| Literature DB >> 29805213 |
K Rathore1, B Joseph1, D K Sharma1, A Gaurav2, S K Sharma3, M Milind1, P Patel1, C Prakash4, L Singh5.
Abstract
AIM: This study was designed to evaluate the potential of the use of multiplex polymerase chain reaction (PCR) as an alternative to conventional antibiotic sensitivity test.Entities:
Keywords: Staphylococcus aureus; antimicrobial resistance; genotype; phenotype
Year: 2018 PMID: 29805213 PMCID: PMC5960787 DOI: 10.14202/vetworld.2018.474-479
Source DB: PubMed Journal: Vet World ISSN: 0972-8988
Details of primers used in the present study.
| Oligo name | Sequence 5’‑->3’ | Gene | Tm (°C) | GC-content (%) | Amplicon size (bp) |
|---|---|---|---|---|---|
| 5’AAAATCGATGGTAAAGGTTGGC3’ | 56.5 | 40.90 | 532 | ||
| mecA (reverse) | 5’AGTTCTGCAGTACCGGATTTGC3’ | 60.3 | 50 | ||
| 5’TAATCCAAGAGCAATAAGGGC3’ | 55.9 | 42.90 | 227 | ||
| 5’GCCACACTATCATAACCACTA3’ | 55.9 | 42.90 | |||
| 5’GTAGCGACAATAGGTAATAGT3’ | 54 | 38.10 | 360 | ||
| 5’TAATCGTGGAATACGGGTTTG3’ | 55.9 | 42.90 | |||
| 16s 1 (forward) | 5’CAGCTCGTGTCGTGAGATGT3’ | 16s rRNA | 59.4 | 55 | 420 |
| 16s 2 (reverse) | 5’AATCATTTGTCCCACCTTCG3’ | 55.3 | 45 | ||
| 5’AATCTTTGTCGGTACACGATATTCTTCACG3’ | 64 | 40 | 107 | ||
| 5’CGTAATGAGATTTCAGTAGATAATACAACA3’ | 59.9 | 30 |
S. aureus=Staphylococcus aureus
PCR conditions for S. aureus-specific sequencesbased characterization.
| Gene (size) | PCR conditions | ||
|---|---|---|---|
| Denaturation | Annealing | Extension | |
| 94°C for 1 min | 55°C for 1 min | 72°C for 1 min | |
S. aureus=Staphylococcus aureus, PCR=Polymerase chain reaction
Figure-1Polymerase chain reaction amplification of Staphylococcus aureus-specific sequence (107 bp).
Phenotypic antibiotic resistance pattern of S. aureus isolates from various clinical samples using 11 commonly used antibiotics in veterinary field conditions by Kirby–Bauer disc diffusion method.
| Phenotypic antibiotic sensitivity pattern | |
|---|---|
| 373 | AMC, CTR, CIP, MET, AMP, TET, GEN, S, Nx, AK |
| 413 | MET, AMP, C |
| 415 | AMC, CTR, CIP, TET, GEN, S, Nx, AK |
| 417 | AMC |
| 418 | MET, TET |
| 419 | AMC, CTR, CIP, MET, TET, GEN, S, Nx, AK |
| 423 | AMC, CTR, MET, TET, S |
| 424 | AMC, CTR, CIP, MET, TET, GEN, S, Nx, AK |
| 427 | AMC, CTR, CIP, MET, AMP, TET, GEN, S, Nx, AK |
| 430 | MET, AMP |
| 431 | AMP |
| 432 | CTR, CIP, MET, AMP, C, TET, GEN, S |
| 433 | CTR, MET, AMP |
| 496 | AMC, CTR, CIP, MET, AMP, C, TET, S |
| 502 | AMC, CTR, CIP, MET, AMP, TET, Nx |
| 508 | AMC, CTR, CIP, MET, C, TET, GEN, S, Nx, AK |
| 510 | AMC, MET, AMP, C |
| 515 | AMC, CTR, MET, AMP, TET, GEN, S, Nx |
| 532 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 534 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 536 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 537 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 538 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 541 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 542 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 543 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 544 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 545 | CTR, CIP, MET, TET, Nx |
| 555 | AMC, CTR, MET, AMP, C, TET, S, Nx |
| 556 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 557 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 558 | AMC, CTR, CIP, MET, AMP, C, TET, S |
| 559 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 560 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 561 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
| 562 | AMC, CTR, CIP, MET, AMP, C, TET, GEN, S, Nx, AK |
S. aureus=Staphylococcus aureus, AMC=Amoxyclav, CTR=Ceftriazone, CIP=Ciprofoxacin, MET=Methicillin, AMP=Ampicillin, C=Chloramphenicol, TET=Tetracycline, GEN=Gentamicin, S=Streptomycin, Nx=Norfloxacin, AK=Amikacin
Figure-2Genotypic characterization of antibiotic resistance pattern of different isolates of Staphylococcus aureus against methicillin, aminoglycosides, and tetracycline using multiplex polymerase chain reaction. Lane 1-12: Genotype of antibiotic resistance pattern of S. aureus isolated number 373, 415, 424, 432, 536, 538, 541, 544, 556, 558, 559, and 561, respectively, Lane M: 100 bp ladder.
Phenotype of antibiotic resistance and genes detected by multiplex PCR in S. aureus isolates recovered in the present study.
| Phenotype of resistance pattern against methicillin, aminoglycoside, and tetracycline | Genes detected by multiplex PCR for methicillin, aminoglycoside, and tetracycline | |
|---|---|---|
| 373 | MET, GEN, S, TET | |
| 415 | GEN, S, TET | |
| 424 | MET, GEN, S, TET | |
| 432 | MET, GEN, S, TET | |
| 536 | MET, GEN, S, TET | |
| 538 | MET, GEN, S, TET | |
| 541 | MET, GEN, S, TET | |
| 544 | MET, GEN, S, TET | |
| 556 | MET, GEN, S, TET | |
| 558 | MET, GEN, S | |
| 559 | MET, GEN, S, TET | |
| 561 | MET, GEN, S, TET |