for the prevention and control of hookworm disease. Fecal examination is a traditional method for detecting hookworms, but it is easily missed under mild infection. Because of morphological similarities of different hookworm eggs, it is difficult to identify them only by their appearance. Presently, many molecular detection technologies have been applied to the identification of hookworms, such as specific polymerase chain reaction (PCR), multiplex polymerase chain reaction (multi-PCR), restriction fragment length polymorphism (RFLP), and high resolution melting (HRM) [14-16]. However, there are still some shortcomings, such as being unable to detect a large quantity of samples at the same time, complicated operation, and high cost. Single nucleotide polymorphism (SNP) has become a molecular genetic marker of the third generation after RFLP and microsatellite sequence (MS) [17, 18]. The Tm-shift based on the SNP is a new molecular detection method, where two specific primers and a reverse primer are designed as follows: the 3′-end of specific primer binds to SNP loci, and two GC-rich sequences with unequal length and no pairing with the template are added at the 5′-end, respectively. Then, PCR products of samples are detected according to different peaks of melting curve in different Tm values [19]. The Tm-shift method can satisfy the high-throughput research and has efficient, accurate, and inexpensive advantages [20]. So far, this method has been applied in many fields including medicine, microbiology, and aquatic biology [21-23]. Recently, we established Tm-shift genotyping method for detection of cat-derived Giardia lamblia assemblages A and F [24], which has developed a new genotyping method for veterinary parasitic protozoa. This study developed a Tm-shift method for detecting A. ceylanicum and A. caninum from dogs based on three SNP loci of rDNA ITS1 sequences of two hookworms, in order to establish a rapid and accurate method for identifying the species of dog-derived hookworms which could provide a new technical means for clinical detection of hookworms and zoonotic risk assessment.

2. Materials and Methods

2.1. Source of Samples

Adult A. ceylanicum and A. caninum samples were isolated and identified by Liu et al. [2, 6], preserved in 75% alcohol, and stored in our laboratory. Fecal samples were collected from stray dogs of pet shelters in Shantou, Foshan, and Shaoguan districts of Guangdong province in China, preserved in 2.5% potassium dichromate, and stored at −20°C for use.

2.2. Genomic DNA Extraction

The adult hookworms preserved were repeatedly washed with double-distilled water (ddH2O), and total genomic DNA was extracted using the Wizard® SV Genomic DNA Purification System (Promega, Guangzhou, China) according to the manufacturer's protocols. All clinical fecal samples were dissolved in ddH2O and then pretreated with 5 cycles of heating at 100°C for 5 min, followed by immediate freezing at −80°C for 5 min. Genomic DNA of clinical fecal samples was extracted using Stool DNA extraction kit (Omega, Guangzhou, China) according to the manufacturer's protocols. Extracted DNAs were then stored at −20°C for use.

2.3. PCR Amplification of ITS1 Sequence

The ITS1 sequences of A. ceylanicum and A. caninum were amplified using a forward primer AF (5′-CTTTGTCGGGAAGGTTGG-3′) and a reverse primer AR (5′-TTCACCACTCTAAGCGTCT-3′) designed by Liu et al. [15]. The predictive amplification fragment was 404 bp. Polymerase chain reactions were performed in 25 μL, including 12.5 μL of Premix Ex-Taq polymerase (TaKaRa, Dalian, China), 9.5 μL of ddH2O, 0.5 μL of each primer AF/AR (50 μmol/L), and 2 μL of DNA sample. PCR cycling parameters were as follows: 1 cycle at 94°C for 5 min and then 35 cycles at 94°C for 30 sec, at 61.5°C for 30 sec, and at 72°C for 45 sec, followed by 1 cycle at 72°C for 7 min. The PCR products were analysed by gel electrophoresis in 1.5% agarose gels, stained with 0.2 mg/ml ethidium bromide, and visualized on a UV transilluminator.

2.4. Preparation of Standard Plasmids

The purified PCR products were cloned in Escherichia coli and connected with pMD18-T (TakaRa, Dalian, China) and then transferred into DH5α Competent Cells (TaKaRa, Dalian, China). Positive clones were screened by bacterial PCR and sent to Shenggong Corporation (Shanghai, China) for sequencing. The plasmid DNAs were extracted using the Plasmid Kit (Omega, Guangzhou, China). These plasmids containing ITS1 sequence of A. ceylanicum and A. caninum were named AceP and AcaP, respectively. The A260/A280 value and concentration of plasmids (1 μL) were measured using ultra-micro-spectrophotometer, where A260/A280 value and optimal concentration should be 1.8~2.0 and 50 ng/μL. These plasmids were stored at −20°C for use.

