| Literature DB >> 36032292 |
Zhihao Wang1,2, Long Guo1,2, Jun Li1,2, Jianji Li1,2, Luying Cui1,2, Junsheng Dong1,2, Xia Meng1,2, Chen Qian1,2, Heng Wang1,2.
Abstract
Canine bacterial keratitis is a common infection that can potentially threaten vision. Staphylococcus pseudintermedius (S. pseudintermedius) is an opportunistic pathogen that has been isolated from the canine conjunctival sac but there are only a few reports on the role of this bacterium in canine keratitis. This study focused on the distribution rate of S. pseudintermedius in the canine conjunctival sac, and the antibiotic resistance, biofilm-producing ability, and dissemination of virulence factors in strains of S. pseudintermedius isolated from healthy dogs and dogs with keratitis. The study included 35 healthy dogs and 40 dogs with keratitis. Bacterial species were confirmed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). Strains of S. pseudintermedius were screened for resistance against nine different antibiotics by the Kirby-Bauer assay. The ability to produce biofilm was investigated by microtiter plate assay (MtP) and amplification of icaA and icaD genes. Virulence factors in the strains were also evaluated. A total of 132 aerobic bacteria were isolated from the 119 samples in the study. Among them, 67 bacterial strains were isolated from 70 eyes of healthy dogs, and 65 bacterial strains were isolated from 49 eyes of dogs with keratitis. The prevalence of S. pseudintermedius, which was the most frequent bacterial isolate in both the groups, was 20.9% in the healthy group and 23.08% in the keratitis group. Most of the isolates of S. pseudintermedius were sensitive to rifampin (96.6%), oxacillin (100%), and neomycin (96.6%), and resistant to tetracycline (96.6%). Virulence factors such as lip (96.6%), hlgB (96.6%), and hlgA (96.6%) were found in most of the isolates, and 89.66% of isolates were classed as biofilm producers. In conclusion, S. pseudintermedius was the common bacterium in the conjunctivital sac of the healthy dogs and dogs with keratitis in Yangzhou, China, and the presence of virulence factors and biofilm-formation ability were high in the strains isolated from the dogs with keratitis.Entities:
Keywords: antibiotic-resistance; canine; cornea ulcer; staphylococcus pseudintermedius; virulence factors
Year: 2022 PMID: 36032292 PMCID: PMC9399793 DOI: 10.3389/fvets.2022.903633
Source DB: PubMed Journal: Front Vet Sci ISSN: 2297-1769
Primers, amplicon size, sequence, and annealing temperature.
|
|
|
|
|
|
|
|
|---|---|---|---|---|---|---|
|
| ( | Elastin-blinding protein |
| AGACGCCACAGAAAAAGA | 1040bp | 54 |
|
| GCAGATTGACCTTGTTGA | |||||
|
| ( | Fibrinogen-/ fibronectin-blinding protein |
| TTTCTCGTTTCTGGGCGT | 1600bp | 54 |
|
| GCGTCTTCTGGTTATCGT | |||||
|
| ( | Lipase |
| GGAAAAGCAGCAGAAAGAA | 1601bp | 54 |
|
| GGGTGCTGTAGAAATA | |||||
|
| ( | γ-Hemolysin A component |
| CTTCTTCCACTTATTACACC | 718bp | 56 |
|
| CACTTGTATCGTTTATC | |||||
|
| ( | γ-Hemolysin B component |
| GGGGGGCTAAGTAAGTAATGT | 475bp | 56 |
|
| GCGCCATTTGGTTTATGT | |||||
|
| ( | Leukotoxin F component |
| CCTGTCTATGCCGCTAATCCA | 572bp | 57 |
|
| AGGTCATGGAAGCTATCTCGA | |||||
|
| ( | Leukotoxin S component |
| TGTAAGCAGCAGAAAATGGGG | 503bp | 57 |
|
| GCCCGATAGGACTTCTTACAA | |||||
|
| ( | ica locus A |
| ACTGTTTCGGGGACAAGCAT | 134bp | 60 |
|
| ATTGAGGCTGTAGGGCGTTG | |||||
|
| ( | ica locus D |
| CGTTAATGCCTTCTTTCTTATTGCG | 166bp | 56 |
|
| ATTAGCGCACATTCGGTGTT | |||||
|
| ( | exfoliative toxin SIET |
| ATGGAAAATTTAGCGGCATCTGG | 359bp | 56 |
|
| CCATTACTTTTCGCTTGTTGTGC | |||||
|
| ( | toxic shock syndrome toxin |
| GCTTGCGACAACTGCTACAG | 559bp | 55 |
|
| TGGATCCGTCATTCATTGTTAT | |||||
|
| ( | Panton- Valentine leucocidin |
| ATCATTAGGTAAAATGTCTGGACAT GATCCA | 432bp | 55 |
|
| GCATCAATGTATTGGATAGCAAAAGC |
Bacterial species isolated from canine conjunctival sac.
