Are zoonotic Staphylococcus pseudintermedius strains a growing threat for humans?

Staphylococcus pseudintermedius is a species often isolated from animals, as a common element of their microbiota or an agent of infection, and from people associated with an animal habitat, including owners of home pets-dogs and cats. As with many other species, adaptation of these bacteria to the human body can occur, and they become important human pathogens. 59 S. pseudintermedius strains were investigated in this study to determine the factors contributing to human body colonization: inhibition growth of human skin residents isolated from human skin (Staphylococcus epidermidis, Corynebacterium spp., Cutibacterium acnes (formerly Propionibacterium acnes)), biofilm formation, and the presence of ten genes encoding infection-promoting features (including ebpS, spsE, lukS, lukF, pvl, lip, hlgA, hlgB). The ability of human skin to be colonized and the presence of genes that promote the development of skin infections showed the significant potential of the studied strains in their adaptation to the host. However, while a comparison of the characteristics of animal strains and those isolated from human infections does not allow us to claim that we are the witnesses of the speciation of a new human pathogen, it does indicate their gradual adaptation to the human organism.

Introduction

Staphylococcus pseudintermedius belongs to the Staphylococcus intermedius group (SIG) which also comprises Staphylococcus intermedius and Staphylococcus delphini (Savini et al. 2013). These three coagulase-positive species are animal skin and mucous membrane commensals. S. pseudintermedius inhabits mainly companion animals such as pets (Jee et al. 2007; Kmieciak and Szewczyk 2017; Wladyka et al. 2015), but can also cause infections in animals (Międzobrodzki et al. 2010), most often otitis and skin infections (van Duijkeren et al. 2011). These bacteria have been also isolated from humans (Boost et al. 2011; Savini et al. 2014; Youn et al. 2014). They can be rare etiological factor of animal bite wound infections (Salina et al. 2015; Starlander et al. 2014; Windahl et al. 2015) but also more severe cases (Laurens et al. 2012; Riegel et al. 2011; Stegmann et al. 2010).

The transmission of microorganisms originally associated with animals to humans has been observed for centuries. The interspecies barriers separating animal species from humans are, e.g., tissue tropism, different cell receptors, differences between animal and human microbiota, health and immune status of them, different population dynamics and behavior of humans and animal, and abundance and spread of pathogens within and among species (Gortazar et al. 2014). After the adaptation process, animal pathogens gain more features that allow them to colonize human organisms and then cause serious diseases. Over time, they become recognized human pathogens (Wolfe et al. 2007). It is important to follow the changes of the original animal microorganisms in the context of current and future dangers to humans.

The aim of this study was to determine the features that could allow S. pseudintermedius to colonize human organism. The investigated strains were isolated from clinical specimens taken from pets and from humans. We examined the possibility of their settlement in the ecological niches alongside natural bacterial inhabitants of human skin, and evaluated the presence of genes that may play a role in the development of infections.

Materials and methods

S. pseudintermedius strains causing infections, 40 from dogs and 2 from cats treated in veterinary clinics and 17 strains from the inpatients (7) and outpatients (10) of a hospital in Łódź, were investigated. These strains had been collected in the period of 1 year. All strains in both groups were isolated from skin lesions (4 human and 9 canine strains), infected wounds (4 human, 1 feline, and 6 canine strains), bedsores (1 human and 2 canine strains), external ear infections (7 human, 1 feline, and 19 canine strains), ophthalmia (1 human and 3 canine strains), and laryngitis (1 canine strain). Strains were identified by the genetic method developed by Sasaki et al. (Sasaki et al. 2010). The reference strain was Staphylococcus pseudintermedius PCM 2791.

Phenotypic studies

Bacteria were grown on agar medium supplemented with 5% sheep blood. Hyaluronidase decomposition was studied using the method of Hart et al. (Hart et al. 2009). Biofilm formation was estimated in two colorimetric methods. The intensity of biofilm formation was assessed by crystalline violet (CV) staining according to Christensen et al. (Pompilio et al. 2015). The viability of the cells in the biofilm structure was tested by [2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] (XTT) reduction method of Pettit et al. (Pettit et al. 2005). The ability to produce bacteriocin-like inhibitory substances (BLIS) was investigated using the direct method according to Balusek et al. (Balusek and Hájek 1985; Wysocki et al. 2011). The activity of these substances was evaluated against bacteria that were residents of healthy skin of young people. Ten strains from healthy skin belonging to the genera Staphylococcus, Corynebacterium, and Cutibacterium (formerly Propionibacterium) (Scholz and Kilian 2016) from our own collection were used for this study.

