One cut homeobox 2 (ONECUT2 or OC-2) is a newly discovered transcription factor. Aberrant expression of OC-2 is closely related to cell proliferation, migration, invasion, and angiogenesis. In this study, we found that OC-2 expression was upregulated in ovarian adenocarcinoma cells, by Western blot analysis. The results of immunohistochemistry showed that the expression of OC-2 was also increased in malignant ovarian cancer tissue. In order to explore the role of OC-2 in the development of ovarian cancer, siRNAs that specifically targets OC-2 were designed. The siRNA targeting OC-2 could effectively inhibit the vascular endothelial growth factor A (VEGFA) expression, but silence and overexpression of VEGFA did not affect OC-2 expression. In addition, OC2-siRNA could block the proliferation, migration, and invasion, and inhibit epithelial-mesenchymal transition and the AKT/ERK signaling pathway, of human ovarian cancer cells in vitro. In a mouse model of ovarian cancer xenograft tumors, OC2-siRNA could significantly inhibit tumor cell growth and the tumor inhibition rate reached approximately 73%. The results of immunohistochemistry showed that the densities of microvessels stained with CD31, the expression of OC-2 and VEGFA were significantly decreased in tumors. These data indicated that OC-2 was an upstream regulator of VEGFA and silencing OC-2 could inhibit ovarian cancer angiogenesis and tumor growth.
One cut homeobox 2 (ONECUT2 or OC-2) is a newly discovered transcription factor. Aberrant expression of OC-2 is closely related to cell proliferation, migration, invasion, and angiogenesis. In this study, we found that OC-2expression was upregulated in ovarian adenocarcinoma cells, by Western blot analysis. The results of immunohistochemistry showed that the expression of OC-2 was also increased in malignant ovarian cancer tissue. In order to explore the role of OC-2 in the development of ovarian cancer, siRNAs that specifically targets OC-2 were designed. The siRNA targeting OC-2 could effectively inhibit the vascular endothelial growth factor A (VEGFA) expression, but silence and overexpression of VEGFA did not affect OC-2expression. In addition, OC2-siRNA could block the proliferation, migration, and invasion, and inhibit epithelial-mesenchymal transition and the AKT/ERK signaling pathway, of humanovarian cancer cells in vitro. In a mouse model of ovarian cancer xenograft tumors, OC2-siRNA could significantly inhibit tumor cell growth and the tumor inhibition rate reached approximately 73%. The results of immunohistochemistry showed that the densities of microvessels stained with CD31, the expression of OC-2 and VEGFA were significantly decreased in tumors. These data indicated that OC-2 was an upstream regulator of VEGFA and silencing OC-2 could inhibit ovarian cancer angiogenesis and tumor growth.
Ovarian cancer is one of the most deadly of all gynecological malignancies.1 Most patients with ovarian cancer suffer from advanced ovarian cancer (stage III or IV). Chemotherapy combined with surgical treatment prolongs the mean survival of patients by 16‐22 months and the 5‐year survival is 27%, although treatment options have improved and better results are now being reported.2 The majority of patients are diagnosed late in disease progression and often confront tumor recurrence due to drug resistance.3 Angiogenesis and epithelial–mesenchymal transition (EMT)‐associated markers such as vascular endothelial growth factor (VEGF), Snai1, Snai2, Twist1, and N‐cadherin are significantly upregulated in breast cancer.4, 5 It is speculated that these cytokines play a key role in tumor growth, metastasis, and angiogenesis.6, 7Angiogenesis plays a crucial role in ovarian cancer growth, migration, invasion, and metastasis.8 Early studies reported the processes by which new blood vessels are formed (angiogenesis) from pre‐existing endothelial cells in established vessels, as opposed to during early embryonic development (vasculogenesis) from primitive endothelial cell precursors, which can be derived from adjacent vessels or from incorporation of bone marrow‐derived endothelial precursor cells.9 However, tumor neovascularization, consisting only of vascular endothelial cells, has been challenged by vasculogenic mimicry (VM).10 Tang et al11 indicated that vasculogenic mimicry was an alternative way to supply adequate blood for ovarian cancer. Research on tumor angiogenesis had progressed slowly until important discoveries of the major molecular drivers of tumor angiogenesis: the VEGF family and its homologous receptors.12 In addition to VEGF, other important pathways also contribute to tumor angiogenesis.8One cut homeobox 2 (ONECUT2 or OC‐2) was first reported by Patrick et al13 as the second member of the ONECUT family, whose prototype was hepatocyte nuclear factor‐6, characterized by the presence of a single cut domain and by a specific homeodomain. The expression status of OC‐2 could be used for bladder cancer epigenetic analysis and the results had high sensitivity and specificity.14 As an angiogenic and EMT‐related transcription factor, OC‐2 plays a key role in tumor cell invasion, metastasis, EMT, and oncogenesis.15, 16 Sun et al15 reported that microRNA‐429 inhibited the activation of EMT and regulated the expression of EMT‐related markers by targeting OC‐2. Zhang et al16 introduced the idea that OC‐2 was upregulated in hepatocellular carcinoma and partially acted as a tumor promoter through the Akt/Erk signaling pathway. However, the relationship between OC‐2 expression level and ovarian cancer development is still not clear.In order to study the relationship between OC‐2 expression and the development of ovarian cancer, we used siRNA to silence the expression of the OC‐2 gene in ovarian cancer cells. The results showed that the ability of cell proliferation, migration, invasion, and endothelial cell formation had decreased significantly. In addition, a mouse xenograft model revealed that silencing OC‐2 remarkably inhibited tumor growth and angiogenesis. These OC‐2 silencing studies could provide a new direction for gene therapy for ovarian cancer angiogenesis.
