Literature DB >> 29784083

A homozygous loss-of-function CAMK2A mutation causes growth delay, frequent seizures and severe intellectual disability.

Poh Hui Chia1, Franklin Lei Zhong1,2, Shinsuke Niwa3,4, Carine Bonnard1, Kagistia Hana Utami5, Ruizhu Zeng5, Hane Lee6,7, Ascia Eskin6,7, Stanley F Nelson6,7, William H Xie1, Samah Al-Tawalbeh8, Mohammad El-Khateeb9, Mohammad Shboul10, Mahmoud A Pouladi5,11, Mohammed Al-Raqad8, Bruno Reversade1,2,12,13.   

Abstract

Calcium/calmodulin-dependent protein kinase II (CAMK2) plays fundamental roles in synaptic plasticity that underlies learning and memory. Here, we describe a new recessive neurodevelopmental syndrome with global developmental delay, seizures and intellectual disability. Using linkage analysis and exome sequencing, we found that this disease maps to chromosome 5q31.1-q34 and is caused by a biallelic germline mutation in CAMK2A. The missense mutation, p.His477Tyr is located in the CAMK2A association domain that is critical for its function and localization. Biochemically, the p.His477Tyr mutant is defective in self-oligomerization and unable to assemble into the multimeric holoenzyme.In vivo, CAMK2AH477Y failed to rescue neuronal defects in C. elegans lacking unc-43, the ortholog of human CAMK2A. In vitro, neurons derived from patient iPSCs displayed profound synaptic defects. Together, our data demonstrate that a recessive germline mutation in CAMK2A leads to neurodevelopmental defects in humans and suggest that dysfunctional CAMK2 paralogs may contribute to other neurological disorders.
© 2018, Chia et al.

Entities:  

Keywords:  C. elegans; CAMK2; Mendelian disorder; human; human biology; intellectual disability; medicine; neurological disease; neuroscience; oligomerization; seizures

Mesh:

Substances:

Year:  2018        PMID: 29784083      PMCID: PMC5963920          DOI: 10.7554/eLife.32451

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Calcium/calmodulin-dependent protein kinase II (CAMK2) is a calcium-activated serine/threonine kinase that is extremely abundant in the brain, comprising as much as 0.3% of the total brain protein content (Bennett et al., 1983). CAMK2 is highly enriched at the synapses and is necessary for the process of long-term potentiation (LTP), the activity-dependent strengthening and modulation of synaptic activity that is thought to be the molecular basis of some forms of learning and memory (Kandel et al., 2014; Lisman et al., 2002). In humans, there are four genes encoding distinct CAMK2 iso-enzymes. CAMK2A and CAMK2B are the predominant isoforms in the nervous system, with CAMK2A being expressed 3–4 times higher than CAMK2B (Hanson and Schulman, 1992). Each enzyme comprises a kinase domain, a regulatory domain and an association domain. Structurally CAMK2 holoenzymes are homo- or hetero-oligomers, consisting of 12 or 14 CAMK2 subunits (Hudmon and Schulman, 2002b). The holoenzyme assembly requires the carboxy-terminal association domain, which forms stacked pairs of hexameric or heptameric rings with the regulatory and kinase domain projecting radially to interact with other essential proteins for CAMK2 function and localization (Bhattacharyya et al., 2016). In the absence of calcium signalling, CAMK2 is inactive, as the regulatory domain inhibits kinase function (Yang and Schulman, 1999). This auto-inhibition is relieved when calcium-loaded calmodulin binds to the regulatory domain, thereby exposing the kinase domain and allowing it to phosphorylate target substrates (Meador et al., 1993). Ca2+-Calmodulin binding also exposes Thr286 on the regulatory domain of CAMK2A, which becomes phosphorylated in trans by adjacent subunits. Once this residue is phosphorylated, the enzyme is persistently active, even in the absence of continual Ca2+-Calmodulin signaling (Rich and Schulman, 1998; Stratton et al., 2013). This switch from auto-inhibition to autonomous, persistent activity is thought to constitute a biochemical form of memory, which marks the neuron for having experienced a previous calcium influx (Bhattacharyya et al., 2016; Stratton et al., 2014; Stratton et al., 2013). Mice that are homozygous null for CAMK2A are viable and display impaired spatial memory and reduced LTP in the hippocampus (Silva et al., 1992a, 1992b). The heterozygous mutant (Camk2a) show a significant deficit in spatial working memory and contextual fear memory (Frankland et al., 2001; Matsuo et al., 2009). More recently, it was demonstrated that mice with neuron-specific conditional knock-out of CAMK2A similarly displayed learning deficits and defects in LTP that were comparable to the complete knockout mice (Achterberg et al., 2014). These findings suggest that neuron-intrinsic CAMK2A function is indispensable during the period of learning for memory formation. CAMK2 is conserved in invertebrates, such as D. melanogaster and C. elegans, where the kinase also plays critical roles in behavioral and cognitive traits (Cho et al., 1991; Hudmon and Schulman, 2002a; Reiner et al., 1999; Rongo and Kaplan, 1999). In C. elegans, the only CAMK2 is encoded by the unc-43 gene, which is essential for synaptic function (Rongo and Kaplan, 1999). Loss of unc-43 causes worms to have flaccid muscle tone, locomotion defects and spontaneous body contractions that resemble seizures (Reiner et al., 1999). In pediatric care, global developmental delay in infants is defined as a significant functional delay in two or more developmental domains including gross and fine motor function, speech and language, cognition, social development and personal skills (Quality Standards Subcommittee of the American Academy of Neurology et al., 2003). These defects are detected at an early age in children age five years or under, and can persist throughout life (Shevell, 2008). About 25–50% of identified case are caused by germline genetic changes, including chromosomal abnormalities, copy number variants and monogenic mutations (Srour and Shevell, 2014; van Bokhoven, 2011). For many patients with global neuro-developmental delay, the genetic etiology remains unknown.

Results

Here, we report the identification of a consanguineous family from Jordan with two affected children manifesting global neuro-developmental delay with frequent seizures and convulsions. The two affected siblings had no dysmorphic features but failed to develop the ability to walk or speak (Figure 1A,B, Figure 1—figure supplement 1A). They displayed progressive psychomotor retardation with hypotonic muscles (Supplemental Material, Videos 1 and 2). Electroencephalogram (EEG) analysis revealed abnormal epileptiform transients (Figure 1C, Figure 1—figure supplement 1B), consistent with frequent myoclonic seizures. Magnetic resonance imaging (MRI) scan showed no major structural defects in the brain of proband II:4 (Figure 1—figure supplement 1C). Serum metabolite levels were normal, ruling out potential lysosomal storage disorders.
Figure 1.

A new syndrome of global neuro-developmental delay with seizures caused by a biallelic mutation in CAMK2A.

(A) Pedigree of a consanguineous Jordanian family with two affected siblings with germline homozygous mutations in CAMK2A. The genotypes of all individuals were verified by Sanger sequencing. (B) Photographs of the two affected siblings with normal head circumferences. (C) EEG graph of patient II.I showing abnormal epileptiform transients (red boxes) (D) Homozygosity mapping delineates one candidate locus on chromosome 5. (E) CAMK2A exonic structure and CAMK2A protein domains. Patients II:1 and II:4 carry biallelic missense mutation p. H477Y located in CAMK2A association domain (AD). Nucleotide change c.1429 C > T refers to position on CAMK2A cDNA.

(A) Clinical table detailing the growth parameters and learning deficits of the two affected children. (B) EEG of patient II.4 showing abnormal waveforms (red box). (C) MRI images of patient II.4 showing no gross structural abnormalities in the brain. (D) Graphs showing homozygous regions identified through IBD mapping for each family member prior to filtering (E) Table of 4 homozygous genes that lie within the Chr. 5 IBD region.

Figure 1—figure supplement 1.

Genetic and clinical findings from the two patients with global developmental delay.

(A) Clinical table detailing the growth parameters and learning deficits of the two affected children. (B) EEG of patient II.4 showing abnormal waveforms (red box). (C) MRI images of patient II.4 showing no gross structural abnormalities in the brain. (D) Graphs showing homozygous regions identified through IBD mapping for each family member prior to filtering (E) Table of 4 homozygous genes that lie within the Chr. 5 IBD region.

Video 1.

Video of patient II.1

Video 2.

Video of patient II.4

A new syndrome of global neuro-developmental delay with seizures caused by a biallelic mutation in CAMK2A.

(A) Pedigree of a consanguineous Jordanian family with two affected siblings with germline homozygous mutations in CAMK2A. The genotypes of all individuals were verified by Sanger sequencing. (B) Photographs of the two affected siblings with normal head circumferences. (C) EEG graph of patient II.I showing abnormal epileptiform transients (red boxes) (D) Homozygosity mapping delineates one candidate locus on chromosome 5. (E) CAMK2A exonic structure and CAMK2A protein domains. Patients II:1 and II:4 carry biallelic missense mutation p. H477Y located in CAMK2A association domain (AD). Nucleotide change c.1429 C > T refers to position on CAMK2A cDNA.

Genetic and clinical findings from the two patients with global developmental delay.

(A) Clinical table detailing the growth parameters and learning deficits of the two affected children. (B) EEG of patient II.4 showing abnormal waveforms (red box). (C) MRI images of patient II.4 showing no gross structural abnormalities in the brain. (D) Graphs showing homozygous regions identified through IBD mapping for each family member prior to filtering (E) Table of 4 homozygous genes that lie within the Chr. 5 IBD region. Assuming autosomal recessive inheritance, we performed identity-by-descent (IBD) homozygosity mapping using genomic DNA from both parents, two affected probands and three healthy siblings. Only one candidate locus greater than 5 cM on chromosome 5 spanning 28 Mb was delineated (Figure 1D, Figure 1—figure supplement 1D). Whole-exome sequencing was subsequently performed on index case II:1. After filtering for variants with low quality and low sequencing coverage, 72 homozygous variants were identified, out of which four lie within the Chr. 5 IBD region (Table 1). Three of the homozygous variants had been previously annotated as known polymorphisms with minor allele frequencies > 0.0001. In addition, healthy individuals who are homozygous for the minor alleles had been identified in genomic sequencing databases such as dbSNP and gnomAD (Figure 1—figure supplement 1E). We therefore filtered out these variants as non-pathogenic. The fourth homozygous variant within the IBD region mapped to the CAMK2A gene (MIM: 114078), resulting in a missense mutation p.His477Tyr that has never been observed in previous large-scale sequencing databases and our in-house ethnically-matched cohort (Figure 1E, Figure 1—figure supplement 1E). Using Sanger sequencing, this private mutation was confirmed to segregate with the disease in all seven family members (Figure 1A,D).
Table 1.