|
|
|
| ||
|---|---|---|---|---|
|
|
|
|
| |
| 28 | 41.79 | 39 | 60.00 | |
|
| 14 | 20.90 | 15 | 23.08 |
|
| 4 | 5.97 | 1 | 1.54 |
|
| 0 | 0 | 3 | 4.62 |
|
| 0 | 0 | 2 | 3.08 |
|
| 0 | 0 | 2 | 3.08 |
|
| 0 | 0 | 2 | 3.08 |
|
| 2 | 2.99 | 3 | 4.62 |
|
| 1 | 1.49 | 1 | 1.54 |
|
| 3 | 4.48 | 2 | 3.08 |
|
| 0 | 0 | 4 | 6.15 |
|
| 2 | 2.99 | 1 | 1.54 |
|
| 1 | 1.49 | 1 | 1.54 |
|
| 1 | 1.49 | 2 | 3.08 |
| 8 | 11.94 | 7 | 10.77 | |
|
| 7 | 10.45 | 7 | 10.77 |
|
| 1 | 1.49 | 0 | 0 |
| 1 | 1.49 | 0 | 0 | |
|
| 1 | 1.49 | 0 | 0 |
| 4 | 5.97 | 1 | 1.54 | |
|
| 3 | 4.48 | 1 | 1.54 |
|
| 1 | 1.49 | 0 | 0 |
| 6 | 8.96 | 2 | 3.08 | |
|
| 2 | 2.99 | 1 | 1.54 |
|
| 2 | 2.99 | 1 | 1.54 |
|
| 1 | 1.49 | 0 | 0 |
|
| 1 | 1.49 | 0 | 0 |
| 0 | 0 | 1 | 1.54 | |
|
| 0 | 0 | 1 | 1.54 |
| 0 | 0 | 3 | 4.62 | |
|
| 0 | 0 | 3 | 4.62 |
| 1 | 1.49 | 2 | 3.08 | |
|
| 1 | 1.49 | 2 | 3.08 |
| 3 | 4.48 | 2 | 3.08 | |
|
| 3 | 4.48 | 2 | 3.08 |
| 3 | 4.48 | 1 | 1.54 | |
|
| 1 | 1.49 | 0 | 0 |
|
| 1 | 1.49 | 0 | 0 |
|
| 1 | 1.49 | 1 | 1.54 |
| 1 | 1.49 | 0 | 0 | |
|
| 1 | 1.49 | 0 | 0 |
| 2 | 2.99 | 1 | 1.54 | |
|
| 2 | 2.99 | 1 | 1.54 |
| 3 | 4.48 | 2 | 3.08 | |
|
| 3 | 4.48 | 2 | 3.08 |
| 1 | 1.49 | 3 | 4.62 | |
|
| 1 | 1.49 | 3 | 4.62 |
| Unknow | 6 | 8.96 | 1 | 1.54 |
Frequency of bacterial eye disease among breeds in 40 dogs.
|
|
|
|
|---|---|---|
| French Bulldog | 8 (20) | 5/8 (62.5) |
| Pug | 7 (17.5) | 4/7 (57.1) |
| poodle | 5 (12.5) | 2/5 (40) |
| Chihuahua | 5 (12.5) | 2/5 (40) |
| Pekingese | 4 (10) | 0/4 (0) |
| Bulldog | 4 (10) | 1/4 (25) |
| Other | 7 (1.75) | 1/7 (14.3) |
Antimicrobial resistance of the 29 isolates of S. pseudintermedius from canine eyes.
