Alamandine attenuates hypertension and cardiac hypertrophy in hypertensive rats.

Oral administration of the peptide alamandine has antihypertensive and anti-fibrotic effects in rats. This work aimed to determine whether subcutaneous alamandine injection would attenuate hypertension and cardiac hypertrophy, and improve the function of a major target of hypertension-related damage, the left ventricle (LV), in spontaneously hypertensive rats (SHRs). This was examined in vivo in SHRs and normotensive rats subjected to 6-week subcutaneous infusion of alamandine or saline control, and in vitro in H9C2-derived and primary neonatal rat cardiomyocytes treated with angiotensin (Ang) II to model cardiac hypertrophy. Tail artery blood pressure measurement and transthoracic echocardiography showed that hypertension and impaired LV function in SHRs were ameliorated upon alamandine infusion. Alamandine administration also decreased the mass gains of heart and lung in SHRs, suppressed cardiomyocyte cross-sectional area expansion, and inhibited the mRNA levels of atrial natriuretic peptide and brain natriuretic peptide. The expression of alamandine receptor Mas-related G protein-coupled receptor, member D was increased in SHR hearts and in cardiomyocytes treated with Ang II. Alamandine inhibited the increases of protein kinase A (PKA) levels in the heart in SHRs and in cardiomyocytes treated with Ang II. In conclusion, the present study showed that alamandine administration attenuates hypertension, alleviates cardiac hypertrophy, and improves LV function. PKA signaling may be involved in the mechanisms underlying these effects.

Introduction

The left ventricle (LV) is one of the main targets of damage related to hypertension, which leads to LV structural changes and remodeling (Leung et al. 2016), and eventually heart failure (Rizzello et al. 2009). Cardiac hypertrophy and fibrosis are two of the most important changes observed during cardiac remodeling (Schiattarella and Hill 2015). Myocardial hypertrophy is characterized by increased heart weight and activation of genes such as atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) (Miteva et al. 2016).

The renin–angiotensin system (RAS) plays a crucial role in the pathological development of hypertension (Antoniak et al. 2014), but counter-regulatory mechanisms in response to activated RAS have also been found (Balakumar and Jagadeesh 2014). Angiotensin-converting enzyme (ACE2), a homolog of ACE, converts angiotensin (Ang) II into Ang-(1–7), which counteracts the pro-hypertensive effects of the canonical signaling axis of ACE–Ang II–Ang type 1 receptor (AT1R) (Patel et al. 2016).

Alamandine is a heptapeptide that can be generated from decarboxylation of Ang-(1–7). This peptide can perform many functions of Ang-(1–7) by interacting with Mas-related G protein-coupled receptor, member D (MrgD) (Lautner et al. 2013). In a previous study (Lautner et al. 2013), alamandine had antihypertensive effects when administered to spontaneously hypertensive rats (SHRs) orally as an inclusion compound with β-hydroxypropyl cyclodextrin. However, it is still unknown whether direct peripheral injection of alamandine could ameliorate hypertension and related cardiac phenotypes. More importantly, the effects of alamandine on cardiac hypertrophy and LV function remain to be determined in spontaneously hypertensive animal models.

The molecular signaling events downstream of cardiovascular system regulation by alamandine remained to be investigated. The activation of protein kinase A (PKA) was reported to trigger cardiac remodeling, which is characterized by changes in the cellular structure, size, and shape of the heart (Rababa’h et al. 2014). Norepinephrine (NE)-induced hypertrophy is associated with increased intracellular cAMP levels and PKA over-activation (Zhang et al. 2014). The phosphatidylinositol 3-kinase/protein kinase B (PI3 K/Akt) signaling pathway is also involved in the regulation of cardiac hypertrophy and diastolic dysfunction in hypertension (Wang et al. 2016). Epicatechin induces physiological cardiac growth in healthy mice by activation of the PI3K/Akt pathway (De Los Santos et al. 2017). However, whether any of these pathways are regulated by alamandine is unknown.