2.5. Establishment of Tm-Shift Method Based on SNP

Three sets of Tm-shift primers (including two forward specific primers and one common reverse primer) based on three SNPs (ITS71, ITS197, and ITS296) were designed by software Primer Premier 5.0, referencing to two sequences (KM066110.1, LC177192.1) downloaded from GenBank. Their sequence composition and predictive amplification fragment are shown in Table 1. The above-mentioned primers were synthesized by Shenggong Corporation (Shanghai, China), diluted with sterile double-distilled water at a final concentration of 10 pmol/μL, and stored at −20°C for use. PCR amplification and Tm-shift reaction were performed once in Rotor-Gene Q. The reaction system was performed in 20 μL, including 10 μL of SYBR®Premix Ex-Taq™ II (2x), 0.4 μL of long-tail primer, 0.4 μL of short-tail primer, 0.8 μL of common reverse primer, 7.4 μL of ddH2O, and 1.0 μL of plasmid. PCR cycling parameters were as follows: initial denaturation at 95°C for 5 min and then 40 cycles at 95°C for 10 sec and 63°C for 30 sec. Melting process was from 70 to 95°C at the rate of 0.5°C/sec.
Table 1

Primers for Tm-shift method based on five SNPs.

PrimerNucleotide sequence (5′–3′)Product length (bp)
ITS71TF(Aca) GCGGCGCTATGTGCAGCAAGAGT
ITS71CF(Ace) GCGGGCAGGGCGGGCTATGTGCAGCAAGAGC113
ITS71RACAAGCAGTAAGGCGGCATTCA
ITS197GF(Aca) GCGGCGTGAGCATTAGGCTAACGCCTG
ITS197AF(Ace) GCGGGCAGGGCGGGTGAGCATTAGGCTAACGCCTA114
ITS197RACGATTCTGCAAACATTAAACGTAAAAAGT
ITS296TF(Ace) GCGGCGTTTGCAGAATCGTGACTTT
ITS296GF(Aca) GCGGGCAGGGCGGGTTTGCAGAATCGTGACTTG127
ITS296RTTCACCACTCTAAGCGTCT
ITS26AF(Aca) GCGGCGGAAGGTTGGGAGTATCA
ITS26GF(Ace) GCGGGCAGGGCGGGGAAGGTTGGGAGTATCG121
ITS26RGTCTAAAGCTCAGCGAAAC
ITS48AF(Aca) GCGGCGCCGTTACAGCCCTACGTA
ITS48GF(Ace) GCGGGCAGGGCGGGCCGTTACAGCCCTACGTG116
ITS48RATGCAATGCTCATCAAGTC

The GC tails are bold and underlined. Primers at ITS26 and ITS48 failed to distinguish between A. ceylanicum and A. caninum.

2.6. Stability, Sensitivity, and Accuracy Test

The detection effect of the Tm-shift was assessed through the stability, sensitivity, and accuracy test. We tested the reproducibility of two known standard plasmids (AceP and AcaP). Intra-assays were tested seven times, and interassays were tested three times for each plasmid. For detection of the sensitivity of the Tm-shift method, two standard plasmids (AceP and AcaP) were diluted ten times and detected according to the concentration of 1 : 10~1 : 108. To evaluate the Tm-shift method's accuracy, we detected ten samples with known hookworm species. All reaction system and cycling parameters were the same as mentioned above.

2.7. Clinical Detection

Fifty fecal samples from the stray dogs were examined by the flotation technique with saturated zinc sulfate and the Tm-shift method. Tm-shift classification results were further confirmed by DNA sequencing.

3. Results

3.1. Amplification of ITS1 Fragment and Preparation of Plasmids

The amplified ITS1 fragment from two genomic DNAs of dog-derived A. ceylanicum and A. caninum was 404 bp long (Figure 1) and the generated sequence data were submitted to GenBank (accession numbers: MG733994, MG733993). BLAST analysis indicated the highest similarity (100%) with A. ceylanicum from Japan (LC036567) and the highest similarity (99%) with A. caninum from Australia (KP844730). Thus, two hookworms were identified as A. ceylanicum and A. caninum. The A260/A280 values of positive plasmids AceP and AcaP were between 1.8 and 2.0, respectively. Their concentrations were 53.3 ng/μL and 50.3 ng/μL, respectively.
Figure 1

PCR amplification of the ITS1 sequence of two hookworms. MDL-500 DNA marker; 1: positive control; 2: A. ceylanicum; 3: A. caninum; 4: negative control.