MATERIALS AND METHODS
Cell culture
Ovarian cancer cell lines (CAOV3, COV‐362, COV‐504, EFO‐27, ES‐2, OV‐90, SKOV3, and TOV‐21G) were obtained from ATCC and grown in DMEM with 10% FBS. Cells were serum‐starved and cultured in DMEM with 0.5% FBS overnight. Human umbilical vein endothelial cells were cultured in RPMI‐1640 medium with 10% FBS. All these cells were cultured in an incubator with 95% humidity and 5% CO2 at 37°C.
Small interfering RNA vector construction and transfection
Two siRNAs (siRNA#1 and siRNA#2) targeting OC‐2 and an siRNA (siRNA‐VEGFA) targeting VEGFA were designed according to Yu et al.17 The siRNAs were inserted into pGPU6‐GFP‐Neo vector (Genepharma, Suzhou, China) to construct pGPU6‐GFP‐Neo‐siRNA#1 (siRNA#2) and pGPU6‐GFP‐Neo‐siRNA‐VEGFA, respectively. A scrambled siRNA was used as negative control. The siRNAs sequences are listed in Tables 1, 2. Human recombinant VEGFA eukaryotic expression vector (pAAV‐VEGFA) was constructed by our laboratory.
Table 1
Targets and sequences of ONECUT2 siRNAs
Name
Sites
Sequences (5′‐3′)
siRNA NC
‐
UUCUCCGAACGUGUCACGUTT
siRNA#1
1015‐1034
GCCAGCTGGAAGAAATCAACA
siRNA#2
1277‐1296
GCAAGAACCAAACAAAGACAG
‐, not applicable; NC, scrambled control.
Table 2
Targets and sequences of vascular endothlial growth factor A (VEGFA) siRNA
Name
Sites
Sequences (5′‐3′)
siRNA NC
‐
UUCUCCGAACGUGUCACGUTT
siRNA VEGFA
1227‐1245
GGAGTACCCTGATGAGATCTT
‐, not applicable; NC, scrambled control.
Targets and sequences of ONECUT2 siRNAs‐, not applicable; NC, scrambled control.Targets and sequences of vascular endothlial growth factor A (VEGFA) siRNA‐, not applicable; NC, scrambled control.Ovarian cancer cells (SKOV3 and COV‐504, 2 × 105 cells/well) were added to 6‐well plates for 24 hours in DMEM with 10% FBS before transfection. SKOV3 and COV‐504 cells were transfected with siRNAs or pAAV‐VEGFA in ViaFect Transfection Reagent (Promega, Fitchburg, WI, USA) according to the manufacturer's instructions. After transfection, the cells were cultured in a 37°C incubator for 24 hours for the further experiments.
Cell proliferation assay
The cell viability was measured by CCK‐8 assay (Dojindo Molecular Technologies). SKOV3 and COV‐504 cells were transferred to 96‐well plates at a density of 2000 cells/well and incubated in a 5% CO2 incubator at 37°C overnight. SKOV3 and COV‐504 cells were transfected by OC2‐siRNA (siRNA#1 and siRNA#2) or scramble siRNA (siRNA NC). The proliferation rate of cells was finally determined by CCK‐8, according to the manufacturer's protocol. The optical density values at 450 nm (OD450) after transfection for 12, 24, 36, and 48 hours were measured by microplate reader (Bio‐Tek, USA). The cell proliferation inhibition rate at different time points = (1 − OC2‐siRNA group OD450 / siRNA NC group OD450) × 100%.
Western blot analysis
The ovarian cancer cells were washed with cold PBS and lysed in RIPA buffer (Beyotime, Suzhou, China). The lysates were centrifuged at 12 000 g for 8 minutes at 4°C and the total protein in the supernatant were quantified by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, Rockford, IL, USA). Total proteins were separated by SDS‐PAGE and transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 5% non‐fat milk for 1 hour at 37°C and incubated with rabbit anti‐humanONECUT2 polyclonal antibody (1:1000; Abcam), rabbit anti‐VEGFA polyclonal antibody (1:1000; Abcam), and rabbit anti‐t/p‐Akt (Erk) polyclonal antibody (1:1000; Cell Signaling Technology) overnight at 4°C. Rabbit anti‐GAPDH or β‐actin mAb (1:1000; Cell Signaling Technology) was used as a reference control. The membrane was incubated with HRP‐conjugated goat anti‐rabbit IgG (1:5000; Cell Signaling Technology) for 1 hour at 37°C. The blots were detected with an Immobilon Western Chemiluminescent HRP Substrate (Millipore) according to the manufacturer's instructions.18
Real‐time quantitative PCR analysis
The total RNAs were extracted from cells with TRIzol reagent (Invitrogen, China). The RT reactions were carried out using a SYBR green‐containing PCR kit (Qingke, China). The primers for real‐time PCR were used to detect the mRNA expression of hypoxia‐inducible factor‐1α (HIF‐1α), VEGFC, hepatocyte growth factor (HGF), fibroblast growth factor 2 (FGF2), Snai1, Snai2, transforming growth factor‐β1 (TGF‐β1), and Twist1. The sequences of real‐time PCR primers are listed in Table 3. The primers were synthesized and purified by Beijing Qingke Biotechnology. All real‐time PCR procedures were carried out on the CFX96 detection system (Bio‐Rad, USA).15
Table 3
Primer sequences of real‐time PCR
Gene
Forward primer (5′‐3′) Reverse primer (5′‐3′)
VEGFC
F: 5′‐GTGTCCAGTGTAGATGAA‐3′
R: 5′‐CCTGTTCTCTGTTATGTTG‐3′
Snai1
F: 5′‐TTTACCTTCCAGCAGCCCTA‐3′
R: 5′‐GACAGAGTCCCAGATGAGCA‐3′
Snai2
F: 5′‐GACACATTAGAACTCACACGG‐3′
R: 5′‐TACACAGCAGCCAGATTCCT‐3′
HGF
F: 5′‐ACGCTACGAAGTCTGTGA‐3′
R: 5′‐AAGAATTTGTGCCGGTGT‐3′
HIF‐1α
F: 5′‐TCTGGGTTGAAACTCAAGCAACTG‐3′
R: 5′‐CAACCGGTTTAAGGACACATTCTG‐3′
TGF‐β1
F: 5′‐ATGAACTCATTCAGTCACCATAGC‐3′
R: 5′‐CTATCCCCCACTAAAGCAGG‐3′
FGF2
F: 5′‐CCAGTTCGATTCAGTGCCACA‐3′
R: 5′‐GTGTGCTAACCGTTACCTGGCTATG‐3′
Twist1
F: 5′‐AGCTGAGCAAGATTCAGACCCTCA‐3′
R: 5′‐CTGCAGCTTGCCATCTTGGAGT‐3′
GAPDH
F: 5′‐TTCACCACCATGGAGAAGGC‐3′
R: 5′‐GGCATGGACTGTGGTCATGA‐3′
F, forward; R, reverse.