Molecular research

In order to search for genes encoding virulence factors associated with colonization, primers recommended in literature and newly designed ones were used to PCR (polymerase chain reaction). The first ones were used to detect genes encoding: leukotoxin Luk-I S (lukS) and F (lukF) components, Panton-Valentine leucocidin (pvl), exfoliative toxin SIET (siet), toxic shock syndrome toxin (tst), enterotoxin A (sea), and enterotoxin C (sec) (Futagawa-Saito et al. 2004; Garbacz et al. 2013; Lina et al. 1999). The primers of the own project are shown in Table 1.

Table 1

Projected primers

Gene	Protein/toxin	Primer	Sequence (5′ → 3′)	Size of amplicons
ebpS	Elastin-binding protein	ebpS-F	AGACGCCACAGAAAAAGA	1040 bp
		ebpS-R	GCAGATTGACCTTGTTGA
spsE	Fibrinogen-/fibronectin-binding protein	spsE-F	TTTCTCGTTTCTGGGCGT	1600 bp
		spsE-R	GCGTCTTCTGGTTATCGT
lip	Lipase	lip-F	GGAAAAGCAGCAGAAAGAA	1601 bp
		lip-R	GGGTGCTGTGATGAAATA
hlgA	γ-Hemolysin A component	hlgA-F	GTTCTTCCACTTATTACACC	718 bp
		hlgA-R	CACTTGTATCGCCTTTATC
hlgB	γ-Hemolysin B component	hlgB-F	GGGGGGCTAAGTATAATGT	475 bp
		hlgB-R	GCGCCATTTGGTTTATGT

The new primers were designed using the CLC Main Workbench 7.6 (QIAGEN), a program based on genome sequence analysis of strains deposited in Genbank:

Staphylococcus pseudintermedius ED99 (NC_017568.1)—primers for the ebpS, spsE, and lip genes;

Staphylococcus pseudintermedius HKU 10-03 (NC_014925.1)—primers for the hlgA and hlgB genes.

For PCR reactions with newly designed primers, conditions were as follows: initial denaturation at 94 °C for 2:30 min, 30 cycles (denaturation 0:30 min—94 °C; annealing 0:30 min—54 °C for detection of the genes ebpS, spsE, and lip or 56 °C for detection of genes hlgA and hlgB; elongation 1:00 min—72 °C) and final elongation 10:00 min—72 °C on a T Professional Basic Gradient Thermal Cycler (Biometra).

Results

All 42 animal S. pseudintermedius strains were able to form biofilm structures that were defined as strong or moderate production (respectively 20 and 22). Most commonly, the formation of thick biofilm detected by the CV method was associated with a high metabolic activity resulting in significant XTT reduction ranging from 35 to 67%. Strains from humans did not differ from those of animals in this regard (Table 2).

Table 2

Features of S. pseudintermedius strains predisposing them to human body colonization

Biofilm forming		Human skin microbiota suppression			Pathogenicity gene presence (number of strains)
CV method (number of strains)	Percentage of XTT reduction (median)	Staphylococcus epidermidis strains group:	Corynebacterium strains group:	Cutibacterium acnes strains group:	ebpS	spsE	lukS + lukF	pvl	hlgA + hlgB	lip	siet	tst	sea	sec
		- ZMF K22	- Corynebacterium sp. ZMF LP13	- ZMF P1
		- ZMF K210	- Corynebacterium sp. ZMF LB136	- ZMF P3
		- ZMF B84	- C. tuberculostearicum ZMF LA18	- ZMF R1
				- ZMF R2
Animal strains (42)
42	42%	22 (1)*	7 (1)	3 (1)	41	40	4	1	42	40	42	0	0	2
		8 (2)	2 (3)	1 (3)
		3 (3)	9 (21%)	5 (4)
		33 (79%)		9 (21%)
Human strains (17)
17	50%	6 (1)	2 (1)	1 (4)	17	17	2	1	17	17	17	0	0	3
		7 (2)
		1 (3)	2 (12%)	1 (6%)
		14 (82%)
All strains (59)
59	46%	47	11	10	58	57	6	2	59	57	59	0	0	5

*The number of strains of the given group suppressed by S. pseudintermedius strains is given in brackets

Almost 80% of S. pseudintermedius strains exhibited an inhibitory effect on human skin microbiota, with the highest on epidermal staphylococci. Strains from animals were more effective than those from humans at inhibiting the growth of coryneform and Cutibacterium spp. This antibacterial activity was detected in 21% animal strains, while only 12% human strains were active against Corynebacterium spp. and 6% against Cutibacterium spp. The ability to inhibit several strains of one species or genus was more frequently observed among animal strains (Table 2, data in parentheses).