|
|
| ||||||
|---|---|---|---|---|---|---|---|
|
|
|
|
|
|
| ||
| Erythromycin | ≤18 | 14 (93.3)a | 1 (6.7) | 9 (64.3) | 5 (35.7) | 23 (79.3) | 6 (20.1) |
| Rifampin | ≤23 | 1 (6.7) | 14 (93.3) | 0 (0) | 14 (100) | 1 (3.4) | 28 (96.6) |
| Chloramphenicol | ≤18 | 9 (60)a | 8 (53.3) | 2 (14.3) | 10 (71.4) | 11 (37.9) | 18 (62.1) |
| Tetracycline | ≤19 | 15 (100) | 0 (0) | 13 (92.9) | 1 (7.1) | 28 (96.6) | 1 (3.4) |
| Neomycin | ≤12 | 1 (6.7) | 14 (93.3) | 0 (0) | 14 (100) | 1 (3.4) | 28 (96.6) |
| Ciprofloxacin | ≤15 | 4 (26.7) | 11 (73.3) | 2 (14.3) | 12 (85.7) | 6 (20.7) | 23 (79.3) |
| Tobramycin | ≤12 | 2 (13.3)a | 13 (86.7) | 0 (0) | 14 (100) | 2 (6.9) | 27 (93.1) |
| Levofloxacin | ≤13 | 4 (26.7)a | 12 (80) | 1 (7.1) | 12 (85.7) | 4 (13.7) | 25 (86.3) |
| Oxacillin | ≤18 | 0 (0) | 15 (100) | 0 (0) | 14 (100) | 0 (0) | 29 (100) |
“a” means p < 0.05, vs. healthy groups.
The MDR patterns of 7 S. pseudintermedius isolates.
|
|
| ||
|---|---|---|---|
|
|
|
| |
| TE-E-RA-LVX | 1 (20) | 0 (0) | 1(14.3) |
| TE-E-N-TO | 1 (20) | 0 (0) | 1(14.3) |
| TE-E-TO-C | 1 (20) | 0 (0) | 1(14.3) |
| TE-E-LVX-CIP | 2 (40) | 0 (0) | 2 (28.3) |
| TE-LVX-CIP-C | 0 (0) | 1 (50) | 1(14.3) |
| TE-E-CIP-C | 0 (0) | 1 (50) | 1(14.3) |
Distribution of virulence factors genes among 29 isolates of S. pseudintermedius.
|
|
| ||
|---|---|---|---|
|
|
|
| |
|
| 14 (93.3)a | 13 (92.3) | 27 (93.1) |
|
| 14 (93.3)a | 7 (50) | 21 (72.4) |
|
| 13 (86.7)a | 9 (64.3) | 22 (75.9) |
|
| 15 (100) | 13 (92.3) | 28 (96.6) |
|
| 15 (100)a | 13 (92.3) | 28 (96.6) |
|
| 14 (93.3) | 13 (92.3) | 27 (93.1) |
|
| 0 (0) | 0 (0) | 0 (0) |
|
| 15 (100) | 13 (92.3) | 28 (96.6) |
|
| 14 (93.3)a | 12 (85.7) | 26 (89.7) |
|
| 0 (0) | 0 (0) | 0 (0) |
|
| 15 (100) | 13 (92.3) | 28 (96.6) |
|
| 15 (100) | 13 (92.3) | 28 (96.6) |
|
| 0 (0) | 0 (0) | 0 (0) |
|
| 15 (100) | 13 (92.3) | 28 (96.6) |
“a” means p < 0.05, vs. healthy groups.
Virulence gene patterns of 29 isolates of S. pseudintermedius.
|
|
|
|
| |
|---|---|---|---|---|
| 1 |
| 10 (66.7)a | 4 (28.3) | 14 (48.3) |
| 2 |
| 0 (0) | 2 (14.3) | 2 (6.9) |
| 3 |
| 2 (13.3) | 1 (7.1) | 3 (10.3) |
| 4 |
| 1 (6.7) | 1 (7.1) | 2 (6.9) |
| 5 |
| 1 (6.7) | 1 (7.1) | 2 (6.9) |
| 6 |
| 0 (0) | 3 (21.4) | 3 (10.3) |
| 7 |
| 1 (6.7) | 0 (0) | 1 (3.4) |
| 8 |
| 0 (0) | 1 (7.1) | 1 (3.4) |
| 9 |
| 0 (0) | 1 (7.1) | 1 (3.4) |
| 10 |
| 0 (0) | 1 (7.1) | 1 (3.4) |
“a” means p < 0.05, vs. healthy groups.
Biofilm-forming ability of 29 strains of S. pseudintermedius.
|
| ||||
|---|---|---|---|---|
|
|
|
|
| |
| Keratitis ( | 1 (6.7) | 2 (13.3)a | 5 (33.3)a | 6 (40)a |
| Healthy ( | 2 (14.3) | 11 (78.6) | 1 (7.1) | 1 (7.1) |
| Total ( | 3 (10.3) | 13 (44.8) | 6 (10.2) | 7 (24.1) |
“a” means p < 0.05, vs. healthy groups.