Primer sequences of real‐time PCRF, forward; R, reverse.
Wound healing assay
SKOV3 and COV‐504 cells (4.0 × 105 cells/well) transfected with OC2‐siRNA were transferred to 6‐well plates and cultured in DMEM with 10% FBS. The control groups were transfected with scramble siRNA. After incubation overnight, the cell scratches were made. The plates were washed with serum‐free DMEM and the medium was changed to DMEM with 0.5% FBS. After incubation for 24 hours, the migrated cells were imaged with a computerized imaging system. The cell migration rate of each group was calculated.19 The cell migration inhibition rate = (1 − OC2‐siRNA group migration distance/siRNA NC group migration distance) × 100%.
Migration and invasion assays
Migration and invasion assays of ovarian cancer cells were evaluated using an 8‐μm Transwell chamber (BD Biosciences) according to the instructions. SKOV3 and COV‐504 cells (2 × 104 cells) were transfected with OC2‐siRNAs (siRNA#1, siRNA#2, and siRNA NC) and then transferred to the upper chamber of the Transwell in 200 μL DEME basic medium for 24 hours. In the lower chamber, 600 μL DEME medium with 10% FBS was added as a chemoattractant.For Matrigel invasion assays, Transwells were coated with 60 μL Matrigel matrix (BD Biosciences) and cells (SKOV3 and COV‐504) transfected with OC2‐siRNAs were transferred to the inserts for 24 hours. Migrated and invaded cells on the lower surface of the Transwell were fixed with 70% ethanol and stained with 0.1% crystal violet (Meryer, Shanghai, China) and imaged using a computerized imaging system.19
Tube formation assay
The 96‐well plates were maintained at 4°C for 2 hours and coated with 60 μL Matrigel matrix per well. The plates were incubated for 30 minutes at 37°C. Then HUVECs (5 × 103 cells/well) suspended in M199 medium with Low Serum Growth Supplement (Gibco) were transferred to each well. Conditioned medium (70 μL) of SKOV3 and COV‐504 cells transfected with OC2‐siRNAs was added in the wells for 6 hours at 37°C in a 5% CO2 incubator. The tube formation was observed under a microscope (IX71; Olympus, Japan) and the tube numbers were counted in five random high‐power fields.
Ovarian cancer xenograft model
All the animals used in the experiments were treated humanely in accordance with Institutional Animal Care and Use Committee guidelines of Jinan University (Guangzhou, China). Female BALB/c nude mice (4‐6 weeks old) were purchased from Southern Medical University. For ovarian xenograft experiments, COV‐504 cells (1 × 106 cells in 100 μL) transfected with OC2‐siRNA#1/siRNA NC were s.c. injected into the right shoulder of BALB/c nude mice; the siRNA NC group was regarded as a negative control. Tumor size was measured with a Vernier caliper every 3 days. Tumor volume was calculated using the formula V = 0.52ab2 (a = tumor length; b = tumor width).19 At the end of 21 days, nude mice were euthanized and tumors were stripped for immunohistochemistry assays.
Immunohistochemistry
Immunohistochemistry was carried out as previously described.19, 20 The tumor tissue samples of ovarian cancerpatients were provided by The Third Affiliated Hospital of Sun Yat‐sen University (Guangzhou, China). For humanovarian cancer tissue, the primary antibody was rabbit anti‐humanONECUT2 polyclonal antibody (1:500 dilution, ab28466; Abcam). For tumor tissue of the mouse, the primary antibody was rabbit anti‐mouseCD31 polyclonal antibodies (1:50 dilution, ab28364; Abcam), rabbit anti‐mouseVEGFA polyclonal antibody (1:100 dilution, ab51745; Abcam), rabbit anti‐mouse HIF‐1α monoclonal antibody (1:200 dilution, 36169; Cell Signaling Technology), and rabbit anti‐mouseONECUT2 polyclonal antibody (1:500 dilution, ab28466; Abcam). The biotinylated HRP‐conjugated secondary antibody was a goat anti‐rabbit IgG.
Statistical analysis
Statistical analyses were carried out by one‐way ANOVA followed by the least significant difference test using the statistical software SPSS 15.0. Data are represented as mean ± SD. P‐values <.05 (*) and P < .01 (**) were considered statistically significant.
Ethics
The hospital ethics committee approved the study protocol, and all patients provided gave consent for the utilization of their tissue samples in this study.