List of homozygous variants identified by Whole Exome Sequencing.

ChrPositionGenecDNA variantProtein variant
133,476,435AK2c.*45–1G > T
136,752,343THRAP3c.512C > Tp.Ser171Phe
136,932,102CSF3Rc.2273C > Tp.Thr758Ile
139,758,439MACF1c.1931G > Tp.Gly644Val
1145,365,316NBPF10c.9941G > Ap.Gly3314Glu
211,758,842GREB1c.3841G > Ap.Ala1281Thr
229,404,617CLIP4c.1976G > Ap.Arg659Gln
264,779,195AFTPHc.587G > Ap.Gly196Glu
2238,277,211COL6A3c.4895G > Ap.Arg1632Gln
2241,987,827SNED1c.1369G > Ap.Glu457Lys
338,348,802SLC22A14c.574G > Ap.Ala192Thr
344,672,687ZNF197c.524C > Tp.Ala175Val
347,452,772PTPN23c.3484C > Tp.Arg1162Trp
352,556,184STAB1c.6403C > Gp.Pro2135Ala
367,426,232SUCLG2c.1235T > Cp.Ile412Thr
3197,422,844KIAA0226c.1366C > Tp.Arg456Trp
49,174,981FAM90A26Pc.83T > Gp.Val28Gly
49,175,603FAM90A26Pc.211C > Gp.Pro71Ala
410,089,539WDR1c.743A > Gp.His248Arg
415,529,151CC2D2Ac.1231T > Gp.Ser411Ala
574,021,852GFM2c.1820_1825delTTGAGTp.Glu608_Phe609del
578,610,479JMYc.2464C > Ap.Pro822Thr
5149,602,589CAMK2Ac.1429C > Tp.His477Tyr
5154,199,950C5orf4c.928G > Ap.Glu310Lys
5156,456,715HAVCR1c.1090G > Ap.Ala364Thr
5156,479,452HAVCR1c.590_592delCAAp.Thr198del
626,509,392BTN1A1c.1571G > Ap.Gly524Glu
627,215,709PRSS16c.119G > Ap.Ser40Asn
632,806,007TAP2c.4C > Tp.Arg2Trp
633,260,924RGL2c.1876G > Ap.Gly626Arg
638,704,952DNAH8c.221C > Ap.Ala74Asp
643,412,643ABCC10c.2807C > Tp.Pro936Leu
6129,932,746ARHGAP18c.1054C > Tp.Arg352Ter
6131,946,054MED23c.235C > Tp.Leu79Phe
6151,674,121AKAP12c.4595_4596insGGCp.Asp1532delinsGluAla
6168,479,677FRMD1c.98A > Cp.Glu33Ala
75,352,665TNRC18c.7851_7856dupCTCCTCp.Ser2618_Ser2619dup
745,123,857NACADc.1922T > Cp.Val641Ala
7143,884,437ARHGEF35c.1040C > Tp.Thr347Ile
7149,422,981KRBA1c.1304C > Tp.Ala435Val
7151,680,130GALNTL5c.428A > Gp.Tyr143Cys
812,285,064FAM86B1|FAM86B2c.310T > Cp.Ser104Pro
812,285,250FAM86B2c.808C > Tp.Arg270Trp
886,574,132REXO1L1c.1595A > Cp.Asp532Ala
912,775,863LURAP1Lc.149_150insTGGCGGp.Gly49_Gly50dup
940,706,047FAM75A3c.3704A > Gp.His1235Arg
941,323,425FAM75A4c.1908C > Tp.Arg637Trp
941,323,469FAM75A4c.1864G > Ap.Gly622Asp
943,822,668CNTNAP3Bc.1222C > Tp.Leu408Phe
1051,748,684AGAP6c.209G > Ap.Arg70Gln
1081,471,741FAM22Bc.2137T > Cp.Trp713Arg
111,651,198KRTAP5-5c.129_137delAGGCTGTGGp.Gly44_Gly46del
1112,316,388MICALCLc.1408_1410dupCCTp.Pro470dup
127,045,917ATN1c.1488_1508delGCAGCAGCAGCAGCAGCAGCAp.Gln496_Gln502del
127,045,920ATN1c.1491_1508delGCAGCAGCAGCAGCAGCAp.Gln497_Gln502del
1399,461,564DOCK9c.1271_1272insAp.Leu425LeufsTer?
13114,503,875FAM70Bc.500_509 + 72delCCTGCGGGAGG TGAGGGGCACCGGGGACCCCCATATC TACACCTGCGGGAGGTGAGGGGC GCTGGGGACCCCCGTATCTACA
14105,411,514AHNAK2c.10274C > Tp.Ala3425Val
14106,994,118IGHV3-48c.47G > Ap.Gly16Asp
1629,496,359c.916T > Cp.Ser306Pro
1630,772,988C16orf93c.82G > Ap.Ala28Thr
1670,215,817CLEC18Cc.521C > Tp.Ala174Val
1739,211,189KRTAP2-2c.275G > Cp.Cys92Ser
191,026,716CNN2c.56A > Cp.Lys19Thr
1910,084,460COL5A3c.3584T > Cp.Val1195Ala
1914,517,213CD97c.1892G > Ap.Ser631Asn
2136,042,462CLIC6c.776_805delGCGTAGAAGCGGGGGTCCCGGCGGGGGACAp.Val260_Ser269del
2218,834,773c.329C > Tp.Thr110Ile
X48,920,059CCDC120c.110A > Gp.Asp37Gly
X55,116,478PAGE2c.25T > Ap.Ser9Thr
X150,832,702PASD1c.954_971delCCCAATGGACCAGCAGGAp.Pro319_Asp324del
X153,050,158SRPK3c.1_5delGACAGp.Thr2LeufsTer57
X154,010,046MPP1c.978A > Cp.Glu326Asp
CAMK2A is a neuron-specific, highly abundant serine/threonine kinase that plays critical roles in synaptic plasticity. To understand how neuronal function is affected due to the mutation in CAMK2A, we reprogrammed primary dermal fibroblasts from patient II.4 into iPSCs, differentiated them into neurons and measured population-level neuronal activity using a multi-electrode array (MEA) system (Figure 2A). Compared to H1 embryonic stem cell derived neurons and an unrelated CAMK2A wild-type iPSC control, the patient’s iPSCs were equally efficient in differentiating into mature neurons expressing neuronal markers TUJ1 and MAP2 after 21 days of in vitro differentiation (Figure 2B). When these differentiated neurons were plated on MEA plates to measure spontaneous action potentials, we observed a significant reduction in both the total number of spontaneous spikes (Figure 2C, left) and the mean firing rate (Figure 2C, right) in the patient-derived neurons harboring the p.H477Y mutation compared to the wild-type controls, suggesting that CAMK2AH477Y causes a profound functional defect in cultured neurons.
Figure 2.

CAMK2A mutant iPSC-derived neurons are functionally less active.

(A) Schematic of the hPSC-derived neuronal activity assay with representative image of iPSC-derived neurons plated on a multi-electrode array (B) Representative confocal images of immunofluorescence staining of neuronal lineage markers TUJ1 (green) and MAP2 (red) show efficient differentiation of iPSCs into neurons. Scale bar represents 20 µm. (C) Graphs showing the number of neuron-evoked spikes and mean firing rate detected by multi-electrode arrays. (n = 7 per line per time-point; Values shown as mean ±SEM; Two-way ANOVA with Tukey post-hoc test; *p<0.05 and ***p<0.001).

CAMK2A mutant iPSC-derived neurons are functionally less active.

(A) Schematic of the hPSC-derived neuronal activity assay with representative image of iPSC-derived neurons plated on a multi-electrode array (B) Representative confocal images of immunofluorescence staining of neuronal lineage markers TUJ1 (green) and MAP2 (red) show efficient differentiation of iPSCs into neurons. Scale bar represents 20 µm. (C) Graphs showing the number of neuron-evoked spikes and mean firing rate detected by multi-electrode arrays. (n = 7 per line per time-point; Values shown as mean ±SEM; Two-way ANOVA with Tukey post-hoc test; *p<0.05 and ***p<0.001). The CAMK2A enzyme consists of an N-terminal catalytic kinase domain, a Ca2+-calmodulin-binding regulatory domain and a C-terminal association domain (AD) that is necessary for the assembly of the 12- or 14-subunit holoenzyme. The identified mutation, p.H477Y is located in the association domain (Figure 1E) and affects a histidine residue that is invariant across all vertebrate and invertebrate CAMK2A homologues. It is also conserved in other human CAMK2 paralogs with a similar association domain such as CAMK2B, CAMK2D and CAMK2G (Figure 3A, Figure 3—figure supplement 1A). In addition, this mutation is predicted to be deleterious by both SIFT, PolyPhen and MCAP algorithms. Structurally, His477 is located at the dimeric interface that forms part of the extensive interaction surface at the ‘equatorial’ plane of the CAMK2A holoenzyme (Figure 3B). Based on prior findings that CAMK2A oligomerization through its association domain is indispensable for substrate phosphorylation and synaptic localization (Bhattacharyya et al., 2016), we hypothesize that the p.H477Y allele is hypomorphic and that biallelic loss-of-function in CAMK2A is the direct cause for the neurodevelopmental phenotypes in the two probands.
Figure 3.

p.H477Y affects CAMK2A oligomerization and protein stability.

(A) Sequence conservation of CAMK2A homologs. Histidine 477 (H477) is highlighted in red. (B) X-ray crystal structure of human CAMK2A AD tetradecamer (PDB: 5IG3). H477 (red) is located at the equatorial dimer interface. (C) Defective oligomerization of the p.H477Y mutant. 293 T cells were transiently transfected with FLAG tagged wild-type CAMK2A and CAMK2AH477Y. A third mutant, CAMK2AH477X which lacks part of the AD (a.a. 478–489) was used as positive control. (D) Defective self-association of the p.H477Y mutant. The indicated FLAG- and HA-tagged CAMK2A wild-type and mutant proteins were synthesized in vitro using rabbit reticulocyte lysate. FLAG-GFP was used a negative control. FLAG-tagged proteins were immunoprecipitated using anti-FLAG M2 agarose resin in the presence of 1% NP40. Co-immunoprecipitated proteins were analyzed by SDS-PAGE. *, IgG light chain. ^, IgG heavy chain. (E) p.H477Y mutation lowers expression of CAMK2A in cells. 293 T cells were transfected with reporter plasmids encoding GFP-tagged wild-type CAMK2A, CAMK2AH477Y and CAMK2AH477X mutants, followed by T2A peptide and mCherry. Representative confocal images show lower expression of mutant GFP- CAMK2AH477Y compared to wild-type. Scale bar represents 100 µm. (F). p.H477Y decreases CAMK2A stability via proteasomal degradation. 293 T cells were transfected as in (E) and treated with 10 µM MG132 or DMSO for 16 hr. 10 µg total cell lysate was used for SDS-PAGE and Western blot.