3.2. Detection of qPCR-Tm-Shift

The standard curves of Tm-shift based on ITS71, ITS197, and ITS296 for standard plasmid AceP and AcaP are shown in Figure 2. The result showed that Tm-shift method based on three SNPs could distinguish between A. ceylanicum and A. caninum. Software analysis showed that the Tm values of AceP (A. ceylanicum) and AcaP (A. caninum) in three sets of primers were 88.0°C and 86.0°C (ITS71), 86.0°C and 85.0°C (ITS197), and 84.0°C and 85.0°C (ITS296), respectively.
Figure 2

Standard curves of Tm-shift for two hookworm standard plasmids based on ITS71 (a), ITS197 (b), and ITS296 (c). AceP: A. ceylanicum standard plasmid; AcaP: A. caninum standard plasmid; Neg: negative control.

3.3. Stability, Sensitivity, and Accuracy

The stability test results are shown in Table 2. In primer ITS71, the coefficient of variation (CV) of AceP and AcaP melting temperature (Tm) was 0.15 and 0.09%. In primer ITS197, the CV of AceP and AcaP melting temperature was 0.14 and 0.18%. And in primer ITS296, the CV of AceP and AcaP melting temperature was 0.07 and 0.13%. When AceP and AcaP samples were diluted to 1 : 107 (5.33 × 10−6 ng/μL and 5.03 × 10−6 ng/μL), the Tm-shift method was still able to identify both of them. However, when the samples were diluted to 1 : 108, all of them could not be determined (Table 3). A total of ten known hookworm samples from dogs were randomly selected and detected. The Tm-shift detection results based on ITS71, ITS197, and ITS296 were identical to their known hookworm species (Table 4).
Table 2

The stability of Tm-shift method.

RepeatITS71 (Tm)ITS197 (Tm)ITS296 (Tm)
AcaP AcePAcaP AcePAcaP AceP
First (n = 7)86.1 ± 0.1°C88.0 ± 0.1°C85.1 ± 0.1°C85.9 ± 0.1°C85.0 ± 0.1°C84.0 ± 0.1°C
Second (n = 7)86.1 ± 0.2°C88.1 ± 0.1°C85.1 ± 0.1°C85.9 ± 0.1°C85.0 ± 0.1°C84.0 ± 0.2°C
Third (n = 7)86.1 ± 0.1°C87.9 ± 0.1°C85.1 ± 0.2°C85.9 ± 0.1°C85.1 ± 0.1°C84.1 ± 0.1°C
Average (n = 21)86.10°C88.00°C85.10°C85.90°C85.03°C84.03°C
CV0.15%0.09%0.14%0.18%0.07%0.13%
Table 3

The sensitivity of Tm-shift method.

DilutionITS71 (Tm)ITS197 (Tm)ITS296 (Tm)
AcaPAcePAcaPAcePAcaPAceP
1 : 10186.1°C88.0°C85.0°C86.0°C85.0°C83.9°C
1 : 10285.9°C88.1°C85.0°C86.0°C85.0°C84.0°C
1 : 10386.0°C88.1°C85.1°C86.0°C85.0°C84.0°C
1 : 10486.0°C88.0°C85.0°C86.0°C85.0°C84.0°C
1 : 10586.1°C88.1°C84.9°C86.1°C85.0°C83.9°C
1 : 10686.1°C88.0°C85.1°C86.1°C84.9°C83.9°C
1 : 10786.0°C88.0°C85.1°C86.1°C85.0°C83.9°C
1 : 108

—: not detected.

Table 4

The accuracy of Tm-shift method.

Sample SpeciesITS71 (Tm)ITS197 (Tm)ITS296 (Tm)GenBank
D22 A. caninum 86.0°C85.0°C85.0°CKC755016
D55 A. ceylanicum 88.0°C86.0°C84.0°CKC755015
D60 A. ceylanicum 88.0°C85.9°C83.9°CKC755020
D74 A. ceylanicum 88.0°C86.0°C84.0°CKC755021
D23 A. caninum 86.1°C85.0°C85.1°CKC755017
D28 A. caninum 86.0°C85.1°C85.0°CKC755018
D34 A. caninum 86.1°C85.1°C85.0°CKC755019
D79 A. ceylanicum 88.0°C86.0°C84.0°CKC755022
D23 A. ceylanicum 87.9°C86.0°C84.0°CKF279132
D32 A. ceylanicum 88.0°C86.0°C84.0°CKF279133

Samples D22, D23, D28, D34, D55, D60, D74, and D79 were isolated and identified by Liu et al. [2]. Samples G23 and G32 were isolated and identified by Liu et al. [6].