RESULTS
Overexpression of OC‐2 in some ovarian cancer cells and tissues
Previous studies have indicated that OC‐2 was expressed highly in liver cancer and colon cancer.15, 16 To explore the expression and significance of OC‐2 in ovarian cancer carcinogenesis, OC‐2 expression was detected in different ovarian cancer cells (CAOV3, COV‐362, COV‐504, EFO‐27, ES‐2, OV‐90, SKOV3, and TOV‐21G). The OC‐2 expression of HUVECs served as a negative control.The Western blot assay results showed OC‐2 expression was significantly higher in COV‐504, SKOV3, EFO‐27, and ES‐2 cells than HUVECs. The level of OC‐2 expression in COV‐504 and SKOV3 cells was higher than EFO‐27 and ES‐2. In contrast, OC‐2 expression levels in CAOV3, COV‐362, OV‐90, and TOV‐21G cells were lower than HUVECs (Figure 1A). These results show that the expression of OC‐2 is higher in malignant ovarian adenocarcinoma (SKOV3 and COV‐504) cell lines. By comparison, OC‐2 expression is lower in mucinous carcinoma (EFO‐27), clear cell carcinoma (ES‐2 and TOV‐21G), mixed tumor (OV‐90), and other cancer cells that have a lower degree of deterioration than adenocarcinoma. It indicates that the abnormal expression of OC‐2 is closely related to the deterioration level of ovarian cancer.
Figure 1
Expression of ONECUT‐2 (OC‐2) in ovarian cancer samples with different differentiation. A, OC‐2 expression level was analyzed by Western blot in different ovorian cancer cells; *P < .05, **P < .01. B, (a‐f) OC‐2 expression levels in highly differentiated ovarian cancer samples. (a) Serous adenocarcinoma. (b) Serous papillary carcinoma. (c) Serous adenocarcinoma. (d) Serous adenocarcinoma. (e) High‐grade serous adenocarcinoma. (f) Serous adenocarcinoma. (g‐j) OC‐2 expression in poorly differentiated ovarian cancer samples. (g) Moderately differentiated adenocarcinoma. (h) Clear cell carcinoma. (i) Poorly differentiated adenocarcinoma. (j) Poorly differentiated adenocarcinoma. (k,l) OC‐2 expression levels in normal ovarian tissue. Magnification, ×400
Expression of ONECUT‐2 (OC‐2) in ovarian cancer samples with different differentiation. A, OC‐2 expression level was analyzed by Western blot in different ovorian cancer cells; *P < .05, **P < .01. B, (a‐f) OC‐2 expression levels in highly differentiated ovarian cancer samples. (a) Serous adenocarcinoma. (b) Serous papillary carcinoma. (c) Serous adenocarcinoma. (d) Serous adenocarcinoma. (e) High‐grade serous adenocarcinoma. (f) Serous adenocarcinoma. (g‐j) OC‐2 expression in poorly differentiated ovarian cancer samples. (g) Moderately differentiated adenocarcinoma. (h) Clear cell carcinoma. (i) Poorly differentiated adenocarcinoma. (j) Poorly differentiated adenocarcinoma. (k,l) OC‐2 expression levels in normal ovarian tissue. Magnification, ×400In addition, we analyzed 10 cases of malignant ovarian cancer and two samples of normal ovarian tissue. Immunohistochemistry showed that OC‐2 overexpression was founded in six cases of malignant ovarian cancer (Figure 1B). Given the above results, we decided to silence OC‐2 gene expression on COV‐504 and SKOV3 cells to explore the role of OC‐2 in the progression of ovarian cancer.
ONECUT2 siRNA inhibits OC‐2 expression and proliferation of ovarian cancer cells
COV‐504 and SKOV3 cells transfected with OC2‐siRNAs were collected and lysed for Western blot analysis after 48 hours (Figure 2A). The results showed that OC‐2 expression of COV‐504 and SKOV3 cells transfected with siRNA#1 (siRNA#2) decreased by 75%‐77% (78%‐80%) relative to the siRNA NC group (P < .01) (Figure 2B,C).
Figure 2
ONECUT‐2 (OC‐2) siRNA inhibits OC‐2 expression and proliferation in ovarian cancer cells. A, OC‐2 expression in COV‐504 and SKOV3 cells transfected with OC2‐siRNAs (siRNA#1, siRNA#2, and scrambled siRNA [NC]) were assayed by Western blot. B, Quantitative analysis of OC‐2 expression in COV‐504 cells. C, Quantitative analysis of OC‐2 expression in SKOV3 cells. D,E, Proliferation inhibition rate of COV‐504 and SKOV3 cells transfected with OC2‐siRNAs were detected by CCK‐8 assay. Data were represented as the means ± SD. *P < .05, **P < .01
ONECUT‐2 (OC‐2) siRNA inhibits OC‐2 expression and proliferation in ovarian cancer cells. A, OC‐2 expression in COV‐504 and SKOV3 cells transfected with OC2‐siRNAs (siRNA#1, siRNA#2, and scrambled siRNA [NC]) were assayed by Western blot. B, Quantitative analysis of OC‐2 expression in COV‐504 cells. C, Quantitative analysis of OC‐2 expression in SKOV3 cells. D,E, Proliferation inhibition rate of COV‐504 and SKOV3 cells transfected with OC2‐siRNAs were detected by CCK‐8 assay. Data were represented as the means ± SD. *P < .05, **P < .01The cell proliferation inhibition rate after OC2‐siRNA transfection was evaluated by CCK‐8 assay. The results showed that the proliferation inhibition rate of COV‐504 and SKOV3 cells transfected with siRNA#1 (siRNA#2) reached 24%‐25% (20‐22%) at 48 hours (P < .01) (Figure 2D,E). These results indicated that OC‐2 silencing could significantly inhibit the protein expression of OC‐2 and ovarian cancer cell proliferation.
Silencing of OC‐2 inhibits migration and invasion of ovarian cancer cells
ONECUT‐2 promotes colon cancer cell migration and invasion at high expression, critical to the metastasis of colon cancer.15 However, the relationship between OC‐2 and ovarian cancer cell migration and invasion is still not clear. Therefore, the role of OC‐2 in ovarian cancer cell migration and invasion was investigated by silencing OC‐2. The COV‐504 and SKOV3 cells transfected with OC2‐siRNAs in the upper chamber were chemoattracted by the DMEM medium with 10% FBS in the lower chamber. The results showed that the migration rate of COV‐504 and SKOV3 cells transfected with siRNA#1 (siRNA#2) decreased by 70%‐75% (66%‐72%) compared to the NC group (P < .01) (Figure 3A).