Therefore, the aim of the present study was to determine whether subcutaneous administration of alamandine would influence blood pressure and cardiac hypertrophy in SHRs, and to preliminarily explore the molecular signaling pathways underlying its regulatory effects.

Materials and methods

All procedures were approved by the Experimental Animal Care and Use Committee of Nanjing Medical University and conducted in accordance with the Guide for the Care and Use of Laboratory Animals (NIH publication No. 85-23, revised 1996). The ethical approval number is 14030149 and was approved in November 2015.

Animals and grouping

Fifty-week-old male rats (Vital River Biological Co., Ltd, Beijing, China), including normotensive Wistar–Kyoto (WKY) rats and SHRs, were housed in a temperature-controlled room on a 12–12 h light–dark cycle with free access to standard chow and tap water. Both WKY rats and SHRs were subjected to a 6-week infusion of alamandine (Phoenix Pharmaceuticals Inc., CA, USA) or saline (solvent control) administered by mini-osmotic pumps (model 2006; ALZET Osmotic Pumps, CA, USA) with a 6-week pumping capacity and an infusion rate of 0.15  μl/h (approximately 50 μg alamandine/kg/day) that were surgically placed below the neck.

After transthoracic echocardiography, rats were weighed and killed with an overdose of pentobarbital (100 mg kg−1, I.V.). The heart and lung were weighed, and the tibial length was measured. A part of the left ventricle was sectioned for staining and the remaining tissue was used for western blotting and quantitative reverse-transcription PCR (qRT-PCR).

Measurement of tail artery blood pressure

Systolic blood pressure (SBP), diastolic blood pressure (DBP), and mean artery pressure (MAP) were measured weekly in the tails of conscious rats using a noninvasive computerized tail-cuff system (Kent Scientific Corporation, CT, USA). The rats were warmed at 28 °C for 10–20 min before the measurements to allow for detection of tail artery pulsations and to achieve a steady pulse. To minimize stress-induced fluctuations, the rats were pre-trained by measuring blood pressure daily for at least 1 week before the experiments began. The tail artery blood pressure was obtained (Li et al. 2013) by averaging ten measurements.

Echocardiography

After the 6-week drug administration, transthoracic echocardiography was performed under isoflurane anesthesia using an ultrasound system (Vevo 2100, VisualSonics, Toronto, Canada) with a 21-MHz probe. The LV mass and LV volumes in diastole (LVVd) and systole (LVVs) were measured. The LV mass to body weight ratio, LV ejection fraction (EF), and fractional shortening (FS) were calculated. Measurements over three consecutive cardiac cycles were averaged.

Hematoxylin–eosin staining

Heart Sections (5 µm) were examined by hematoxylin–eosin (HE) staining (Service Biological Technology Co., Ltd, Wuhan, China) to measure the cross-sectional area of cardiomyocytes. Three to five random fields (around 30–50 cells per field) were selected from each of three sections from each animal for observation under a light microscope (Olympus Corporation, Tokyo, Japan). Images were analyzed using Image-Pro Plus software (Media Cybernetics, Inc., MD, USA).

Wheat germ agglutinin staining

Heart sections were stained using FITC-conjugated wheat germ agglutinin (WGA; Invitrogen Inc., CA, USA) to measure the cross-sectional area of cardiomyocytes. Three to five random fields (around 30–50 cells per field) were selected from each of three sections from each animal for observation under a confocal microscope (Carl Zeiss GmbH, Oberkochen, Germany) and analyzed with Zeiss software.

Culture of cardiomyocytes isolated from neonatal rat

Primary cardiomyocytes were isolated from 1–2-day-old newborn Sprague–Dawley rats (Vital River Biological Co.) (Ngoh et al. 2011). Hearts were excised and digested in PBS containing collagenase type II (Worthington Biochemical Corp., NJ, USA) and pancreatin (Sigma, MO, USA). The atria and great vessels were discarded. The ventricles were cut into small pieces and further digested with collagenase type II and pancreatin. Cells from digestion were collected and cultured in Complete Dulbecco’s modified Eagle’s medium (DMEM; GIBCO, Invitrogen Inc.) for 2–4 h to reduce fibroblasts and enrich for cardiomyocytes. The cardiomyocytes were cultured at 37 °C with 5% CO2.

