Literature DB >> 29720147

CRBP-1 over-expression is associated with poor prognosis in tongue squamous cell carcinoma.

Yue Chen1,2, Tian Tian1, Min-Jie Mao1,3, Wei-Ye Deng4, Hao Li5,6.   

Abstract

BACKGROUND: Tongue squamous cell carcinoma (TSCC) is one of the most common malignancies of oral squamous cell carcinomas. Cellular retinol binding protein-1 (CRBP-1) as a carrier protein transports retinol from the liver storage site to peripheral tissue. Up-regulated expression of CRBP-1 is associated with some tumor types such as prostate cancer, breast cancer and ovarian cancer as reported, but its role in TSCC remains uncertain.
METHODS: In this study, an integrated bioinformatics analysis based on the multiple cancer microarray data sets available from Oncomine database was conducted to view the differential expression of CRBP-1 between TSCC and the adjacent non-tumorous tissues. Quantitative real-time polymerase chain reaction (qRT-PCR), western blotting (WB) and immunohistochemical (IHC) assays were performed to investigate CRBP-1 expression in 101 paraffin-embeded TSCC tissues and 48 pairs of freshly frozen tissues. Kaplan-Meier curve and univariate and multivariate Cox-regression analysis were used to estimate the association between CRBP-1 expression and patients' prognosis. Then western blotting, MTT, transwell migration and invasion assays were performed in TSCC cell lines to investigate the effects of CRBP-1 on cellular proliferation and invasion.
RESULTS: Compared with the matched adjacent non-tumorous tissues, the expression of CRBP-1 was significantly up-regulated in TSCC tissues, which correlated with the differentiation state (P = 0.003), N classification (P = 0.048), the clinical stage (P = 0.048) and death (P = 0.001). The Kaplan-Meier curve showed that TSCC patients with higher CRBP-1 expression levels had lower overall survival rates than those with lower CRBP-1 expression levels. A univariate and multivariate analysis demonstrated that CRBP-1 was an independent prognostic factor (P < 0.05). Furthermore, we knocked down CRBP-1 expression and observed that TSCC cell proliferation and invasion in vitro were significantly blocked, as determined by MTT and transwell assays.
CONCLUSIONS: Up-regulated expression of CRBP-1 is associated with poor prognosis in TSCC, so it might potentially serve as an additional prognostic marker, and the inhibition of CRBP-1 might provide new therapeutic approaches for TSCC.

Entities:  

Keywords:  CRBP-1; Expression; Invasion; Knockdown; Prognosis; Proliferation; Tongue squamous cell carcinoma

Mesh:

Substances:

Year:  2018        PMID: 29720147      PMCID: PMC5932876          DOI: 10.1186/s12885-018-4249-1

Source DB:  PubMed          Journal:  BMC Cancer        ISSN: 1471-2407            Impact factor:   4.430


Background

Tongue squamous cell carcinoma (TSCC) is one of the most common types of oral squamous cell carcinomas (OSCC). TSCC is highly invasive and characterized by early metastasis and poor prognosis [1-4]. Although therapeutic targets of TSCC have been improved, the mortality rates of TSCC patients are still high [5-7]. Regional lymph node metastasis has been known as an adverse prognostic factor of TSCC [2, 8, 9]. Poorly differentiated cancer is more likely to have cervical metastasis, positive margins after resecting and poor survival [10]. Histologic risk is another important prognostic predictor in OSCC [11]. A better comprehension of the connection between certain molecular alterations and histological differentiation may inject fresh blood into studying the mechanisms of tumor occurrence and development, and provide an effective strategy for the diagnosis, treatment and prevention of TSCC. Retinol (known as Vitamin A) and its metabolic products are necessary for many biochemical reactions and affect epithelial cell proliferation and differentiation [12]. The biological effects of retinol are primarily mediated by all trans-retinoic acid receptors (RARs) and 9-cis retinoic acid receptors (RXRs) [13, 14]. Currently, researchers have focused much attention on the roles of retinoic acid binding proteins and cellular retinol binding proteins (CRABPs and CRBPs) in carcinogenesis. Retinoid intracellular transportation and retinoid-induced cellular activities in physiology are under regulation of CRABPs and CRBPs. Among them,CRBP-1 takes an important part in the uptake and subsequent esterification of retinol and improving bioavailability and transcriptional activities. In addition, CRBP-1 plays a vital role in the embryonic development, growth, vision and survival of vertebrates [15, 16]. Recent studies found that CRBP-1 was down-regulated in certain human cancer tissues, including prostate cancer [17], breast cancer [18], endometrial cancer [19] and ovarian cancer [20], and that CRBP-1 was up-regulated in lung adenocarcinoma [15] and laryngeal cancer [21]. However, few studies focused on the clinicopathological features of CRBP-1 expression levels in human TSCC. Therefore, the goal of our study was to determine whether CRBP-1 influenced tumor progression and overall survival (OS) rates in TSCC patients. To find out the relationship between CRBP-1 and TSCC, qRT-PCR, western blotting and immunohistochemistry were conducted to examine CRBP-1 expression in a batch of human TSCC tissues and the matched non-tumorous tissues. We also carry out some cell experiments to investigate the effects of CRBP-1 on tumor cells’ proliferation and migration.