(A) Sequence conservation of CAMK2 paralogs. His477 (red) is invariant in all human CAMK2 paralogues with an association domain. (B) p.H477Y mutant is subject to proteasomal degradation. 293 T cells were transfected with plasmids encoding GFP-tagged wild-type CAMK2A, p.H477Y and p.H477X mutants. Cells were incubated with DMSO or 2.5 μM MG132 for 16 hr 1 day post transfection. GFP intensity in the cells is increased in the CAMK2A p.H477Y and p.H477X mutants after MG132 treatment. Scale bar represents 100 µm.

Figure 3—figure supplement 1.

Decreased stability and defective cytoplasmic localization of the CAMK2AH477Y mutant.

(A) Sequence conservation of CAMK2 paralogs. His477 (red) is invariant in all human CAMK2 paralogues with an association domain. (B) p.H477Y mutant is subject to proteasomal degradation. 293 T cells were transfected with plasmids encoding GFP-tagged wild-type CAMK2A, p.H477Y and p.H477X mutants. Cells were incubated with DMSO or 2.5 μM MG132 for 16 hr 1 day post transfection. GFP intensity in the cells is increased in the CAMK2A p.H477Y and p.H477X mutants after MG132 treatment. Scale bar represents 100 µm.

p.H477Y affects CAMK2A oligomerization and protein stability.

(A) Sequence conservation of CAMK2A homologs. Histidine 477 (H477) is highlighted in red. (B) X-ray crystal structure of human CAMK2A AD tetradecamer (PDB: 5IG3). H477 (red) is located at the equatorial dimer interface. (C) Defective oligomerization of the p.H477Y mutant. 293 T cells were transiently transfected with FLAG tagged wild-type CAMK2A and CAMK2AH477Y. A third mutant, CAMK2AH477X which lacks part of the AD (a.a. 478–489) was used as positive control. (D) Defective self-association of the p.H477Y mutant. The indicated FLAG- and HA-tagged CAMK2A wild-type and mutant proteins were synthesized in vitro using rabbit reticulocyte lysate. FLAG-GFP was used a negative control. FLAG-tagged proteins were immunoprecipitated using anti-FLAG M2 agarose resin in the presence of 1% NP40. Co-immunoprecipitated proteins were analyzed by SDS-PAGE. *, IgG light chain. ^, IgG heavy chain. (E) p.H477Y mutation lowers expression of CAMK2A in cells. 293 T cells were transfected with reporter plasmids encoding GFP-tagged wild-type CAMK2A, CAMK2AH477Y and CAMK2AH477X mutants, followed by T2A peptide and mCherry. Representative confocal images show lower expression of mutant GFP- CAMK2AH477Y compared to wild-type. Scale bar represents 100 µm. (F). p.H477Y decreases CAMK2A stability via proteasomal degradation. 293 T cells were transfected as in (E) and treated with 10 µM MG132 or DMSO for 16 hr. 10 µg total cell lysate was used for SDS-PAGE and Western blot.

Decreased stability and defective cytoplasmic localization of the CAMK2AH477Y mutant.

(A) Sequence conservation of CAMK2 paralogs. His477 (red) is invariant in all human CAMK2 paralogues with an association domain. (B) p.H477Y mutant is subject to proteasomal degradation. 293 T cells were transfected with plasmids encoding GFP-tagged wild-type CAMK2A, p.H477Y and p.H477X mutants. Cells were incubated with DMSO or 2.5 μM MG132 for 16 hr 1 day post transfection. GFP intensity in the cells is increased in the CAMK2A p.H477Y and p.H477X mutants after MG132 treatment. Scale bar represents 100 µm. To measure the oligomerization potential of the CAMK2AH477Y mutant in cells, we transiently expressed FLAG-tagged wild-type CAMK2A and CAMK2AH477Y mutant in 293 T cells, which do not express endogenous CAMK2A. A third mutant CAMK2AH477X, which lacks amino acids 477–489 and thus encodes a truncated association domain, was used as an additional control. Using native lysis conditions that preserve non-covalent macromolecular interactions, we found that wild-type CAMK2A forms a prominent complex with an apparent molecular weight ~1 MDa (Figure 3C, Native-PAGE, lane 2), which is consistent with the 12- or 14- subunit CAMK2A holoenzyme (Bhattacharyya et al., 2016). As compared to wild-type CAMK2A, the ~1 MDa, putatively oligomeric species was drastically reduced for the p.H477Y mutant and was undetectable for the p.H477X mutant (Figure 3C, Native-PAGE, lane 3 and 4 vs. lane 2). Next, we examined the ability of in vitro translated CAMK2A to self-oligomerize in a cell-free system. In contrast to the negative control protein GFP, wild-type FLAG-CAMK2A efficiently co-immunoprecipitated with HA-CAMK2A (Figure 3D, Lane 10 vs 11). This self-association was preserved between CAMK2AWT and CAMK2AH477Y (Figure 3D, lanes 12 and 15), but was completely lost between wild-type CAMK2A and the p.H477X mutant (Figure 3D, lane 13). In contrast, we could not detect any self-association between FLAG- CAMK2AH477Y and HA- CAMK2AH477Y (Figure 3D, Lane 16). Taken together, these results suggest that the missense p.H477Y partially disrupts the self-association between identical CAMK2A molecules, which had been shown to be required for holoenzyme assembly. The partial loss of function of the p.H477Y mutant, as compared to a more severe mutation p.H477X, is consistent with the observed autosomal recessive inheritance of the disease in the family, where the heterozygous carriers do not display apparent neuro-developmental symptoms. During the course of this analysis, we noticed that both p.H477Y and p.H477X mutants had reduced protein abundance. This effect on the p.H477Y mutant was, however, subtle and could not readily explain the difference in the CAMK2A oligomer observed in the native gel (Figure 3C, SDS-PAGE). As it is known that in general fully assembled oligomeric complexes have enhanced stability in vivo compared to partially assembled complexes with disrupted folding like CAMK2AH477Y (Lord, 1996; Oromendia et al., 2012), we hypothesized that the p.H477Y mutant may exhibit reduced stability and undergo proteasomal degradation. To test this, 293T cells were transfected with reporter constructs that encode GFP tagged wild-type and mutant CAMK2A followed by a self-cleaving peptide T2A and mCherry (Figure 3E). The intensity of GFP fluorescence was used as a direct quantitative measure of CAMK2A stability with the mCherry as an internal control for transfection and translational efficiency. We observed a significant reduction in GFP intensity in cells expressing CAMK2AH477Y and CAMK2AH477X as compared to wild-type CAMK2A or GFP alone (Figure 3E) despite comparable mCherry fluorescence levels. This reduction was rescued when we treated the cells with MG132, which blocked proteasomal degradation. MG132 treamentled to enhanced accumulation of the p.H477Y and p.H477X mutant, with a greater effect on p.H477X (Figure 3F, lane 3, 4 vs lane 7, 8, Figure 3—figure supplement 1B). By contrast, the level of the wild-type protein was reduced, likely due to the toxic effects of MG132 (Figure 3F, lane 2 vs. lane 6). These results suggest that in addition to causing reduced holoenzyme assembly, the p.H477Y mutation might also directly or indirectly reduce the overall CAMK2A levels by compromising its half-life. To unequivocally demonstrate the pathogenicity of the p.H477Y allele in vivo, we performed rescue experiments using C. elegans. A single ortholog of CAMK2, encoded by unc-43, is present in the worm genome and its functions in the nervous system are welldocumented (Reiner et al., 1999). To study the neuronal defects caused by loss of unc-43, we focused on motor neuron, DA9, which has its cell body located in the pre-anal ganglion with a dendrite that extends anteriorly and a posteriorly oriented axon extending via a commissure into the dorsal nerve cord, where it proceeds anteriorly to form approximately 25 en passant synapses onto body wall muscles and reciprocal inhibitory neurons (Figure 4A) (Klassen and Shen, 2007; Maeder et al., 2014). Using mCherry-tagged UNC-43, we observed that UNC-43 could be found along the entire DA9 neuron but concentrated at synaptic boutons (Figure 4B). The homologous patient-specific mutation p.H466Y in UNC-43 (homologous to p.H477Y in human CAMK2A) significantly disrupted the synaptic localization of UNC-43 and caused the protein to be dispersed throughout the entire axon (Figure 4B). To test the consequence of UNC-43 mutation on DA9 synaptic function, we used the itr-1 pB promoter to express the fluorescently conjugated synaptic vesicle marker RAB-3 (RAB3::GFP) within DA9 in both the wild-type and unc-43 mutant background. In wild-type animals, RAB-3::GFP accumulated in discrete puncta along the axon of DA9 at stereotyped synaptic locations. In the canonical unc-43(e408) loss-of-function mutant, we observed a reduction in individual pre-synaptic puncta fluorescence intensity as compared to wild-type animals. This phenotype could be rescued by cell-autonomous expression of wild-type unc-43 in DA9. However, expression of unc-43 harboring the homologous patient mutation UNC-43H466Y failed to rescue this defect (Figure 4C,D). In addition, transgenic expression of human wild-type CAMK2A fully rescued this defect, confirming the high degree of functional conservation between CAMK2A homologs, while the patient-derived human CAMK2AH477Y failed to do so (Figure 4C, bottom panels). These results suggest that the p.H477Y mutation is defective in supporting pre-synaptic function in C. elegans.
Figure 4.

CAMK2AH477Y mutant fails to rescue synaptic defects in unc-43 C. elegans neurons.