We also searched for genes encoding substances important for the colonization, spread, and toxicity of these staphylococci. The presence of extracellular matrix binding proteins of host tissues (ebpS, spsE) and the lipase enhancing the colonization of the skin, as well as the gene encoding the epidermolytic toxin, were common in S. pseudintermedius strains. In all strains, γ-hemolysin genes, hlgA and hlgB, were present. Few strains had both genes encoding leukotoxin Luk-I components (lukS, lukF). None of the tested strains had toxic shock syndrome toxin (tst) or enterotoxin A (sea) genes. Single strains had the gene of enterotoxin C (sec) (two from animals, three from humans) and Panton-Valentine leucocidin pvl genes (one from animal, one from humans) and showed hyaluronic acid degradation (eight from animals, two from humans) (Table 2). This is the first report on pvl gene detection in S. pseudintermedius strains.

Discussion

Breaking the barrier protecting people from infections caused by animal strains must begin with the efficient colonization of human skin or mucous membranes. The tested S. pseudintermedius strains were capable of performing this process and they were able to effectively gain space on human skin by inhibiting the growth of bacteria that are its natural microbiota.

Our studies showed that S. pseudintermedius species has a potential for colonizing the human organism. Strains of this species possess phenotypical features and genes favoring staphylococcal pathogenicity to the skin. No significant differences were found between strains from animals or those that caused infections in humans that would indicate the adaptation of this species to a new host.

The acquisition of genes connected with human colonization may result from close contact between animals and their owners. This contact is certainly common in dogs and other domestic animals accompanying people as pets. Colonization of human skin also is interrelated with the ability of these staphylococci to form and live in biofilm structures. The acquisition of genes from human bacterial microbiota or pathogens can arise from rearrangement of genetic material and horizontal gene transfer (HTG) (Ambur et al. 2009). This may lead to the creation of new variants which are better adapted to a new host and their subsequent selection. We found a few strains that were better equipped than others.

Our results show the potential of the tested strains. S. pseudintermedius has a set of features that allow bacteria to infect humans and find a place among microbes on the skin of humans by inhibiting the growth of bacteria typical for this site.

Screening of the tested strains revealed the presence of toxin genes whose expression may contribute to the development of skin and subcutaneous tissue diseases. S. aureus Panton-Valentine leukocidin (PVL) is a factor of necrotic skin lesions (Barrio et al. 2006; Prévost et al. 1995). Its analogue in the SIG group is the Luk-I leukotoxin which exhibits a strong leukotoxic effect. The cytotoxic activity of bi-component leukotoxins and γ-hemolysin is manifested only when both components are synthesized (Szmigielski et al. 1998); both components was observed in most cases were the investigated strains possessed the genes.

SIET exfoliative toxin, which was detected in all of the tested strains, is involved in the etiopathogenesis of scaly and purulent skin infections (Terauchi et al. 2003). Lipase-producing strains can break down sebum, divesting the epidermis of an important antimicrobial agent, thus allowing effective colonization. Degradation of cell membrane lipids facilitates the spread of infection throughout the body (Hu et al. 2012). The gene lip encoding lipase was reported in almost all of the tested strains.

Our results indicate that a particular role in the pathogenesis of superficial infections may be played by the following: elastin binding protein EbpS, fibrinogen/fibronectin binding protein SpsE, lipase, exfoliative toxin SIET, and γ-hemolysin. The presence of these genes was commonly observed among S. pseudintermedius strains. Panton-Valentine leukocidin was detected only in two strains and it was the first time it was found in S. pseudintermedius. Our strains did not produce hyaluronidase, which enhances penetration through the deeper tissues of the host (Hart et al. 2013). Lack of toxic shock syndrome toxin (TSST-1) and staphylococcal enterotoxin genes which are superantigens reduce the chance of causing severe disease entities (Pinchuk et al. 2010). Enterotoxins A (SEA) and C (SEC) are a cause of food poisoning (STF). The toxin genes tst or sea were not present in the investigated S. pseudintermedius strains, although SEC is commonly found in other strains isolated from animals (Korpysa-Dzirba et al. 2012). The single occurrence of the sec gene in strains of this species from both the animals and humans indicates a potential risk of food poisoning.

It is difficult to determine how often S. pseudintermedius strains were previously isolated from clinical materials from humans and how frequently they are now isolated, as phenotypic identification of the species may be questionable. This is the largest study in Europe of S. pseudintermedius infections in humans. Most of the reports concern only single human strains although there is one study of 200 human isolates from south Japan (Bardiau et al. 2013). Many of the features we studied in human and animal strains were similar but some differences were found. It may be considered that this species is currently not a particular threat for humans but we showed the possibility of its settlement in the ecological niches alongside natural bacterial inhabitants of human skin and the presence of genes that may play a role in the development infections in humans. Further studies are needed to monitor change in phenotype and genotypic potential both of which may indicate transformation of S. pseudintermedius into a human pathogen.