Methods

Patients and tumor tissue samples

An immunohistochemistry analysis was conducted on tongue tumor specimens collected from 101 patients who were diagnosed with tongue squamous cell carcinoma and had surgical resection between September of 2005 and February of 2009 at the Head and Neck Department of the Sun Yat-sen University Cancer Center. All patients obtained a biopsy before surgery, and the diagnosis of TSCC was confirmed by the Pathology Department of Sun Yat-sen University Cancer Center according to the World Health Organization (WHO) histological criteria. Patients bearing other primary tumors at the same time were excluded in this study. All patients’ clinicopathological records, based on the clinical and pathologic staging system of the American Joint Committee on Cancer (AJCC), were reviewed. Overall survival (OS), defined as the time from the surgery to the date of death or the last follow-up, were used to measure the patients’ prognosis. Detailed information of the 101 patients is shown in Table 1.
Table 1

Clinical characteristic and CRBP-1 express of 101 patient samples of TSCC

CharacteristicsNumber of cases (%)
Age (years)
 ≤4527(26.7)
 > 4574(73.2)
Gender
 Male61(60.4)
 Female40(39.6)
Tumor size (cm)
 ≤273(72.3)
 > 228(27.7)
Differentiation status
 Well72(71.3)
 Moderate Poor24(23.8)
 Poor5(4.9)
T classification classification
 T173(72.3)
 T227(26.7)
 T31(1.0)
 T40
N classification
 N078(77.2)
 N110(9.9)
 N213(12.9)
 N30
M classification
 M0100(99.0)
 M11(1.0)
Clinical stage
 I63(62.4)
 II15(14.8)
 III10(9.9)
 IV13(12.9)
Relapse
 Yes23(22.8)
 No78(77.2)
Death
 Yes27(26.7)
 No74(73.3)
Expression of CRBP-1
 Low expression49(48.5)
 High expression52(51.5)
Clinical characteristic and CRBP-1 express of 101 patient samples of TSCC 48 pairs of fresh TSCC tissues and matching adjacent non-tumorous tongue tissues (located more than 1 cm away from the tumor) collected from TSCC patients after resection at the Sun Yat-sen University Cancer Center from 2011 to 2015 were used for qRT-PCR and western blotting analysis.

Database

The Oncomine microarray database (http://www.oncomine.org) was used to screen CRBP-1 expression in the paired TSCC samples. “CRBP-1” was used as a keyword in the Oncomine search, “Cancer vs. Normal Analysis” was used as the primary filter, and “Tongue squamous cell carcinoma” was chosen as the cancer type. The up-regulated mRNA levels of CRBP-1 were shown in multiple data sets including Talbot’s, Estilo’s and Ye’s datasets. We also screened the gene expression levels in paired head and neck squamous carcinoma (HNSCC) samples (normal vs. carcinoma tissues). The up-regulated mRNA levels of CRBP-1 were shown in multiple datasets including Cromer’s, Peng’s, Toruner’s and Ginos’ data sets. The CRBP-1 expression data were log-transformed, median-centered per array, and the standard deviation (SD) was normalized to one per array.

Cell culture and generation of stably transfected cell lines

The human TSCC cell line CAL-27 was maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fatal bovine serum (FBS). The human TSCC cell lines (SCC-9, SCC-15 and SCC-25) were cultured in a mixture of DMEM (Invitrogen) and Ham’s F12 medium and DMEM supplemented 25 mM Hepes, 100 μg/mL penicillin/streptomycin, 4 mM L-glutamine and 10% FBS (Gibco). Tca8113 was grown in RPMI-1640 (Invitrogen) supplemented with 10% FBS, 15 mM Hepes, 100 μg /mL penicillin and 2.5 μg /mL. The lentiviruses containing CRBP-1 shRNA were bought from GenePharma (Shanghai, China). The transfection was conducted and stable cell lines (CAL-27 or SCC-25 cells) expressing CRBP-1 shRNAs were selected for 2 weeks with 3 μg/ml puromycin. The sequences targeting CRBP-1 were 5′- GTGGATTGAGGGTGATGAA-3′(#1) and 5’-GTCTGTCTCATTGCCTTGT-3′(#2).