(A) Schematic drawing of C. elegans motor neuron, DA9 in the tail region. DA9 extends a dendrite (red) anteriorly and an axon (blue) that extends posteriorly crosses the midline of the animal and anteriorly in the dorsal nerve cord (DNC). It forms approximately 20 en passant synapses within a discrete stretch along the DNC (blue box). DA9 presynaptic vesicles were marked with RAB-3 (GFP::RAB-3). The asynaptic region (yellow box) is devoid of any synaptic vesicle accumulation. (B) The localization of mCherry::UNC-43 and mCherry::UNC-43(H466Y) in DA9 synapses. Note that UNC-43 accumulates at synaptic boutons while UNC-43(H466Y) is diffusely localized. Fluorescent intensity of mCherry::UNC-43 was measured at synaptic boutons and along the axonal shaft. Graph plots the ratio of fluorescence intensity at synaptic boutons compared to the axonal shaft of 30 synapses from three animals. Graph shows the mean and error bars show SEM, ***p-value 6.32e−19, Student’s T-test. (C) Representative confocal images demonstrating presynaptic puncta size changes between WT and unc-43(e408) mutants. unc-43 mutants have smaller presynaptic puncta along the DNC. This defect is rescued by expression of either UNC-43 or CAMK2A in DA9 whilst the mutated UNC-43H466Y and CAMK2AH477Y fail to rescue. (D) Quantification of average puncta intensity from WT and unc-43(e408) animals. Error bars represent SEM with number of synaptic puncta quantified n > 80, N.S. is not significant, ***p-value<0.001 (uninjected vs unc-43 p-value 5.0e8, uninjected vs unc-43 p-value 4.17, uninjected vs CAMK2A p-value 4.25e−12, uninjected vs CAMK2A p-value 9.40), One-Way ANOVA with Bonferroni posthoc test. (E) Representative confocal images showing mislocalization of GFP::RAB-3 into the asynaptic region (yellow box) in unc-43 DA9 neuron. (F) Rescue of the unc-43(e408) phenotype by DA9 cell-specific expression of UNC-43 or CAMK2A. UNC-43H466Y and CAMK2AH477Y fail to rescue the unc-43 phenotype. Graph shows the percentage of animals with the WT and unc-43 mutant phenotypes. ***p<0.001 (unc-43 vs unc-43 p-value 2.13e−51, CAMK2A vs CAMK2AH477Y p-value 3.77e−50), Fisher Exact test with n = 100 animals scored for each line. (G) Behavioral rescue by expressing wild-type UNC-43 or UNC-43H466Y in unc-43(e408) mutants. The behavior was scored as either wild-type or unc-43. Two independent worm lines were analyzed for each condition. *** p-value 5.29e−41, Fisher Exact test with n = 100 animals scored for each line.

CAMK2AH477Y mutant fails to rescue synaptic defects in unc-43 C. elegans neurons.

(A) Schematic drawing of C. elegans motor neuron, DA9 in the tail region. DA9 extends a dendrite (red) anteriorly and an axon (blue) that extends posteriorly crosses the midline of the animal and anteriorly in the dorsal nerve cord (DNC). It forms approximately 20 en passant synapses within a discrete stretch along the DNC (blue box). DA9 presynaptic vesicles were marked with RAB-3 (GFP::RAB-3). The asynaptic region (yellow box) is devoid of any synaptic vesicle accumulation. (B) The localization of mCherry::UNC-43 and mCherry::UNC-43(H466Y) in DA9 synapses. Note that UNC-43 accumulates at synaptic boutons while UNC-43(H466Y) is diffusely localized. Fluorescent intensity of mCherry::UNC-43 was measured at synaptic boutons and along the axonal shaft. Graph plots the ratio of fluorescence intensity at synaptic boutons compared to the axonal shaft of 30 synapses from three animals. Graph shows the mean and error bars show SEM, ***p-value 6.32e−19, Student’s T-test. (C) Representative confocal images demonstrating presynaptic puncta size changes between WT and unc-43(e408) mutants. unc-43 mutants have smaller presynaptic puncta along the DNC. This defect is rescued by expression of either UNC-43 or CAMK2A in DA9 whilst the mutated UNC-43H466Y and CAMK2AH477Y fail to rescue. (D) Quantification of average puncta intensity from WT and unc-43(e408) animals. Error bars represent SEM with number of synaptic puncta quantified n > 80, N.S. is not significant, ***p-value<0.001 (uninjected vs unc-43 p-value 5.0e8, uninjected vs unc-43 p-value 4.17, uninjected vs CAMK2A p-value 4.25e−12, uninjected vs CAMK2A p-value 9.40), One-Way ANOVA with Bonferroni posthoc test. (E) Representative confocal images showing mislocalization of GFP::RAB-3 into the asynaptic region (yellow box) in unc-43 DA9 neuron. (F) Rescue of the unc-43(e408) phenotype by DA9 cell-specific expression of UNC-43 or CAMK2A. UNC-43H466Y and CAMK2AH477Y fail to rescue the unc-43 phenotype. Graph shows the percentage of animals with the WT and unc-43 mutant phenotypes. ***p<0.001 (unc-43 vs unc-43 p-value 2.13e−51, CAMK2A vs CAMK2AH477Y p-value 3.77e−50), Fisher Exact test with n = 100 animals scored for each line. (G) Behavioral rescue by expressing wild-type UNC-43 or UNC-43H466Y in unc-43(e408) mutants. The behavior was scored as either wild-type or unc-43. Two independent worm lines were analyzed for each condition. *** p-value 5.29e−41, Fisher Exact test with n = 100 animals scored for each line. Immediately posterior to the stretch of presynaptic puncta is an asynaptic domain within the DA9 axon that is devoid of any RAB-3::GFP fluorescence in wild-type animals (Figure 4E, top panel). Loss of unc-43 results in the mislocalization of the synaptic marker RAB3::GFP into this asynaptic region (Figure 4E, bottom panel). This defect could also be rescued by cell autonomous expression of either unc-43 or human CAMK2A. Patient derived mutation CAMK2AH477Y or the worm homologous mutation UNC-43H466Y both failed to rescue this phenotype (Figure 4E). In addition, expression of UNC-43H466Y in wild-type animals did not cause any synaptic defect or mislocalizaton of RAB3::GFP, suggesting that the mutation does not have dominant negative effects (Figure 4F). We further tested if the patient derived mutation in CAMK2A impacted worm locomotor behavior. Null mutants for unc-43 are flaccid in posture and move with a flattened uncoordinated waveform. The animals are variably convulsive, often spontaneously contracting and relaxing their body-wall muscles in brief repeating bursts that resemble seizures (Reiner et al., 1999). We expressed either wild-type UNC-43 or UNC-43H466Y in the muscles and neurons of unc-43(e408) mutant worms and scored the behavior of young adults in a double-blind experiment. Only the wildtype UNC-43 was able to rescue the movement defects in unc-43(e408) animals, but not UNC-43H466Y, suggesting that UNC-43H466Y is not functional (Figure 4G). Together, the data show that CAMK2AH477Y is a loss-of-function mutation which fails to support synaptic function in vivo. In summary, we have identified an autosomal recessive neurodevelopmental syndrome characterized by growth delay, frequent seizures and severe intellectual disability that is caused by a biallelic germline loss-of-function mutation in CAMK2A. Mechanistically this mutation disrupts CAMK2A self-oligomerization and holoenzyme assembly via its association domain. Our functional results are consistent with the high degree of evolutionary conservation of the affected residue H477 in CAMK2A orthologs, as well as previous structural data demonstrating that His477 is located in the interface between two stacked CAMK2A subunits, which together form the basic repeat unit of the ring-shaped holoenzyme (Bhattacharyya et al., 2016; Stratton et al., 2014). The pathogenicity of the biallelic p.H477Y mutation is furthered highlighted by rescue experiments in C. elegans, where in contrast to wild-type human CAMK2A the p.H477Y mutant failed to rescue the neuronal and behavioral defect in unc-43 (CAMK2 ortholog) null worms. Together, these data demonstrate that the loss of function of CAMK2A is the most plausible genetic cause for the neurodevelopmental defects observed in the two affected siblings.

Discussion

CAMK2 plays important and evolutionary conserved roles in synaptic plasticity, neuronal transmission and cognition in near all model organisms examined, and several groups have shown that somatic mutations in human CAMK2 isoforms may contribute to neurological disorders (Ghosh and Giese, 2015; Robison, 2014; Takemoto-Kimura et al., 2017). Notably, a de novo p.E183V mutation in the CAMK2A catalytic domain was shown to cause autism spectrum disorder (Stephenson et al., 2017). This mutation was shown to act in a dominant-negative manner to reduce wild-type CAMK2A auto-phosphorylation and localization to dendritic spines. While this manuscript was under revision, S. Küry et al. reported multiple families with intellectual disability caused by de novo, heterozygous mutations in both CAMK2A and CAMK2B kinase and auto-regulatory domains, which disrupted CAMK2 phosphorylation and caused neuronal migratory defects in murine models (Küry et al., 2017). Our discovery of a novel neuro-developmental syndrome caused by biallelic CAMK2A mutations further broadens the spectrum of human neurological disorders caused by the CAMK2 family of kinases. To the best of our knowledge, this represents the first Mendelian human disease caused by biallelic CAMK2A mutations. Our functional characterization of the novel mutation p.H477Y in vitro and in vivo also reveal novel insights on how the CAMK2A holoenzyme regulates neuronal function. In contrast to all previously reported mutations in CAMK2A in intellectual disability syndromes, the p.H477Y is located within the C-terminal association domain and results in a partial but significant disruption of self-oligomerization, suggesting that the assembly of CAMK2A oligomers, in addition to its kinase function is required for neuronal function. Interestingly, the CAMK2AH477Y mutant retains the ability to interact with wild-type CAMK2A but not with itself (Figure 3D). CAMK2A displays very specific cellular and subcellular expression patterns that is important for regulating substrate phosphorylation in cells (Liu and Murray, 2012; Tsui et al., 2005). The p.H477Y missense affects the subcellular localization in neurons and this may affect its ability to function efficiently. These biochemical results provide a mechanistic basis for the autosomal recessive nature of the disease in our family: the p.H477Y allele is hypomorphic and becomes pathogenic when recessively inherited in the homozygous state. We speculate that heterozygous carriers retain sufficient CAMK2A activity for proper neuronal function. As compared to the milder disease phenotypes reported by Kury et. al., the symptoms afflicting the p.H477Y patients likely represent the most severe manifestation of the CAMK2A dysfunction in humans. Due to the high degree of conservation of CAMK2A across evolution, we employed the established C. elegans unc-43 mutant to prove the pathogenicity of the p.H477Y mutation. UNC-43 is the worm homologue of vertebrate CAMK2. We demonstrated wild-type human CAMK2A could rescue the locomotive defects of the unc-43 mutants, while the p.H477Y mutant failed to do so, likely due to its inability to localize into neuronal synapses (Figure 4). We anticipate this in vivo functional assay in C. elegans to be widely applicable to assess the pathogenicity of newly discovered CAMK2 alleles found in human diseases.