The primary cardiomyocytes were divided into PBS, PBS + Ang II, alamandine, and alamandine + Ang II groups. First, alamandine was added to the alamandine and alamandine + Ang II groups, with PBS as the solution control in the PBS and PBS + Ang II groups. This alamandine pretreatment lasted for 30 min. Next, the PBS + Ang II and alamandine + Ang II groups were treated with 10−6 M Ang II (Sigma) for 24 h, with PBS as the solution control in the PBS and alamandine groups. Cells were assessed with immunofluorescence, western blotting, and qRT-PCR.

In another experiment, the primary cardiomyocytes were divided into DMSO, DMSO + Ang II, H89 (PKA inhibitor), and H89 + Ang II groups. The procedures were similar to the description above except that the alamandine pretreatment was replaced with H89 (10 μM, Selleck Chemicals, Houston, TX, USA) treatment and the corresponding control was DMSO, which is the vehicle in which H89 was administered. These cells were subjected to qRT-PCR.

Culture and differentiation of H9C2 cells

The rat myoblast cell line H9C2 (Cell Resource Center of Chinese Academy of Sciences, Shanghai, China) was cultured in DMEM supplemented with 10% fetal bovine serum, 100 U/mL of penicillin, and 100 µg/mL of streptomycin for 48 h at 37 °C in humidified air with 5% CO2. Cells were seeded at a density of 2 × 104 cells/well (6-well plate). Upon reaching confluency, H9C2 cells were differentiated into adult cardiomyocytes by substituting growth media with differentiation media containing 10 nM all-trans-retinoic acid and 1% horse serum for 6 days. The differentiated H9C2 cells were exposed to alamandine and Ang II treatments as described in “Culture of cardiomyocytes isolated from neonatal rat.” These cells were subjected to western blotting and qRT-PCR.

Western blotting

Heart tissues or cultured cells were sonicated in RIPA lysis buffer and homogenized. The debris was removed and the supernatant was obtained by centrifugation at 12,000 g for 10 min at 4 °C. Approximately 30–50 μg protein was separated by electrophoresis, transferred to PVDF membrane, and probed with primary antibodies against MrgD (Abcam, MA, USA); PKA, Akt, and p-Akt (Ser 473) (Cell Signaling, Danvers, MA, USA); and GAPDH (Abcam) as an internal control. Images were analyzed using Image-Pro Plus software.

qRT-PCR

RNA was isolated from heart tissues or cultured cells using Trizol (Invitrogen Inc.). Total RNA (0.5 μg) was reverse transcribed to cDNA. qRT-PCR was performed using an ABI Prism 7000 sequencer (Applied Biosystems, Foster City, CA, USA). The primers are shown in Table 1. The relative level of mRNA expression was expressed as 2−ΔΔCt.

Table 1

List of utilized primers for qRT-PCR

Gene	Specie	Forward primer	Reverse primer
ANP	Rat	GAGCAAATCCCGTATACAGTGC	ATCTTCTACCGGCATCTCCTCC
BNP	Rat	GCTGCTGGAGCTGATAAGAGAA	GTTCTTTTGTAGGGCCTTGGTC
GAPDH	Rat	GGCACAGTCAAGGCTGAGAATG	ATGGTGGTGAAGACGCCAGTA

ANP natriuretic peptide, BNP brain natriuretic peptide, GAPDH glyceraldehyde-3-phosphate dehydrogenase

Statistical analyses

Data are presented as mean ± standard error of the mean (SEM). Using GraphPad Prism 4.0 (GraphPad software Inc., CA, USA), statistical significance among multiple groups was evaluated by one-way analysis of variance (ANOVA) with the Bonferroni post hoc test. A two-tailed P value < 0.05 was considered statistically significant.