3.4. Clinical Detection

Seventeen out of fifty fecal samples from dogs were microscopically positive for hookworm but twenty-one of them were positive for hookworm using Tm-shift method, where fourteen were identified as A. ceylanicum and seven as A. caninum. The melting curves and detection results are shown in Figure 3. All detection results were identical to their sequencing results.
Figure 3

Melting curves of Tm-shift based on ITS71 (a), ITS197 (b), and ITS296 (c) and detection results for 21 hookworm-positive samples.

4. Discussion

Dogs are important reservoir host to zoonotic hookworms A. ceylanicum and A. caninum. Genetic evolution analysis indicated that dog-derived A. ceylanicum and human-derived A. ceylanicum from China [25], Malaysia [26], Kampuchea [27], and India [13] have the closest genetic relationship, and the infection rate of A. ceylanicum between humans and dogs had a strong correlation in the same region, as well as confirming the possibility of transmission of A. ceylanicum between humans and animals [28]. A. caninum mainly infects dogs and cats and sometimes infects people. Dogs are both companion animals for humans and susceptible animals to zoonotic hookworms. With the development of economy and improvement of life quality, the number of people raising dogs has been increasing. Therefore, the establishment of Tm-shift method for detection of A. ceylanicum and A. caninum has important significance in the prevention and control of zoonotic ancylostomiasis. Currently, the species identification of hookworm is mainly dependent on molecular means such as specific PCR, multi-PCR, RFLP, and HRM [14-16]. However, there are still some limitations. The conventional PCR can only detect a single pathogen. Although multi-PCR can simultaneously detect multiple pathogens, it is necessary to design more primers and the PCR conditions are demanding. The RFLP technology can only select specific endonuclease, and the operation is tedious and time-consuming, with low sensitivity for false negatives. HRM is similar to the Tm-shift method through test of the melting curve of PCR products. But it is based on the different GC content and base complementarity in the same DNA sequence to detect samples. When difference bases are counteracted in the sequence, two peaks of melting curve are difficult to distinguish and easily cause detection failure [29]. Compared with specific PCR, multi-PCR, and RFLP, the Tm-shift method can detect 36 or 72 samples simultaneously. Its closed tube operation can greatly reduce the risk of contaminated samples. Also, there is no need to use the poisonous reagent ethidium bromide (EB), which thus can reduce pollution to the environment and ensure safety of the researchers. The Tm-shift method has clear price advantage compared with HRM, because of the use of instruments for ordinary fluorescence PCR and fluorescent dyes for ordinary SYBR Green I rather than saturation dyes Eva Green and LC Green. In addition, the detection efficiency is improved through amplification of the target fragment by two-step method. Although the Tm-shift detection method has its unique advantages, it also has some limitations. It has higher demand of two specific primers, whose Tm value should be 59~62°C, and their length should be controlled in 15~22 bp. In order to give better amplification efficiency of Taq polymerase, the gap of the Tm values between the reverse primer and the specific primers (before joining at the 5′-end sequence) must be maintained between 4 and 5°C. It is due to the high screening conditions of specific primers that some SNP loci failed to design suitable primers. Among five SNP loci (Table 1) originally designed in this experiment, two loci (ITS26 and ITS48) failed to distinguish between A. ceylanicum and A. caninum, thus leading to the failure of detection. Another three SNP loci (ITS71, ITS197, and ITS296) could distinguish between two species of hookworms. The Tm value of the melting curve between A. ceylanicum and A. caninum differed at 2°C on ITS71 but 1°C on ITS197 and ITS296. The ITS71 locus identification had the best effect. Among 50 dog-derived fecal samples detected, 21 samples were positive for hookworms by Tm-shift method (14 A. ceylanicum and 7 A. caninum), which had 4 more positive samples than microscopic examination (17 positive samples), and can accurately identify the species of hookworms from stray dogs. In conclusion, Tm-shift method based on three SNP loci of ITS1 sequences of A. ceylanicum and A. caninum was used for the first time for their classification. The successful identification of two hookworms indicates that the method is specific, sensitive, economical, practical, and safe, which can provide a new technical means for clinical detection of hookworm and zoonotic risk assessment.
  28 in total

1.  High-throughput SNP genotyping by single-tube PCR with Tm-shift primers.

Authors:  Jun Wang; Karen Chuang; Mandeep Ahluwalia; Sarika Patel; Nanette Umblas; Daniel Mirel; Russell Higuchi; Soren Germer
Journal:  Biotechniques       Date:  2005-12       Impact factor: 1.993

Review 2.  High-resolution DNA melting analysis for simple and efficient molecular diagnostics.