Figure 3
Silencing ONECUT‐2 (OC‐2) inhibits migration and invasion of ovarian cancer cells. A, Inhibitory effect of OC2‐siRNAs on the migration of COV‐504 and SKOV3 cells. (a,c) Migration ability of COV‐504 and SKOV3 cells transfected with OC2‐siRNAs for 24 h. (b,d) Quantitative analysis of COV‐504 and SKOV3 cell migration. B, Inhibitory effect of OC2‐siRNAs on the invasion of COV‐504 and SKOV3 cells. (a,c) Invasion ability of COV‐504 and SKOV3 cells transfected with OC2‐siRNAs for 24 h. (b,d) Quantitative analysis of COV‐504 and SKOV3 cell invasion. C, Migration of COV‐504 and SKOV3 cells transfected with OC2‐siRNAs for 24 h. (a,c) Migration ability of COV‐504 and SKOV3 cells was evaluated by wound healing assay after transfection for 24 h. (b,d) Quantitative analysis of the migration inhibition rate of COV‐504 and SKOV3 cells. Data were represented as the means ± SD. *P < .05, **P < .01
Silencing ONECUT‐2 (OC‐2) inhibits migration and invasion of ovarian cancer cells. A, Inhibitory effect of OC2‐siRNAs on the migration of COV‐504 and SKOV3 cells. (a,c) Migration ability of COV‐504 and SKOV3 cells transfected with OC2‐siRNAs for 24 h. (b,d) Quantitative analysis of COV‐504 and SKOV3 cell migration. B, Inhibitory effect of OC2‐siRNAs on the invasion of COV‐504 and SKOV3 cells. (a,c) Invasion ability of COV‐504 and SKOV3 cells transfected with OC2‐siRNAs for 24 h. (b,d) Quantitative analysis of COV‐504 and SKOV3 cell invasion. C, Migration of COV‐504 and SKOV3 cells transfected with OC2‐siRNAs for 24 h. (a,c) Migration ability of COV‐504 and SKOV3 cells was evaluated by wound healing assay after transfection for 24 h. (b,d) Quantitative analysis of the migration inhibition rate of COV‐504 and SKOV3 cells. Data were represented as the means ± SD. *P < .05, **P < .01The invasion rate of COV‐504 and SKOV3 cells transfected with siRNA#1 (siRNA#2) were reduced by 71%‐76% (69%‐74%) (P < .01) (Figure 3B). We further investigated the effect of OC‐2 silencing on the migration of ovarian cancer cells through wound healing assays (Figure 3C). The results showed that the migration inhibition rate of COV‐504 and SKOV3 cells transfected with siRNA#1 (siRNA#2) reached 83%‐86% (86%‐89%) (P < .01). These data suggest that OC‐2 silencing could significantly inhibit the migration and invasion of ovarian carcinoma cells.
Silencing OC‐2 expression in ovarian cancer cells inhibits endothelial angiogenesis
Anti‐angiogenic therapy is used as a primary treatment for ovarian cancer.21 To test the role of OC‐2 in ovarian cancer cells stimulating angiogenesis, the conditioned media were collected from the COV‐504 and SKOV3 cells transfected with OC2‐siRNAs, and stimulated HUVECs on Matrigel‐coated plates (Figure 4A,B). The conditioned medium of COV‐504 and SKOV3 cells transfected with siRNA#1 (siRNA#2) reduced the tube formation rate of HUVECs by 70%‐75% (70%‐85%) (P < .01) (Figure 4C,D).
Figure 4
Silencing ONECUT‐2 (OC‐2) inhibits endothelial cell tube formation. A,B, Effects of conditioned medium of COV‐504 and SKOV3 transfected with OC2‐siRNAs on HUVEC tube formation. C,D, Quantitative analysis of HUVEC tube formation. NC, scrambled siRNA
Silencing ONECUT‐2 (OC‐2) inhibits endothelial cell tube formation. A,B, Effects of conditioned medium of COV‐504 and SKOV3 transfected with OC2‐siRNAs on HUVEC tube formation. C,D, Quantitative analysis of HUVEC tube formation. NC, scrambled siRNAONECUT‐2 is a transcription factor, we speculated that OC‐2 could regulate the release of angiogenic factors in the ovarian tumor microenvironment to stimulate angiogenesis. Our preliminary data indicated that OC‐2 was associated with VEGFA, the most important molecule involved in angiogenesis. Therefore, the expression of VEGFA was detected by Western blot after OC‐2 silencing on COV‐504 and SKOV3 cells. The results showed that OC‐2 silencing significantly inhibited the expression of VEGFA (Figure 5A). In addition, COV‐504 and SKOV3 cells transfected with siRNA‐VEGFA or pAAV‐VEGFA were collected and lysed for Western blot analysis after 48 hours. The results showed that the expression of OC‐2 was not affected after silencing or overexpression of VEGFA (Figure 5B,C).