Materials and methods

Disease diagnosis and informed consent

Patients were identified and diagnosed by clinical geneticists at King Hussein Medical Centre, Amman, Jordan. Informed consent was obtained from the families for genetic testing in accordance with approved institutional ethical guidelines (Institute of Medical Biology, Singapore, A*STAR, Singapore, NUS-IRB reference code 10–051). For patients in Figure 1, informed consent to publish photographs and videos was obtained from parents. Genomic DNA samples were isolated from saliva using the Oragene DNA collection kit (OG-500, DNAGenotek) and a punch skin biopsy was taken from patient II.4.

Whole exome sequencing

Whole exome sequencing of proband II-1 was performed using the Illumina TruSeq Exome Enrichment Kit for exome capture using 1 ug of genomic DNA. Illumina HiSeq2000 High-output mode was used for sequencing as 100 bp paired-end runs at the UCLA Clinical Genomics Centre and at the UCLA Broad Stem Cell Research Centre as previously described (Hu et al., 2014). An average coverage of 34X was achieved across the exome with 87% of these bases covered at ≥10X. After filtering, a total of 73 homozygous, 125 compound heterozygous and 493 heterozygous variants were protein-changing variants with population minor allele frequencies < 1%.

Homozygosity mapping

Both parents and their five children were genotyped using Illumina Humancore-12v1 BeadChips following manufacturer’s instructions. Call rates were above 99%. Gender and relationships were verified using Illumina BeadStudio. Mapping was performed by searching for shared regions that are homozygous and identical-by-descent (IBD) in the two affected children using custom programs written in the Mathematica (Wofram Research, Inc.) data analysis software (Source code file 1 - IBD linkage program). Candidate regions were further refined by exclusion of common homozygous segments with any unaffected family members. The confidence criteria to identify IBD blocks were a minimum of 5 cM. We identified one shared candidate loci on chromosome 5.

Cell culture and plasmid transfection

HEK 293 T cells (ATCC Cat# CRL-3216, RRID:CVCL_0063, from Lab Stock) were cultured in DMEM media (Gibco) supplemented with 10% FBS. Cell line identity was authenticated by commercial human STR profiling with ATCC (ATCC, #135-XV). All cell lines used in this paper tested negative for mycoplasma using Lonza MycoAlert (Lonza LT07). For transient transfection, 6 × 105 cells per well were seeded in 6 well plates 24 hr before being transfected with Lipofectamine 2000 (ThermoFisher)-complexed plasmids in OPTIMEM (ThermoFisher). To construct the CAMK2A expression plasmids, human CAMK2A cDNA was PCR-amplified from ImageClone with AscI and PacI restriction sites and cloned into pCDNA3.1 with an N-terminal 3xFLAG or 3xHA tag. All CAMK2A mutants were generated using QuikChange XL (Agilent). Cells were treated with MG132 (Sigma, M8699) at 5 µM to block proteasome degradation.

Generation of iPSCs

Control iPSCs from an unrelated but ethnically and sex-matched individual

Fibroblasts were transduced with OCT4, SOX2, KLF4 and c-MYC (Addgene plasmids #17225, #17226, #17227 were gifts from George Daley, and #18119 a gift from John Cleveland) as previously described (Park et al., 2008). After 4 days, transduced cells were reseeded onto irradiated mouse embryonic fibroblast in human ES cell medium (DMEM/F12 (Sigma, D6421) supplemented with 20% Knock Out Serum Replacement (Thermo Fisher Scientific, 10828–028), 0.1 mM 2-mercaptoethanol (Thermo Fisher Scientific, 21985–023), 2 mM L-glutamine (Thermo Fisher Scientific, 25030), 0.2 mM NEAA (Thermo Fisher Scientific, 11140–050) and 5 ng/mL bFGF (Stemgent, 03–0002). iPSC colonies were picked between days 17–28 and maintained in matrigel (Corning, 354234) and mTeSR1 (STEMCELL Technologies, 85850) for expansion.

Patient-derived iPSC from proband, II.4

Dermal primary fibroblasts were reprogrammed using the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific, A16517) in accordance with the manufacturer’s instructions. Cells were passaged and plated onto irradiated mouse embryonic feeders 7 days after viral transfection in human ES cell medium (DMEM/F12 (Sigma, D6421) supplemented with 20% Knock Out Serum Replacement (Thermo Fisher Scientific, 10828–028), 0.1 mM 2-mercaptoethanol (Thermo Fisher Scientific, 21985–023), 2 mM L-glutamine (Thermo Fisher Scientific, 25030), 0.2 mM NEAA (Thermo Fisher Scientific, 11140–050) and 5 ng/mL bFGF (Stemgent, 03–0002). iPSC colonies were picked between days 17–28 and maintained in Matrigel Basement Membrane Matrix (Corning, 354234) and mTeSR1 (STEMCELL Technologies, 85850) for expansion.

Neuronal differentiation and Multi-electrode Array Recordings

iPSCs-derived NPCs were differentiated into neurons for 21 days using a previously published protocol (Xu et al., 2017a). Briefly, NPCs were plated at a density of 50,000 cells/cm2 in a poly-L-ornithine and laminin-coated plates, cultured in N2B27 medium supplemented BDNF (20 ng/ml), GDNF (20 ng/ml), cAMP (N6,2’-O-dibutyryladenosine 3’,5’-cyclic monophosphate; Sigma; 0.3 mM) and ascorbic acid (0.2 mM). H1 embryonic stem cells (Gift from Lawrence W. Stanton, WiCell, RRID:CVCL_C813) were also differentiated into neurons to use as controls. H1 embryonic stem cells were verified by karyotyping (Cytogenetics Laboratory, KK Women's and Children's Hospital, Singapore) and checked for pluripotency by differentiation into the three germ layers marked by Nestin (ectoderm), AFP (endoderm) and ASM-1 (mesoderm). For the immunofluorescence staining, neurons were fixed for 15 min in ice cold 4% (w/v) paraformaldehyde. Permeabilization using 0.3% (v/v) Triton-X in 1X PBS was performed for 10 min then incubated with 1:1000 mouse anti-Tuj1 (Covance Research Products Inc Cat# MMS-435P, RRID:AB_2313773), 1:1500 guinea pig anti-MAP2 (Synaptic Systems Cat# 188 004, RRID:AB_2138181) overnight at 4°C in 5% (w/v) BSA diluted with 1X PBS. For visualization, 1:1000 secondary antibody conjugated to Alexa Fluor 594 (Thermo Fisher Scientific Cat# A-11076, RRID:AB_2534120) or Alexa Fluor 488 (Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069) was applied. Counter staining for nuclei were performed using Dapi. Images were captured using the FV3000 Olympus confocal. For the multi-electrode array (MEA) recordings, neurons on day 21 were dissociated and replated on 0.1 polyethylenimine (Sigma)-coated 48 well MEA plates (Axion Biosystems) in BrainPhys media supplemented with BDNF, GDNF, cAMP and ascorbic acid as previously described (Xu et al., 2017b). Spontaneous neuronal activity was observed and recorded at 37°C for 5 min every 2–3 days using the Maestro MEA System (Axion Biosystem). Independent measurements were taken from seven wells for each condition (technical replicates).

In vitro transcription/translation and co-immunoprecipitation

CAMK2A proteins were synthesized in vitro using TNT T7 Quick Coupled Transcription/Translation (Promega) with 1 μg of plasmids in 20 μl reaction volumes for 90 mins at 30°C. For co-immunoprecipitation, the reactions were diluted 10x in TBS (100 mM Tris-HCl, pH = 8, 150 mM NaCl) with 1% Nonidet P40 (NP40) and incubated with 10 μl anti-FLAG M2 agarose beads (Sigma) at 4°C overnight. Proteins were eluted with 1x Laemmli buffer after 3 washes in the 1xTBS with 1% NP40.

Protein electrophoresis and immunoblotting

Total protein lysate was quantified using a standard Bradford assay and 10 μg of lysate was used for immunoblotting experiments. For Blue Native PAGE, cells were lysed in 1x Sample Preparation buffer (ThermoFisher) containing 1% digitonin. 1% SDS was supplemented for SDS-PAGE. All proteins were transferred to PVDF membranes using TurboBlot (Bio-rad) at 2.5 mA for seven mins. The primary antibodies used were anti-FLAG (M2, Sigma-Aldrich Cat# F3165, RRID:AB_259529), anti-GAPDH (Santa Cruz Biotechnology Cat# sc-47724, RRID:AB_627678) and anti-HA (Y-11, Santa Cruz Biotechnology Cat# sc-805, RRID:AB_631618). The secondary antibodies were anti-rabbit IgG-HRP (Jackson ImmunoResearch Labs Cat# 111-035-003, RRID:AB_2313567), anti-mouse IgG-HRP (light chain specific) (Jackson ImmunoResearch Labs Cat# 205-032-176, RRID:AB_2339056) and anti-mouse IgG-HRP (Jackson ImmunoResearch Labs Cat# 115-035-003, RRID:AB_10015289).

Worm strains

All strains were maintained at 20°C on OP50 E. coli nematode growth medium plates as described (Brenner, 1974). N2 Bristol strain worms (WB Cat# CB4852, RRID:WB-STRAIN:CB4852) were used as the WT reference, and the unc-43(e408) mutant was used. To visualize synaptic vesicles in DA9 neuron, wyIs85 [Pitr-1::GPF::RAB-3] was used (Klassen and Shen, 2007).