Results

Hypertension was ameliorated by subcutaneous administration of alamandine

Throughout the experiment, the SBP, DBP, and MAP were all higher in SHRs than in WKY rats. Alamandine infusion significantly decreased SBP, DBP, and MAP in the period of 2–6 weeks in SHRs, but had no significant effects on blood pressure in WKY rats (Fig. 1).

Fig. 1

Effects of alamandine on blood pressure in normotensive Wistar–Kyoto (WKY) rats and spontaneously hypertensive rats (SHRs). Tail systolic blood pressure (SBP), diastolic blood pressure (DBP), and mean arterial pressure (MAP) were decreased by alamandine treatment. The results are expressed as mean ± SEM. N = 8. *p < 0.05 versus the WKY-Saline group; #p < 0.05 versus the SHR-Saline group

Impaired LV function in SHRs was ameliorated by subcutaneous administration of alamandine

Echocardiography showed that the impaired EF and FS and enlarged LVVd and LVVs in SHRs compared to WKY rats was ameliorated after 6 weeks of alamandine administration. LV mass and LV mass/body weight were higher in SHRs compared with WKY rats, and alamandine treatment decreased these indexes (Table 2).

Table 2

Echocardiographic examination of the left ventricular function

Variables	WKY-Saline	WKY-Ala	SHR-Saline	SHR-Ala
LV mass (mg)	1022.9 ± 57.9	1058.5 ± 34.7	1447.7 ± 89.2*	1158.6 ± 44.5#
LV mass/BW(mg/g)	3.0 ± 0.1	3.1 ± 0.1	4.0 ± 0.2*	3.2 ± 0.1#
LVVd (µl)	344.7 ± 22.0	324.8 ± 8.8	370.5 ± 26.0*	350.9 ± 23.5#
LVVs (µl)	122.0 ± 7.9	111.3 ± 7.3	176.8 ± 18.1*	148.3 ± 14.3#
EF (%)	65.1 ± 2.8	65.9 ± 1.7	51.5 ± 1.6*	59.1 ± 1.2#
FS (%)	37.2 ± 2.2	37.7 ± 1.4	28.3 ± 1.3*	32.6 ± 0.9#

Normotensive Wistar–Kyoto (WKY) rats and spontaneously hypertensive rats (SHR) were subjected to a 6-week subcutaneous infusion of alamandine or saline (solvent control), respectively, named WKY-Saline, WKY-Ala, SHR-Saline, and SHR-Ala. After that, transthoracic echocardiography was performed

The results are expressed as the mean ± SEM of six rats per group

LV left ventricular, BW body weight, LVVd LV volume in diastole, LVVs LV volume in systole, EF ejection fraction, FS fractional shortening

*p < 0.05 versus the WKY-Saline group, #p < 0.05 versus the SHR-Saline group

Heart hypertrophy in SHRs was alleviated by subcutaneous administration of alamandine

SHRs had greater heart and lung weights than WKY rats. The 6-week subcutaneous administration of alamandine reduced the organ mass in SHRs to levels similar to WKY rats (Fig. 2a). SHR heart tissue had higher mRNA levels of ANP and BNP, but this was inhibited by subcutaneous administration of alamandine (Fig. 2a). The cross-sectional area of cardiomyocytes was significantly expanded in SHRs, as indicated by WGA and HE staining, and returned to areas similar to those in WKY rats after alamandine treatment (Fig. 2b). Alamandine had no effect on any of these measurements in WKY rats (Fig. 2).

Fig. 2

Effects of alamandine (Ala) on cardiac hypertrophy in spontaneously hypertensive rats (SHRs) versus normotensive Wistar–Kyoto (WKY) rats. a Alamandine attenuated increases in heart weight (HW), HW/body weight (BW) ratio, lung weight (LW), LW/BW ratio, HW/tibial length (TL) ratio, and ANP and BNP expression. b Alamandine inhibited the increase of cross-sectional area of cardiomyocytes in SHRs as indicated by WGA and HE staining. The results are expressed as mean ± SEM. N = 8. *p < 0.05 versus the WKY-Saline group; #p < 0.05 versus the SHR-Saline group