Figure 5
Silencing ONECUT‐2 (OC‐2) inhibits the expression of angiogenesis‐related factors. A, Vascular endothelial growth factor A (VEGFA) expression in COV‐504 and SKOV3 cells after transfection with OC2‐siRNAs for 48 h. B, OC‐2 expression was detected after overexpression of VEGFA. C, VEGFA expression in COV‐504 and SKOV3 cells was detected after transfection with siRNA‐VEGFA for 48 h. D, Hepatocyte growth factor (HGF) and hypoxia‐inducible factor‐1α (HIF‐1α) mRNA expression were detected by real‐time PCR. E, mRNA expression of VEGFC and fibroblast growth factor 2 (FGF2) were detected by real‐time PCR. Data were represented as the means ± SD. *P < .05, **P < .01. ACTB, β‐actin; NC, scrambled siRNA
Silencing ONECUT‐2 (OC‐2) inhibits the expression of angiogenesis‐related factors. A, Vascular endothelial growth factor A (VEGFA) expression in COV‐504 and SKOV3 cells after transfection with OC2‐siRNAs for 48 h. B, OC‐2 expression was detected after overexpression of VEGFA. C, VEGFAexpression in COV‐504 and SKOV3 cells was detected after transfection with siRNA‐VEGFA for 48 h. D, Hepatocyte growth factor (HGF) and hypoxia‐inducible factor‐1α (HIF‐1α) mRNA expression were detected by real‐time PCR. E, mRNA expression of VEGFC and fibroblast growth factor 2 (FGF2) were detected by real‐time PCR. Data were represented as the means ± SD. *P < .05, **P < .01. ACTB, β‐actin; NC, scrambled siRNASubsequently, we examined the mRNA expression of HIF‐1α and other angiogenic factors (VEGFC, HGF, and FGF2) after silencing OC‐2 expression in COV‐504 and SKOV3 cells by real‐time PCR. The results showed that the HIF‐1α mRNA expression of COV‐504 and SKOV3 cells transfected with siRNA#1 (siRNA#2) declined by 41%‐58% (45%‐49%) relative to the siRNA NC group (P < .05) (Figure 5D).The HGF mRNA expression of COV‐504 and SKOV3 cells transfected with siRNA#1 were reduced by 44%‐48% (P < .05). The HGF mRNA expression of COV‐504 cells transfected with siRNA#2 was decreased by 36%‐40% (P < .05). However, there was no significant difference in the HGF mRNA expression of SKOV3 cells transfected with siRNA#2 compared with the control group (Figure 5D).The expression of VEGFC mRNA in COV‐504 and SKOV3 cells transfected with siRNA#1 and siRNA#2 were reduced by 40%‐50% (35%‐44%) (P < .05). The mRNA expression of FGF2 in COV‐504 and SKOV3 cells transfected with siRNA#1 was decreased by 40%‐48% (P < .05). The decreased level of mRNA expression of FGF2 in COV‐504 cells (transfected with siRNA#2) reached 33%‐36% (P < .05). However, the decreased level of mRNA expression of FGF2 in SKOV3 cells (transfected with siRNA#2) did not reach a significant level compared to the control group (Figure 5E).These data indicate that OC‐2 might regulate the production of HIF‐1α and angiogenic factors (VEGFA, HGF, VEGFC, and FGF2) in the ovarian tumor microenvironment and promote endothelial tube formation of branching complexity.
Silencing of OC‐2 inhibits phosphorylation of AKT, ERK1/2, and EMT
The pathway of AKT/ERK has been verified to correlate with tumor growth and angiogenesis.22, 23, 24 ONECUT‐2 decreased the proliferation rate of SKOV3 and COV‐504 cells, and showed a time‐dependent inhibition of cell growth (Figure 2D,E). To further assess whether OC‐2 affected the downstream signaling pathway involved in cell proliferation and angiogenesis, p‐Akt and p‐Erk were investigated by Western blot assay. The results showed that silencing OC‐2 could inhibit the phosphorylation of Akt and Erk (Figure 6A).
Figure 6
Silencing ONECUT‐2 (OC‐2) inhibits the Akt/Erk signaling pathway and epithelial–mesenchymal transition (EMT) in ovarian cancer cells. A, Effect on the Akt/Erk signaling pathway after OC‐2 silencing in COV‐504 and SKOV3 cells. (a) Total protein was extracted to assess expression levels of Akt/Erk on COV‐504 and SKOV3 cells transfected with OC2‐siRNAs by Western blot. (b‐e) Erk and Akt phosphorylation (p‐) levels in SKOV3 (b,d) and COV‐504 (c,e) cells were quantified by grayscale analysis. B, EMT‐related markers were detected after OC‐2 silencing by Western blot analysis. (a) N‐cadherin and E‐cadherin expression levels in COV‐504 and SKOV3 cells transfected with OC2‐siRNAs for 48 h. (b‐e) N‐cadherin (b,c) and E‐cadherin (d,e) expression levels in COV‐504 and SKOV3 cells were quantified by grayscale analysis. (f) mRNA expression of Snai1, Snai2, transforming growth factor‐β1 (TGF‐β1), and Twist1 in COV‐504 and SKOV3 cells (transfected with OC2‐siRNA#1) were detected by real‐time PCR. Data were represented as the means ± SD. *P < .05, **P < .01. ACTB, β‐actin; NC, scrambled siRNA
Silencing ONECUT‐2 (OC‐2) inhibits the Akt/Erk signaling pathway and epithelial–mesenchymal transition (EMT) in ovarian cancer cells. A, Effect on the Akt/Erk signaling pathway after OC‐2 silencing in COV‐504 and SKOV3 cells. (a) Total protein was extracted to assess expression levels of Akt/Erk on COV‐504 and SKOV3 cells transfected with OC2‐siRNAs by Western blot. (b‐e) Erk and Akt phosphorylation (p‐) levels in SKOV3 (b,d) and COV‐504 (c,e) cells were quantified by grayscale analysis. B, EMT‐related markers were detected after OC‐2 silencing by Western blot analysis. (a) N‐cadherin and E‐cadherin expression levels in COV‐504 and SKOV3 cells transfected with OC2‐siRNAs for 48 h. (b‐e) N‐cadherin (b,c) and E‐cadherin (d,e) expression levels in COV‐504 and SKOV3 cells were quantified by grayscale analysis. (f) mRNA expression of Snai1, Snai2, transforming growth factor‐β1 (TGF‐β1), and Twist1 in COV‐504 and SKOV3 cells (transfected with OC2‐siRNA#1) were detected by real‐time PCR. Data were represented as the means ± SD. *P < .05, **P < .01. ACTB, β‐actin; NC, scrambled siRNAONECUT‐2 is a transcription factor associated with EMT, and N‐cadherin and E‐cadherin are important markers of EMT development.15, 25 As a feature of aggressive tumors, EMT is characterized by reduced E‐cadherin and increased N‐cadherin expression, contributing to a stroma‐oriented cellular adhesion profile with increased tumor cell motility and invasive properties.26, 27, 28 To explore the relationship between OC‐2 and EMT‐related markers, N‐cadherin and E‐cadherin expression were detected after silencing OC‐2 by Western blot, and the mRNA expression of Snai1, Snai2, TGF‐β1, and Twist1 were detected after silencing OC‐2 by real‐time PCR.Our results showed that E‐cadherin expression increased and N‐cadherin decreased after OC‐2 silencing on SKOV3 and COV‐504 cells (Figure 6Ba‐e). In addition, the real‐time PCR results showed that the expression levels of TGF‐β1 in COV‐504 and SKOV3 cells transfected with siRNA#1 reduced by approximately 56% and 48%, respectively (P < .05). The Snai2expression levels were downregulated by approximately 45% and 40%, respectively (P < .05). The Twist1expression levels were decreased by nearly 51% and 53%, respectively (P < .05). In contrast, the Snai1expression levels declined by 25% and 20%, respectively, but the results did not reach a significant level (Figure 6Bf).These results implied that OC‐2 might play a role through the Akt/Erk signaling pathway to promote ovarian cancer cell proliferation and activate EMT to improve migration and invasion in ovarian cancer cells.