Transgenic lines

OTL70 wyIs85[Podr-1::dsred, Pitr-1::gfp::rab-3]; jpnEx40[Podr-1::gfp, Pmig-13::unc-43] OTL71 wyIs85; jpnEx41[Podr-1::gfp, Pmig-13::unc-43] OTL72 unc-43(e408); wyIs85; jpnEx44[Podr-1::gfp, Pmig-13::unc-43(H466Y)] OTL73 unc-43(e408); wyIs85; jpnEx45[Podr-1::gfp, Pmig-13::unc-43(H466Y)] OTL74 unc-43(e408); wyIs85; jpnEx42[Podr-1::gfp, Pmig-13::unc-43] OTL75 unc-43(e408); wyIs85; jpnEx43[Podr-1::gfp, Pmig-13::unc-43] OTL76 unc-43(e408); wyIs85; jpnEx47[Podr-1::gfp, Pmig-13::CAMK2A] OTL77 unc-43(e408); wyIs85; jpnEx48[Podr-1::gfp, Pmig-13::CAMK2A] OTL78 unc-43(e408); wyIs85; jpnEx49[Podr-1::gfp, Pmig-13::CAMK2AH477Y] OTL79 unc-43(e408); wyIs85; jpnEx50[Podr-1::gfp, Pmig-13::CAMK2AH477Y]] OTL82: jpnEx54[Podr-1::gfp, Pmig-13::mcheery::unc-43] OTL83: jpnEx55[Podr-1::gfp, Pmig-13::mcherry::unc-43] OTL84: jpnEx56[Podr-1::gfp, Pmig-13::mcherry::unc-43(H466Y)] OTL85: jpnEx57[Podr-1::gfp, Pmig-13::mcherry::unc-43(H466Y)] OTL86: unc-43(e408); jpnEx58[Punc-122::dsred, Punc-104::mcherry::unc-43, Phlh-1::mcherry::unc-43] OTL87: unc-43(e408); jpnEx59[Punc-122::dsred, Punc-104::mcherry::unc-43, Phlh-1::mcherry::unc-43] OTL88: unc-43(e408); jpnEx60[Punc-122::dsred, Punc-104::mcherry::unc-43(H466Y), Phlh-1::mcherry::unc-43(H466Y)] OTL89: unc-43(e408); jpnEx61[Punc-122::dsred, Punc-104::mcherry::unc-43(H466Y), Phlh-1::mcherry::unc-43(H466Y)]

Plasmids for transgenic expression in worms

Expression plasmids for transgenic worm lines were made using the pSM vector (C. Bargmann), a derivative of pPD49.26 (A. Fire). The mig-13 promoter was cloned between SphI/AscI, and C.elegans unc-43 isoform d or human CAMK2α was cloned between NheI/KpnI or AscI/NheI, respectively. P.H466Y and p.H477Y mutations were introduced by PCR-based mutagenesis using KOD-plus- high fidelity DNA polymerase (TOYOBO, Tokyo, Japan). Transgenic worms were generated as described (Mello, 1995). Plasmids were injected into animals at 10 ng/μl (in the case of Pmig-13::unc-43) and 50 ng/μl (in the case of Pmig-13::CAMK2α) together with coinjection markers at 90 ng/μl.

Fluorescence quantification and confocal imaging

All fluorescence images of DA9 were taken in live worms immobilized with 5% agar pad, 10 μM levamisol (Sigma) and 0.1 mm polystylene beads (Polysciences, Inc., Warrington, PA, USA) with a 63×/1.4 NA objective on a Zeiss Axioplan 2 Imaging System or a Plan-Apochromat 63×/1.3 objective on a Zeiss LSM710 confocal microscope using similar imaging parameters for the same marker across different genotypes. Fluorescence quantification was determined using Image J software (ImageJ, RRID:SCR_003070).