Cardiomyocyte hypertrophy induced by Ang II was alleviated by alamandine pretreatment

ANP and BNP mRNA levels were higher in Ang II-treated cardiomyocytes from neonatal rats, modeling cardiac hypertrophy, compared with those treated with PBS as a control. Alamandine pretreatment (0.1, 1.0, or 10 µg/ml) blocked these increases (Fig. 3a). The size of cardiomyocytes increased after Ang II treatment, and alamandine pretreatment (1.0 µg/ml) attenuated the increase (Fig. 3b). Consistently, in myocardial cell line H9C2, alamandine pretreatment (1.0 µg/ml) blocked the increase in ANP and BNP mRNA levels induced by Ang II treatment (Fig. 3c).

Fig. 3

Effects of alamandine (Ala) on cardiomyocyte hypertrophy induced by angiotensin (Ang) II treatment. a Alamandine inhibited the Ang II-induced increases in ANP and BNP mRNA levels in primary cardiomyocytes. b Alamandine attenuated the increase in cardiomyocyte size induced by Ang II as shown by WGA staining. c Alamandine inhibited the Ang II-induced increases in ANP and BNP levels in H9C2 cells. *p < 0.05 versus the PBS group; #p < 0.05 versus the Ang II group

MrgD expression was increased in hypertension

Levels of the alamandine receptor MrgD were higher in the hearts of SHRs than of WKY rats (Fig. 4a), and Ang II treatment increased the expression of MrgD in primary cardiomyocytes (Fig. 4b).

Fig. 4

Expression of alamandine receptor Mas-related G protein-coupled receptor, member D (MrgD) is increased during hypertension. a MrgD level was increased in the hearts of spontaneously hypertensive rats (SHRs) compared with Wistar–Kyoto (WKY) rats. b Angiotensin (Ang) II treatment increased MrgD expression in primary cardiomyocytes. *p < 0.05 versus the WKY or PBS group

Alamandine inhibited PKA signaling in SHRs

PKA and p-Akt levels in the heart were higher in SHRs than in WKY rats, and alamandine administration reduced the increase in PKA, but not p-Akt, in the heart of SHRs (Fig. 5).

Fig. 5

Interaction of alamandine with the protein kinase A (PKA) signaling pathway in spontaneously hypertensive rats (SHRs). PKA and phosphorylated protein kinase B (p-Akt) levels were higher in the hearts of SHRs than in those of Wistar–Kyoto (WKY) rats, and alamandine decreased the expression of PKA but not p-Akt in SHRs. *p < 0.05 versus the WKY-Saline group; #p < 0.05 versus the SHR-Saline group

Alamandine inhibited PKA signaling in cardiomyocytes

PKA and p-Akt levels were increased in primary cardiomyocytes treated with Ang II, and alamandine pretreatment inhibited the increase in PKA but not p-Akt (Fig. 6a). H89, an inhibitor of PKA, blocked the Ang II-induced increase in the mRNA levels of ANP and BNP (Fig. 6b). As in primary cardiomyocytes, H9C2 cells treated with Ang II had higher levels of PKA, which was blocked by alamandine pretreatment (Fig. 6c).

Fig. 6

Signaling pathway in primary cardiomyocytes. a Alamandine pretreatment inhibited the Ang II-induced increases of protein kinase A (PKA) but not phosphorylated protein kinase B (p-Akt) in primary cardiomyocytes. b H89, an inhibitor of PKA, inhibited the Ang II-induced increases of ANP and BNP mRNA levels in primary cardiomyocytes. c Alamandine pretreatment inhibited the Ang II-induced increase of PKA level in H9C2 cells. *p < 0.05 versus the PBS or DMSO group; #p < 0.05 versus the Ang II group

Discussion

Oral administration of alamandine has an antihypertensive effect in SHRs and anti-fibrotic effect in isoproterenol-treated rats (Lautner et al. 2013). The present study showed that subcutaneous administration of alamandine also ameliorated hypertension and LV function impairment, and attenuated cardiac hypertrophy. Our results also suggest that the regulatory mechanisms downstream of alamandine may be mediated by PKA signaling.