Silencing OC‐2 inhibits ovarian tumor growth and angiogenesis
In order to investigate OC‐2 silencing on COV‐504 cells growth and angiogenesis in vivo, a xenograft tumor model of ovarian cancer was established in BALB/c nude mice. COV‐504 cells transfected with siRNA#1 and siRNA NC were injected into nude mice for 21 days; the mice were euthanized and the tumors stripped (Figure 7A). The OC‐2 silenced group showed a significant inhibition in tumor growth (P < .05) from the day 7, whereas the siRNA NC group showed a continuous increase (Figure 7B). In accordance with this observation, the average weight of tumors in the OC‐2 silenced group was significantly reduced compared to the control group (P < .01) (Figure 7C). The stripped tumors were sectioned for immunohistochemistry staining with CD31, OC‐2, VEGFA, and HIF‐1α (Figure 7D). The immunohistochemistry results showed that the number of microvessels decreased by approximately 72% in the silenced group (P < .01) (Figure 7E). The OC‐2 expression reduced by 77%‐81% (P < .01). The expression of VEGFA decreased by 78%‐83% (P < .01) and the HIF‐1α expression decreased by 72%‐78% (P < .01) (Figure 7F).
Figure 7
ONECUT‐2 (OC‐2) silencing inhibits tumor growth and angiogenesis in an ovarian cancer xenograft nude mice model. A, COV‐504 ovarian cancer cells transfected with siRNA#1/scrambled siRNA (siRNA NC) were injected into the right shoulder of BALB/c nude mice (n = 10). Mice were euthanized and the tumors were excised after 21 d. B, Growth curves of tumors. C, Quantitative analysis of tumor weight. D, Paraffin sections of tumors were stained with OC‐2, CD31, VEGFA, and HIF‐1α antibody. The positive rates were statistically analyzed. E, Tumors were stained with CD31 antibody. Microvessel densities were quantified. The numbers of blood vessels at five high‐power fields (×200) per section were counted. F, Positive expression rates of vascular endothelial growth factor A (VEGFA), OC‐2, and hypoxia‐inducible factor‐1α (HIF‐1α) in tumors. Data were represented as the means ± SD. *P < .05, **P < .01
ONECUT‐2 (OC‐2) silencing inhibits tumor growth and angiogenesis in an ovarian cancer xenograft nude mice model. A, COV‐504 ovarian cancer cells transfected with siRNA#1/scrambled siRNA (siRNA NC) were injected into the right shoulder of BALB/c nude mice (n = 10). Mice were euthanized and the tumors were excised after 21 d. B, Growth curves of tumors. C, Quantitative analysis of tumor weight. D, Paraffin sections of tumors were stained with OC‐2, CD31, VEGFA, and HIF‐1α antibody. The positive rates were statistically analyzed. E, Tumors were stained with CD31 antibody. Microvessel densities were quantified. The numbers of blood vessels at five high‐power fields (×200) per section were counted. F, Positive expression rates of vascular endothelial growth factor A (VEGFA), OC‐2, and hypoxia‐inducible factor‐1α (HIF‐1α) in tumors. Data were represented as the means ± SD. *P < .05, **P < .01These data suggest that OC‐2 could be an important regulator of angiogenesis and tumor growth in ovarian cancer.