Behavioral analysis

mcherry::unc-43 or mcherry::unc-43(H466Y) were expressed in unc-43(e403) mutant worms using both unc-104 promoter (neuron-specific promoter) and hlh-1 promoter (muscle-specific promoter). Two independent lines were established and analyzed. The behavioral phenotype of the transgenic worms was scored in a double-blind manner using a stereo microscope (SZX16, Olumpus, Tokyo, Japan). From the movement behavior on OP50 feeder NGM plates, each worm was classified to behave like ‘wild-type’ or ‘unc-43’. 100 worms were observed for each genotype on the same day from two independently derived transgenic lines. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "A homozygous loss-of-function CAMK2A mutation causes growth delay, frequent seizures and severe intellectual disability" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and K VijayRaghavan as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Karl Giese (Reviewer #1); A.J Robison (Reviewer #3). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. All reviewers have substantive comments, most of which are non-overlapping. Some of the comments require you to carry out new experiments. For submitting a revised version, it is essential that you address all the comments of all the reviewers. Along with your revised submission, please attach a point-by-point statement of the actions taken by you. If you disagree with any of the points raised by the reviewers, please state so with justification in your actions-taken-report. Reviewer #1: This manuscript is of fundamental importance for the CaMKII field, as for the first time it makes a convincing case that CaMKII dysfunction is relevant for brain diseases. The strength of the manuscript is that a family is described where two children are homozygous for a missense mutation in CaMKIIalpha. Biochemical characterisation of the missense mutation strongly suggests that this mutation causes loss-of function, by not only preventing oligomerisation of CaMKIIalpha subunits, but also mislocalising CaMKIIalpha to the nucleus and enhancing the proteasomal dedragation of the kinase subunits. I think that this work is important that it deserves to be published in eLife. I have some suggestions that can further strengthen the manuscript: 1) I could not find any data regarding impaired intellectual disability. If possible, could such data be included? 2) Regarding the table in Figure 1—figure supplement 1, it would be amazing if data for heterozygous and wild-type children could be included. This would provide very strong evidence that specifically the missense mutation causes the observed phenotypes. Would you have patient consent to include such information? 3) The authors found that the identified missense mutation mislocalizes CaMKIIalpha to nucleus in a non-neuronal cell line. If possible, it would be good to show that this also happens in primary neurons. This would suggest that CaMKIIalpha with the missense mutation is not delivered to synapses, substantially blocking synaptic plasticity. 4) Unfortunately, the presented in vivo studies with C. elegans focus on the wrong neuronal cell type. In mammals CaMKIIalpha is expressed exclusively in glutamatergic neurons (not cholinergic motoneurons). Therefore, I think that Figure 2 must be removed from the manuscript, as the findings are misleading. -- In my opinion, for this manuscript it is not necessary to include in vivo data. However, if authors wish to include in vivo data, then they should focus on the correct neuronal cell type in any in vivo system. Reviewer #2: Chia and colleagues have authored a potentially important manuscript identifying an association between a novel homozygous missense mutation in CAMK2A and global neurodevelopmental delay with severe intellectual disability, seizures, and delayed growth. Although interesting, a number of major issues need to be addressed: 1) Substantially more details are required regarding the genetic analysis, in order to better establish the likely causality of the candidate CAMK2A mutation. In particular, the workflow by which the proposed causative variant has been identified needs to be much better clarified. a) Can the authors provide additional pedigree data regarding the parental consanguineous relationship? If not, then on what basis are the parents reported as consanguineous? b) The authors should provide the genome-wide results of the homozygosity mapping prior to filtering out homozygous segments found in the unaffected family members, and prior to filtering for regions of homozygosity >5cM. c) On what basis have the authors established the "confidence criteria to identify IBD blocks were a minimum of 5 cM"? d) Regarding the variants identified by exome sequencing, the authors should minimally provide a list of all 72 homozygous protein-coding variants with MAF<1%, and sufficient information to determine their localization within the regions of homozygosity in all of the genotyped family members. 2) Functional experiments: a) The authors convincingly establish that the H477Y mutation blocks oligomerization of the CAMK2A holoenzyme. However, they subsequently attempt to evaluate protein stability using MG132. I have some difficulties with this experiment. Specifically, how can it be that in the DMSO treated lysates (Figure 2—figure supplement 2C), such big differences are found between the different CAMK2A construct expression levels, whereas in Figure 1H the expression levels are similar? Was each experiment done at different time points after transfection? How do the authors control for transfection efficiency? Based on the results shown here, in the absence of a demonstration that the transfection efficiency was equal across the various constructs, it is difficult to reach a firm conclusion regarding the stability or expression levels of CAMK2A [H477Y]. b) Figure 2C and 2E: The images provided are consistent with a rescue of the synaptic phenotype when expressing either Unc-43 or wild-type human CAMK2, but not with the H477Y mutant. However, the experimental design is unclear. The legend reports n>80 (Figure 2C) and n=100 (Figure 2E). But what does 'n' represent (e.g., is this the number of puncta, images, or worms measured)? For Figure 2C, why is it not possible to provide an exact value? c) Figure 2C: Why do the authors use a Student's t-test for these data? If they want to compare the different conditions, a one-way ANOVA with post-hoc correction should be applied. d) Figure 2D: By what criteria have the authors defined the asynaptic region? e) The Unc-43 worm has clear phenotypes, as the authors themselves describe in the Results section: "Null mutants for unc-43 are flaccid in posture and move with a flattened uncoordinated waveform." These phenotypes are very clear. Why didn't they try rescuing these phenotypes? This would have provided a much stronger opportunity to assess the functional relevance of the rescue experiments. f) What is the relevance of examining the localization of the association domain? The authors reason that since the mutation blocks oligomerization, it is more likely to diffuse through the nuclear pore, thereby reducing cytosolic accumulation. But does the association domain itself oligomerize in HEK293T cells? The authors seem to infer on the basis of these experiments that CAMK2A is likely to be mislocalized in the homozygous H477Y carriers. However, they would need to show the same experiment using full-length reference and mutant CAMK2A in order to establish more definitive evidence. Reviewer #3: The manuscript "A homozygous loss-of-function CaAMK2A mutation causes loss of growth, frequent seizures, and severe intellectual disability" uses sequencing of patient DNA, biochemistry, and C. elegans phenotyping to characterize a novel coding mutation preventing holoenzyme formation in CaMKIIalpha protein in humans. The authors demonstrate that an autosomal recessive mutation in a histidine residue critical for association domain interactions is associated with disease state in a human family, then go on to use traditional biochemistry to show that this mutant kinase forms interactions with WT but not with itself, a finding beautifully consistent with the recessive nature of the disease state. Further, they use a rescue strategy in a C. elegans model lacking expression of the CaMKII homolog to show that neither the human nor the worm kinase with this mutation can rescue worm phenotype, while either WT kinase does so. Because CaMKII has long been associated with cognition through mostly mouse studies but has never before been directly and causally tied to a human cognitive disorder, this is a very exciting finding that will help to validate and reinvigorate study of this essential molecule. The paper is clear and well-written, the experiments directly address the hypotheses and are appropriately interpreted (for the most part – see below), and the findings are certain to strongly impact the field. I have some minor concerns below about interpretation and mechanism, and one somewhat larger concern: The C. elegans experiments are very convincing. However, I wonder whether the mutant and WT CaMKII proteins used in the rescue experiments have the same localization. This ought to be very easy to determine by immunofluorescence, even if the constructs aren't tagged. Does the mutant accumulate in the nucleus of the C. elegans neurons as it does in HEK cells? Does the WT adopt a postsynaptic localization? Data such as these would greatly strengthen the manuscript. Overall, I am highly enthusiastic about this manuscript. Reviewer #1: This manuscript is of fundamental importance for the CaMKII field, as for the first time it makes a convincing case that CaMKII dysfunction is relevant for brain diseases. The strength of the manuscript is that a family is described where two children are homozygous for a missense mutation in CaMKIIalpha. Biochemical characerisation of the missense mutation strongly suggests that this mutation causes loss-of function, by not only preventing oligomerisation of CaMKIIalpha subunits, but also mislocalising CaMKIIalpha to the nucleus and enhancing the proteasomal degradation of the kinase subunits. I think that this work is important that it deserves to be published in eLife. I have some suggestions that can further strengthen the manuscript: 1) I could not find any data regarding impaired intellectual disability. If possible, could such data be included? The clinicians cannot obtain a definitive IQ test since both affected siblings are non-verbal and do not respond to verbal cues. We believe that the supplementary videos do convey the extent and severity of the ID in both affected siblings. 2) Regarding the table in Figure 1—figure supplement 1, it would be amazing if data for heterozygous and wild-type children could be included. This would provide very strong evidence that specifically the missense mutation causes the observed phenotypes. Would you have patient consent to include such information? We have confirmed that the healthy siblings (who are either heterozygous or non-carrier for the CAMK2A H477Y allele) do not display any signs of neuro-developmental delay. We have updated the clinical table in Figure 1—figure supplement 1 to include all five siblings. 3) The authors found that the identified missense mutation mislocalizes CaMKIIalpha to nucleus in a non-neuronal cell line. If possible, it would be good to show that this also happens in primary neurons. This would suggest that CaMKIIalpha with the missense mutation is not delivered to synapses, substantially blocking synaptic plasticity. We have significantly revised our initial biochemical analyses of overexpressed CAMK2A mutant. In the initial submission, the nuclear localization was shown using GFP-tagged to the CAMK2A association domain, but not with the full length CAMK2A protein. We did not mean to claim that full length CAMK2A would mislocalize in vivo. Instead, we simply used nuclear exclusion as an in vitro assay to test the oligomerization of CAMK2A association domain. We have removed these data to avoid any confusion and replaced them with a more rigorous functional experiment using neurons derived from the proband’s iPS cells. These new results demonstrate a profound impairment in neuronal activity in patient’s neurons that are cultured in vitro (Figure 2) suggesting that endogenous CAMK2AH477Y is most likely dysfunctional. We have attempted to decipher the localization of endogenous CAMK2A by immunofluorescence in iPSC-derived neurons. However, all five commercial CAMK2A antibodies tested failed to give a single band by Western blot using lysates from wild-type neurons (Author response image 1). Likewise, these antibodies could not reflect the synaptic localization of wild-type CAMK2A in iPSC-derived neurons using IF. We therefore could not carry out a rigorous evaluation of the localization of the CAMK2AH477Y in iPSCs-derived neurons.
Author response image 1.
4) Unfortunately, the presented in vivo studies with C. elegans focus on the wrong neuronal cell type. In mammals CaMKIIalpha is expressed exclusively in glutamatergic neurons (not cholinergic motoneurons). Therefore, I think that Figure 2 must be removed from the manuscript, as the findings are misleading. -- In my opinion, for this manuscript it is not necessary to include in vivo data. However, if authors wish to include in vivo data, then they should focus on the correct neuronal cell type in any in vivo system. We understand your concern that in mammals, CAMK2A is mostly found in glutamatergic neurons. In vertebrates, CAMKII isoforms are encoded by at least four genes (⍺, β, γ, δ). In the worm, the unc-43 gene encodes only one CaMKII orthologue which is found in all neurons. Mutations in unc-43 cause multiple behavioral defects in locomotory activity, in the clock control of defecation, in the regulation of body-wall muscle excitation and spontaneous activity (David et al., 1999). Thus in C. elegans, unc-43 can perform all these functions regardless of the neuronal cell type in which it is expressed. CAMK2 is highly conserved from humans to worm. We show in Figure 4C and 4F that the human CAMK2A orthologue is able to fully rescue synaptic defects due to the loss of unc-43 in the DA9 neuron. This indicates that the human CAMK2A functions similarly in cholinergic neurons of C. elegans. More importantly, the identified patient mutation p.H477Y when introduced in either UNC-43 or CAMK2A, is unable to rescue the unc-43 synaptic defects. To further strengthen this data, we have performed behavioural rescue experiments by expressing either wildtype or H466Y mutated UNC-43 protein in worms defective for unc-43. We have used a pan-neuronal promoter to express UNC-43 in all neurons and scored the phenotype in a double-blind experimental setup. Consistently, we observe that the wildtype UNC-43, but not UNC-43H466Y, is able to fully rescue all behavioral defects of unc-43 worms. This is providing further evidence that the patient identified mutation renders CAMK2A non-functional in multiple in vivo assays. We believe the C. elegans data are key to prove the pathogenicity of this human allele. They are now complemented by functional assays using patient IPSCs-derived neurons (Figure 2). Reviewer #2: Chia and colleagues have authored a potentially important manuscript identifying an association between a novel homozygous missense mutation in CAMK2A and global neurodevelopmental delay with severe intellectual disability, seizures, and delayed growth. Although interesting, a number of major issues need to be addressed: 1) Substantially more details are required regarding the genetic analysis, in order to better establish the likely causality of the candidate CAMK2A mutation. In particular, the workflow by which the proposed causative variant has been identified needs to be much better clarified. We have included in this revised manuscript, a more detailed description of the pipeline, including IBD mapping, whole-exome sequencing and data filtering. We are adhering to our standard operating procedures which have allowed us to genetically diagnose numerous Mendelian disorders over the years (Reversade et al., 2009; Bonnard et al., 2012; Hu and Pomp, 2014; Cetinkaya and Xiong, 2016; Zhong et al., 2016; Gordon and Xue, 2017). a) Can the authors provide additional pedigree data regarding the parental consanguineous relationship? If not, then on what basis are the parents reported as consanguineous? We could not obtain additional medical record from members of the extended family. We confirm that parents are first cousins as stated by them during several clinical visits. This is independently verified from the SNP genotyping analysis of their 5 children. On average, 10% of the children’s genomes are homozygous- proving that their parents are at least first cousins. b) The authors should provide the genome-wide results of the homozygosity mapping prior to filtering out homozygous segments found in the unaffected family members, and prior to filtering for regions of homozygosity >5cM. These data are now provided in Supplemental file 1 and Figure 1—figure supplement 1D. c) On what basis have the authors established the "confidence criteria to identify IBD blocks were a minimum of 5 cM"? IBD regions <5 cM are likely to be false positives. According to Duran et al., (2014), "most 2–3 cM segments are erroneous and only segments longer than 5 cM have a negligible number of false positives". d) Regarding the variants identified by exome sequencing, the authors should minimally provide a list of all 72 homozygous protein-coding variants with MAF<1%, and sufficient information to determine their localization within the regions of homozygosity in all of the genotyped family members. These data are now provided in Figure 1—figure supplement 1E, with a thorough description in the text. Briefly, four homozygous variants from the proband’s exome were identified within the chromosome 5 IBD candidate block. Notably, homozygotes for these variants, except the CAMK2AH477Y allele, have been identified in public sequencing databases, such as ExAC and GnomAD, and therefore can be ruled out. 2) Functional experiments: a) The authors convincingly establish that the H477Y mutation blocks oligomerization of the CAMK2A holoenzyme. However, they subsequently attempt to evaluate protein stability using MG132. I have some difficulties with this experiment. Specifically, how can it be that in the DMSO treated lysates (Figure S2C), such big differences are found between the different CAMK2A construct expression levels, whereas in Figure 1H the expression levels are similar? Was each experiment done at different time points after transfection? How do the authors control for transfection efficiency? Based on the results shown here, in the absence of a demonstration that the transfection efficiency was equal across the various constructs, it is difficult to reach a firm conclusion regarding the stability or expression levels of CAMK2A [H477Y]. Thank you for encouraging us to improve these results. These experiments have been significantly revised with improved constructs consisting of a single cistronic T2A-mCherry cassette to control for both transfection and translation efficiency. These results are described in Figure 3E, 3F and Figure 2—figure supplement 2B. b) Figure 2C and 2E: The images provided are consistent with a rescue of the synaptic phenotype when expressing either Unc-43 or wild-type human CAMK2, but not with the H477Y mutant. However, the experimental design is unclear. The legend reports n>80 (Figure 2C) and n=100 (Figure 2E). But what does 'n' represent (e.g., is this the number of puncta, images, or worms measured)? For Figure 2C, why is it not possible to provide an exact value? We have made changes in the legend text to clarify the exact parameter of measurement for each experiment. For instance, “error bars represent SEM with number of synaptic puncta quantified n> 80” and “Graph shows the percentage of animals with the WT and unc-43 mutant phenotypes with n=100 animals scored for each line”. c) Figure 2C: Why do the authors use a Student's t-test for these data? If they want to compare the different conditions, a one-way ANOVA with post-hoc correction should be applied. The statistics for experiments comparing multiple conditions has been revised according to your suggestions. We have implemented a one-way ANOVA test with either Bonferroni post-hoc test or two-way ANOVA with Tukey post-hoc test. d) Figure 2D: By what criteria have the authors defined the asynaptic region? The asynaptic region is the defined as the part of the axon extending out from the DA9 cell body to the first en passant synapse located on the dorsal part of the axon. It has been shown that the positional information required to define this asynaptic region is controlled by lin-44/Wnt secreted by four hypodermal cells in the tail of the worm (Klassen and Shen, (2007). This asynaptic region of the axon is also defined by different synaptic vesicle transport dynamics as compared to the dendrite and distal axon of DA9 (Maeder et al., (2014). e) The Unc-43 worm has clear phenotypes, as the authors themselves describe in the Results section: "Null mutants for unc-43 are flaccid in posture and move with a flattened uncoordinated waveform." These phenotypes are very clear. Why didn't they try rescuing these phenotypes? This would have provided a much stronger opportunity to assess the functional relevance of the rescue experiments. We have carried out a behavioral rescue as shown Figure 3G: in contrast to UNC-43wild-type, UNC-43H466Y which is homologous to CAMK2AH477Y, completely failed to rescue the uncoordinated and convulsive phenotype of the mutant unc-43 worms. Thank you for suggesting this crucial experiment which provides further support to our initial observation. f) What is the relevance of examining the localization of the association domain? The authors reason that since the mutation blocks oligomerization, it is more likely to diffuse through the nuclear pore, thereby reducing cytosolic accumulation. But does the association domain itself oligomerize in HEK293T cells? We have removed these data to avoid any confusion. Our biochemical data using native PAGE and co-immunoprecipitation (Figure 3C,D) support the oligomerization defect when CAMK2A was expressed in 293T cells as well as when translated in vitro. The authors seem to infer on the basis of these experiments that CAMK2A is likely to be mislocalized in the homozygous H477Y carriers. However, they would need to show the same experiment using full-length reference and mutant CAMK2A in order to establish more definitive evidence. These experiments are now shown in Figure 3E and Figure 2—figure supplement 2B, with full length CAMK2A. We focused on the most striking difference, which was the reduction in overall level in mutant CAMK2A.
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (human)CAMK2A Calcium/Calmodulin Dependent Protein Kinase II AlphaUniprot: Isoform B (identifier: Q9UQM7-2)Q9UQM7-2
Gene (C. elegans)unc-43 Calcium/Calmodulin-Dependent Protein Kinase type IIProtein UNC-43 isoform d (Wormbase CDS K11E8.1d)K11E8.1d
Strain, strain background (C. elegans)Worm (C. elegans) N2 Bristol Strain;unc-43(e408)Caenorhabditis Genetics Center (CGC) PMID: 1794171117941711
Recombinant DNApCDH-CMV-MCS-EF1α-NeoSystems Biosciences (SBI)CD514B-1
Recombinant DNApSM vector (a derivative of pPD49.26 with additional cloning sites)Modified for this paperNAADDGENE https://media.addgene.org/cms/files/Vec95.pdf
Recombinant DNApCDH-CMV-CAMK2A-T2A-mCherryThis paper; based on pCDH-CMV-MCS-EF1α-NeoNA
Recombinant DNApMIG-hOCT4AddgenePlasmid #17225
Recombinant DNAMSCV h c-MYC IRES GFPAddgenePlasmid #18119
Recombinant DNApMIG-hKLF4AddgenePlasmid #17227
Recombinant DNApMIG-hSOX2AddgenePlasmid #17226
Cell line (human)Patient derived iPS neuronsThis paperNA
Cell line (human)293TLab stockNA
Chemical compound, drugMG132Sigma-AldrichM7449
Commercial kitNativeMark PAGEThermoFisherBN1002BOX
Commercial kitTnT Quick Coupled Transcription/Translation SystemPromegaL1170
AntibodyAnti-FLAG Clone M2Sigma-AldrichF3165
AntibodyAnti-HA Clone Y-11Santa Cruz Biotechnologysc-7392
AntibodyAnti-GADPHSanta Cruz Biotechnologysc-47724
AntibodyAnti-Tuj1Covance ResearchMMS-435P
AntibodyAnti-MAP2Synaptic Systems188 004
Cell culture reagent20% Knock Out Serum ReplacementThermo Fisher10828–028
Cell culture reagentbFGFStemgent37316
Cell culture reagentMatrigel Basement Membrane MatrixCorning354234
Cell culture reagentmTeSR1STEMCELL Technologies85850
Cell culture reagentCytoTune-iPS 2.0 Sendai Reprogramming KitThermoFisherA16517
Cell line (human)H1 embryonic stem cellsGift from Dr. Lawrence W. Stanton, WiCellRRID:CVCL_C813
AntibodyAlexa Fluor 594 secondary AbThermoFisherCat# A-11076, RRID:AB_2534120
AntibodyAlexa Fluor 488 secondary AbThermoFisherCat# A-11001, RRID:AB_2534069
Assay system/kitMaestro MEA SystemAxion Biosystem-
% of homozygosity in all children from family
ChildMb% homozygous
II-1309.410.3
II-2319.210.6
II-3378.212.6
II-4310.210.3
II-5183.16.1
  40 in total