Overexpression of an Ang-(1–7) fusion protein attenuated ventricular hypertrophy in rats induced by deoxycorticosterone acetate (de Almeida et al. 2015). Additionally, an improvement in physiological heart function and cardiomyocyte hypertrophy was observed in Ang-(1–7)-treated mice (Papinska et al. 2015). Alamandine is similar to Ang-(1–7) and differs only by the presence of an alanine residue in place of an aspartate residue at the amino end. Alamandine has previously been shown to reduce blood pressure (Lautner et al. 2013) and attenuate inflammatory (Li et al. 2018) which was involved in obesity and hypertension(Skrypnik et al. 2017; Szulinska et al. 2017). In the present study, alamandine administration in SHRs reduced blood pressure, improved EF and FS, and attenuated heart weight and cardiomyocyte cross-sectional area expansion. These results strongly suggest that alamandine treatment improved heart function and cardiac hypertrophy associated with hypertension.

Alamandine acts through binding to the receptor MrgD (Lautner et al. 2013; Hrenak et al. 2016; Etelvino et al. 2014). In the present study, we found that MrgD expression was higher in the hearts of SHRs than those of WKY rats, and Ang II treatment increased MrgD levels in cardiomyocytes, which suggest that alamandine receptor activity is enhanced in the heart during hypertension and cardiac hypertrophy.

Chronic isoproterenol treatment fails to induce cardiac hypertrophy in PKA inhibitor peptide transgenic mice (Zhang et al. 2013).Ang II induced hypertension in both PKA Cβ-null mice and their WT littermates (Feng et al. 2017), but PKA Cβ-null mice are resistant to a number of Ang II-induced cardiopathological effects observed in wild-type mice, including hypertrophy, decreased diastolic performance, and enlarged left atria (Enns et al. 2010). In the present study, PKA expression in the heart was higher in SHRs compared with WKY rats, and alamandine treatment decreased PKA expression in SHRs, but had no effects in WKY rats. Furthermore, Ang II treatment increased PKA expression in cardiomyocytes, and alamandine pretreatment inhibited this increase of PKA level. The PKA inhibitor H89 blocked the increase of ANP and BNP levels induced by Ang II. These results suggest that PKA was involved in cardiac hypertrophy, and alamandine attenuated cardiac hypertrophy by inhibiting the PKA pathway. Previous study showed alamandine/Ang II ratio in plasma from chronic renal failure patients was higher compared with healthy controls (Lautner et al. 2013). Unfortunately, there is no any study on the effect of alamandine in humans.

In conclusion, we validated and expanded upon the conclusions of previous study (Lautner et al. 2013) by demonstrating that peripheral supplementation of alamandine could also mitigate hypertension. Furthermore, this treatment is beneficial for LV function recovery. In addition, alamandine administration efficiently alleviated cardiac hypertrophy in SHRs. The alamandine receptor MrgD is enhanced in the heart under conditions of hypertension and cardiac hypertrophy.

Study strong points and study limitation

Peripheral administration of alamandine attenuated hypertension and LV dysfunction associated with hypertension. Additionally, alamandine treatment alleviated cardiac hypertrophy in SHRs and cardiomyocytes hypertrophy induced by Ang II via inhibited PKA pathway. Furthermore, the alamandine receptor MrgD is increased in the heart in hypertension and cardiac hypertrophy.

Alamandine is a heptapeptide that can be generated from decarboxylation of Ang-(1–7). However, alamandine degradation has not yet been elucidated in rats or humans. Aminopeptidases may play an important role, since the removal of Ala1 could lead to the formation of Ang-(2–7). Given alamandine’s similarity to Ang-(1–7), Ang- (1–7) degrading enzymes, neutral endopeptidase or neprilysin, may also participate in the alamandine degradation (Mendoza-Torres et al. 2015). Additionally, there is no any study on the effect of alamandine in humans, although previous study showed the alamandine levels in plasma in human (Lautner et al. 2013).