DISCUSSION
Previous studies regarding OC‐2 focused on the regulatory role of the ONECUT family in the differentiation and growth of liver tissues and visual cells, as well as the specific diagnosis of bladder cancer.29, 30, 31 It was reported that OC‐2 existed in the nucleus and its expression was significantly increased in colorectal carcinoma relative to paracancerous normal tissues.15 Zhang et al16 found that OC‐2 was significantly upregulated in tumor tissues compared with non‐tumor tissues and might play an oncogenic role in hepatocellular carcinoma development. Sun et al15 showed that transcript factor OC‐2 was involved in the EMT, migration, and invasion of colorectal carcinoma cells. However, the role of OC‐2 on tumor development in ovarian cancerpatients has not been reported.In this study, we found that OC‐2 expression was elevated in some malignant ovarian cancer tissues compared to normal ovarian tissue. Similarly, the high expression of OC‐2 in COV‐504 and SKOV3 cells was confirmed by Western blot analysis. Zhang et al16 hypothesized that the high expression of OC‐2 might have a close relationship with the occurrence of liver cancer. Therefore, we speculated that the abnormal expression of OC‐2 might play an important role in the occurrence and development of ovarian cancer.Zhang et al16 found that Akt/Erk signaling was activated when microRNA‐9 targeted OC‐2. The Akt/Erk signaling pathway is closely related to cell proliferation, migration, and angiogenesis.32 We tried to investigate its effect on ovarian cancer cell proliferation by silencing the OC‐2 gene. The results showed that the proliferation rate of SKOV3 and COV‐504 cells was significantly reduced and the phosphorylation levels of AKT/ERK were also inhibited. Therefore, OC‐2 might regulate the proliferation of ovarian cancer cells through the AKT/ERK signaling pathway.Epithelial–mesenchymal transition is an essential and important step in tumor cell invasion and distant metastasis.33 ONECUT‐2 could promote EMT, one of the well‐defined processes during tumor invasion and distant metastasis.15, 16 Our Western blot results showed that E‐cadherin expression was increased and N‐cadherin expression was decreased after OC‐2 silencing. The real‐time PCR results showed a significant decrease in mRNA expression of TGF‐β1, Snai2, and Twist1 relative to the control group. Aomatsu et al34 found that TGF‐β downregulated E‐cadherin and upregulated N‐cadherin in the human corneal epithelial cell line and it could induce sustained upregulation of Snai1 and Snai2 through both Smad and non‐Smad pathways (human corneal epithelial cell line). Olmeda et al35 found that interference of endogenous Snai2 in mousecarcinoma cells affected EMT and cooperates with Snai1 silencing in decreased invasiveness. Moreover, Snai2 is also an essential mediator of Twist1‐induced EMT and metastasis.36 Therefore, we hypothesized that the expression of TGF‐β1 is significantly inhibited after silencing the OC‐2 gene and then suppresses the expression of nuclear transcription factors Twist1, Snail2, and Snai1 by a complex regulatory network. Twist1 was also significantly inhibited by Snai2‐mediated EMT, and this series of changes in these transcription factors significantly reduced the inhibitory effect on the E‐cadherin promoter, resulting in a significant decrease in migration and invasion of ovarian cancer cells.36, 37These results indicated that high expression of OC‐2 in ovarian cancer cells could stimulate cell migration and invasion and break through the epithelial basement membrane. This is particularly relevant to the strong metastatic capacity of highly differentiated malignant ovarian cancer cells.38Subsequently, we used siRNA to silence OC‐2 expression to investigate its effect on angiogenesis in vitro and in vivo. In vitro, the conditioned medium after silencing OC‐2 in ovarian cancer cells significantly inhibited the tube formation numbers of HUVECs. Western blot assay showed that VEGFAexpression was decreased after OC‐2 silencing, but silencing and overexpression of VEGFA did not significantly affect OC‐2 expression. These results indicated that OC‐2 was an upstream regulator of VEGFA. In addition, we found that HIF‐1α expression was significantly reduced after silencing OC‐2 by real‐time PCR and the mousetumor immunohistochemistry experiments. The mRNA expression levels of VEGFC, HGF, and FGF2 also decreased in varying degrees after silencing OC‐2 expression in ovarian cancer cells by RT‐PCR. Hypoxia stimulates new blood vessel formation in coronary artery disease, tumor angiogenesis, and diabetic neovascularization.39, 40, 41 Hypoxia‐inducible factor‐1α increase of VEGFexpression is due to both transcriptional activation and increased mRNA stability.42 Tacchini et al43 found that HGF can not only increase the HIF‐1α mRNA and protein levels in HepG2 cells, but can also increase the DNA binding activity of HIF‐1α and regulate the expression of its downstream target genes (such as VEGF). Shi et al44 reported that FGF2 regulates HIF‐1α activation by increasing protein synthesis and transactivity through the PI3K/Akt and MEK1/ERK pathways in a breast cancer cell line. Our results showed that the expression of OC‐2 in silenced ovarian cancer, the downregulation of FGF2 and HGFexpression, might inhibit the activation of HIF‐1α, resulting in greatly reduced expression of downstream VEGFA and VEGFC. Pan et al45 reported that interleukin‐17 inhibits VEGF secretion in non‐small‐cell lung cancer through the STAT3/Girdin (GIV) signaling pathway. We hypothesized that OC‐2 might also act through other angiogenic signaling pathways, such as STAT3/GIV, rather than just the Akt/Erk and HIF‐1 signaling pathways that we revealed here. Therefore, silencing OC‐2 might affect one or several signaling pathways, inhibiting the expression and secretion of angiogenesis‐related factors and ultimately affecting angiogenesis.In addition, nude mice bearing COV‐504 ovarian cancer transfected with OC2‐siRNA (siRNA#1) showed significant tumor growth inhibition. The siRNA#1‐treated tumors showed a significant reduction in CD31 stained blood vessels, OC‐2, VEGFA, and HIF‐1α expression compared to the siRNA NC group. These data indicated that inhibition of OC‐2 expression could affect tumor growth and angiogenesis.Our results provided proof of targeting OC‐2 for anti‐angiogenesis therapy in ovarian cancer; OC‐2 might be a marker of ovarian cancer‐specific detection.
Authors: Eelke H Gort; Karijn P M Suijkerbuijk; Suzan M Roothaan; Venu Raman; Marc Vooijs; Elsken van der Wall; Paul J van Diest Journal: Cancer Epidemiol Biomarkers Prev Date: 2008-12 Impact factor: 4.254
Authors: Sabrina Margagliotti; Frédéric Clotman; Christophe E Pierreux; Jean-Bernard Beaudry; Patrick Jacquemin; Guy G Rousseau; Frédéric P Lemaigre Journal: Dev Biol Date: 2007-09-16 Impact factor: 3.582
Authors: Su Yon Jung; Jeanette C Papp; Eric M Sobel; Matteo Pellegrini; Herbert Yu; Zuo-Feng Zhang Journal: Am J Cancer Res Date: 2020-09-01 Impact factor: 6.166