1.  Alpha-CaMKII-dependent plasticity in the cortex is required for permanent memory.

Authors:  P W Frankland; C O'Brien; M Ohno; A Kirkwood; A J Silva
Journal:  Nature       Date:  2001-05-17       Impact factor: 49.962

Review 2.  Genetics and the investigation of developmental delay/intellectual disability.

Authors:  Myriam Srour; Michael Shevell
Journal:  Arch Dis Child       Date:  2013-12-16       Impact factor: 3.791

Review 3.  Go outside and see the proteasome. Protein degradation.

Authors:  J M Lord
Journal:  Curr Biol       Date:  1996-09-01       Impact factor: 10.834

4.  Diverse behavioural defects caused by mutations in Caenorhabditis elegans unc-43 CaM kinase II.

Authors:  D J Reiner; E M Newton; H Tian; J H Thomas
Journal:  Nature       Date:  1999-11-11       Impact factor: 49.962

5.  Wnt signaling positions neuromuscular connectivity by inhibiting synapse formation in C. elegans.

Authors:  Matthew P Klassen; Kang Shen
Journal:  Cell       Date:  2007-08-24       Impact factor: 41.582

6.  Aneuploidy causes proteotoxic stress in yeast.

Authors:  Ana B Oromendia; Stacie E Dodgson; Angelika Amon
Journal:  Genes Dev       Date:  2012-12-07       Impact factor: 11.361

7.  Reprogramming of human somatic cells to pluripotency with defined factors.

Authors:  In-Hyun Park; Rui Zhao; Jason A West; Akiko Yabuuchi; Hongguang Huo; Tan A Ince; Paul H Lerou; M William Lensch; George Q Daley
Journal:  Nature       Date:  2007-12-23       Impact factor: 49.962

8.  Modulation of calmodulin plasticity in molecular recognition on the basis of x-ray structures.

Authors:  W E Meador; A R Means; F A Quiocho
Journal:  Science       Date:  1993-12-10       Impact factor: 47.728

Review 9.  Structural studies on the regulation of Ca2+/calmodulin dependent protein kinase II.

Authors:  Margaret M Stratton; Luke H Chao; Howard Schulman; John Kuriyan
Journal:  Curr Opin Struct Biol       Date:  2013-04-27       Impact factor: 6.809

10.  Reversal of Phenotypic Abnormalities by CRISPR/Cas9-Mediated Gene Correction in Huntington Disease Patient-Derived Induced Pluripotent Stem Cells.

Authors:  Xiaohong Xu; Yilin Tay; Bernice Sim; Su-In Yoon; Yihui Huang; Jolene Ooi; Kagistia Hana Utami; Amin Ziaei; Bryan Ng; Carola Radulescu; Donovan Low; Alvin Yu Jin Ng; Marie Loh; Byrappa Venkatesh; Florent Ginhoux; George J Augustine; Mahmoud A Pouladi
Journal:  Stem Cell Reports       Date:  2017-02-23       Impact factor: 7.765

View more
  20 in total

1.  Variation in assembly stoichiometry in non-metazoan homologs of the hub domain of Ca2+ /calmodulin-dependent protein kinase II.

Authors:  Ethan D McSpadden; Zijie Xia; Chris C Chi; Anna C Susa; Neel H Shah; Christine L Gee; Evan R Williams; John Kuriyan
Journal:  Protein Sci       Date:  2019-04-17       Impact factor: 6.725

2.  Truncating biallelic variant in DNAJA1, encoding the co-chaperone Hsp40, is associated with intellectual disability and seizures.

Authors:  Saud Alsahli; Ahmed Alfares; Francisco J Guzmán-Vega; Stefan T Arold; Duaa Ba-Armah; Fuad Al Mutairi
Journal:  Neurogenetics       Date:  2019-04-10       Impact factor: 2.660

3.  CAMK2-Dependent Signaling in Neurons Is Essential for Survival.

Authors:  Martijn J Kool; Martina Proietti Onori; Nils Z Borgesius; Jolet E van de Bree; Minetta Elgersma-Hooisma; Enzo Nio; Karel Bezstarosti; Gabriëlle H S Buitendijk; Mehrnoush Aghadavoud Jolfaei; Jeroen A A Demmers; Ype Elgersma; Geeske M van Woerden
Journal:  J Neurosci       Date:  2019-05-07       Impact factor: 6.167

Review 4.  The Regulation of Microglial Cell Polarization in the Tumor Microenvironment: A New Potential Strategy for Auxiliary Treatment of Glioma-A Review.

Authors:  Lei Zhao; Dong-Gang Xu; Yu-Hua Hu
Journal:  Cell Mol Neurobiol       Date:  2022-02-08       Impact factor: 5.046

Review 5.  CaMKII: a central molecular organizer of synaptic plasticity, learning and memory.

Authors:  Ryohei Yasuda; Yasunori Hayashi; Johannes W Hell
Journal:  Nat Rev Neurosci       Date:  2022-09-02       Impact factor: 38.755

6.  Neuronal L-Type Calcium Channel Signaling to the Nucleus Requires a Novel CaMKIIα-Shank3 Interaction.

Authors:  Tyler L Perfitt; Xiaohan Wang; Matthew T Dickerson; Jason R Stephenson; Terunaga Nakagawa; David A Jacobson; Roger J Colbran
Journal:  J Neurosci       Date:  2020-02-04       Impact factor: 6.167

Review 7.  RNA transport and local translation in neurodevelopmental and neurodegenerative disease.

Authors:  Michael S Fernandopulle; Jennifer Lippincott-Schwartz; Michael E Ward
Journal:  Nat Neurosci       Date:  2021-01-28       Impact factor: 24.884

8.  Breakage of the oligomeric CaMKII hub by the regulatory segment of the kinase.

Authors:  Deepti Karandur; Moitrayee Bhattacharyya; Zijie Xia; Young Kwang Lee; Serena Muratcioglu; Darren McAffee; Ethan D McSpadden; Baiyu Qiu; Jay T Groves; Evan R Williams; John Kuriyan
Journal:  Elife       Date:  2020-09-09       Impact factor: 8.140

9.  A Micropatterned Human-Specific Neuroepithelial Tissue for Modeling Gene and Drug-Induced Neurodevelopmental Defects.

Authors:  Geetika Sahni; Shu-Yung Chang; Jeremy Teo Choon Meng; Jerome Zu Yao Tan; Jean Jacques Clement Fatien; Carine Bonnard; Kagistia Hana Utami; Puck Wee Chan; Thong Teck Tan; Umut Altunoglu; Hülya Kayserili; Mahmoud Pouladi; Bruno Reversade; Yi-Chin Toh
Journal:  Adv Sci (Weinh)       Date:  2021-01-06       Impact factor: 16.806

Review 10.  Structural Insights into the Regulation of Ca2+/Calmodulin-Dependent Protein Kinase II (CaMKII).

Authors:  Moitrayee Bhattacharyya; Deepti Karandur; John Kuriyan
Journal:  Cold Spring Harb Perspect Biol       Date:  2020-06-01       Impact factor: 9.708

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.