Authors:  Gudrun H Reed; Jana O Kent; Carl T Wittwer
Journal:  Pharmacogenomics       Date:  2007-06       Impact factor: 2.533

3.  Molecular identification of human hookworm infections in economically disadvantaged communities in Peninsular Malaysia.

Authors:  Romano Ngui; Lee Soo Ching; Tan Tiong Kai; Muhammad Aidil Roslan; Yvonne A L Lim
Journal:  Am J Trop Med Hyg       Date:  2012-05       Impact factor: 2.345

4.  Use of high-resolution melting and melting temperature-shift assays for specific detection and identification of Bacillus anthracis based on single nucleotide discrimination.

Authors:  Sylviane Derzelle; Christiane Mendy; Séverine Laroche; Nora Madani
Journal:  J Microbiol Methods       Date:  2011-08-31       Impact factor: 2.363

5.  Soil-transmitted helminthiasis in Laos: a community-wide cross-sectional study of humans and dogs in a mass drug administration environment.

Authors:  James V Conlan; Boualam Khamlome; Khamphouth Vongxay; Aileen Elliot; Louise Pallant; Banchob Sripa; Stuart D Blacksell; Stanley Fenwick; R C Andrew Thompson
Journal:  Am J Trop Med Hyg       Date:  2012-04       Impact factor: 2.345

Review 6.  Ancylostoma ceylanicum, a re-emerging but neglected parasitic zoonosis.

Authors:  Rebecca J Traub
Journal:  Int J Parasitol       Date:  2013-08-19       Impact factor: 3.981

7.  Molecular identification of Ancylostoma caninum isolated from cats in southern China based on complete ITS sequence.

Authors:  Yuanjia Liu; Guochao Zheng; Muhamd Alsarakibi; Xinheng Zhang; Wei Hu; Pengyun Lu; Liqin Lin; Liping Tan; Qin Luo; Guoqing Li
Journal:  Biomed Res Int       Date:  2013-09-23       Impact factor: 3.411

8.  Simple fecal flotation is a superior alternative to guadruple Kato Katz smear examination for the detection of hookworm eggs in human stool.

Authors:  Tawin Inpankaew; Fabian Schär; Virak Khieu; Sinuon Muth; Anders Dalsgaard; Hanspeter Marti; Rebecca J Traub; Peter Odermatt
Journal:  PLoS Negl Trop Dis       Date:  2014-12-18

9.  Rapid detection and identification of human hookworm infections through high resolution melting (HRM) analysis.

Authors:  Romano Ngui; Yvonne A L Lim; Kek Heng Chua
Journal:  PLoS One       Date:  2012-07-26       Impact factor: 3.240

10.  The global burden of disease study 2010: interpretation and implications for the neglected tropical diseases.

Authors:  Peter J Hotez; Miriam Alvarado; María-Gloria Basáñez; Ian Bolliger; Rupert Bourne; Michel Boussinesq; Simon J Brooker; Ami Shah Brown; Geoffrey Buckle; Christine M Budke; Hélène Carabin; Luc E Coffeng; Eric M Fèvre; Thomas Fürst; Yara A Halasa; Rashmi Jasrasaria; Nicole E Johns; Jennifer Keiser; Charles H King; Rafael Lozano; Michele E Murdoch; Simon O'Hanlon; Sébastien D S Pion; Rachel L Pullan; Kapa D Ramaiah; Thomas Roberts; Donald S Shepard; Jennifer L Smith; Wilma A Stolk; Eduardo A Undurraga; Jürg Utzinger; Mengru Wang; Christopher J L Murray; Mohsen Naghavi
Journal:  PLoS Negl Trop Dis       Date:  2014-07-24
View more
  1 in total

1.  Establishment of a Tm-shift Method for Detection of Cat-Derived Hookworms.

Authors:  Yeqi Fu; Yunqiu Liu; Asmaa M I Abuzeid; Yue Huang; Xue Zhou; Long He; Qi Zhao; Xiu Li; Jumei Liu; Rongkun Ran; Guoqing Li
Journal:  Korean J Parasitol       Date:  2019-02-26       Impact factor: 1.341

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.