Immunohistochemistry (IHC)

IHC was performed to study CRBP-1 expression in TSCC tissues with the same method described above. At first, paraffin-embedded tissue sections were deparaffinized and rehydrated in a series of descending ethanol concentrations. Then, the sections were treated with 3% hydrogen peroxide for 15 min at room temperature and placed in a high-pressure cooker for antigen retrieval. The slides were incubated with rabbit anti-CRBP-1 (1:100; Abcam, U.S.A.) in a humidified chamber at 4 °C overnight, then incubated with an anti-rabbit secondary antibody at 37 °C for 30 min, following by treatment with diaminobenzidine tetrahydrochloride (DAB) and counterstaining with hematoxylin. An isotypic antibody dilution was used for each sample as the negative control under the same experimental conditions. The CRBP-1 immunostaining results were scored by two independent pathologists based on both percentage and intensity of positively stained tumor cells under double-blind conditions. The percentage of positive cells was scored as follows:“0”(0–5%), “1”(5–25%), “2”(25–50%), “3”(50–75%) and “4”(75–100%). The intensity were scored as follows: “0”(no staining), “1”(weakly staining), “2”(moderately staining) and “3”(strongly staining). The final score was calculated by multiplying the staining intensity score by the positive percentage score. We devided the patients into high or low expression group with the median score. The final score of low expression group was < 8 and the final score of high expression group was ≥8. [22]

Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted from fresh tissues and TSCC cells using a TRIZOL reagent according to the manufacturer’s instructions (Thermo Fischer Scientific, Waltham, MA, U.S.A.). 2 μg of the extracted RNA pretreated with RNase-free DNase were used for the cDNA synthesis primed with random hexamers. The obtained cDNAs were applied to a real-time PCR analysis to evaluate the relative expression levels of CRBP-1 and β-actin (used as an internal control) with the following primers: 5′- CTACAATGAGCTGCGTGTGG -3′ (forward); 5’-AGGTACTCCTCGAAATTCTCGTT-3′ (reverse) for CRBP-1; 5′- CATGTACGTTGCTATCCAGGC -3′(forward); and 5′- CTCCTTAATGTCACGCACGAT -3′(reverse) for β-actin. The quantitative PCR was performed using a Light Cycler real-time quantitative PCR system 480 (Roche, Germany).

Western blotting assay

Both fresh tissues and TSCC cells were homogenized in a RIPA lysis buffer, and the lysates were cleared by centrifugation. The obtained proteins were then transferred to a polyvinylidene difluoride membrane that was incubated with a CRBP-1 primary antibody (1:1000, Abcam, U.S.A.) or β-actin (1:1000, Abcam, U.S.A.) and with 5% skim milk. The membranes were incubated with anti-rabbit IgG or anti-mouse IgG and then visualized by the ECL system (Santa Cruz Biotechnology, Dallas, TX, U.S.A.).

MTT assay

CAL-27 and SCC-25 cells were implanted in 96-well plates with 1500 cells per well after transfection. Cellular proliferation was measured by means of MTT assay at 1, 2, 3, 4, 5 and 6 days, and their absorbance values were measured at 490 nm wavelength with a spectrophotometric plate reader.

Transwell assay

CAL-27 and SCC-25 cells were respectively trypsinized and counted, and then implanted in the top chamber with the matrigel-coated membrane (24-well insert; pore size, 8 μm; BD Biosciences) with 2 × 105 cells per well in medium without serum. Medium supplemented with serum was used as a chemical attractant in the lower chamber. After incubated for 24 h, the cells that had migrated or invaded through the membrane to the lower surface were fixed, stained, and counted under the inverted microscope. Cells were counted for normalization of matrigel invasion activity by counting the siRNA-treated cells by microscopy 24 h after plating the equal number of the cells on culture plates.

Statistical analysis

Data were presented as mean ± SD. The Chi-square test,Student’s t-test and Fisher’s exact test were used for comparisons between groups. The Kaplan-Meier test and cox regression models were used to analyze the survival rates of the TSCC patients. All data were analyzed with SPSS software (version 21; SPSS Inc., Chicago, IL, U.S.A.). A two-sided p value < 0.05 was regarded as statistically significant.

Results

CRBP-1 expression levels in tongue tissues and the adjacent non-tumorous tissues

To explore the expression levels of CRBP-1 in TSCC tissues (T) and in the adjacent non-tumorous tissues (ANT), the qRT-PCR assay was used to detect the levels of mRNA in 48 paired tongue samples, and were compared to the matched adjacent non-tumorous tissues. As shown in Fig. 1a, the CRBP-1 mRNA expression levels were significantly higher in 48 pairs of the TSCC tissues compared to those of the matched ANT tissues. Next, we analyzed the expression of CRBP-1 in TSCC and HNSCC in the multiple cancer microarray data sets available from Oncomine (http://www.oncomine.org), and found that the mRNA expressions of CRBP-1 in TSCC and HNSCC tissues were markedly higher than those in the matched normal non-tumorous tissues, and some normal tissues had very low CRBP-1 expression with a negative value (Fig. 1b and c). We observed that the 7 pairs of human TSCC tissues had significantly higher expression levels than found in their matched control, which was consistent with Western blot data (Fig. 2a). To further investigate the CRBP-1 expression levels in TSCC, we performed an immunohistochemical analysis of 101 paraffin-embeded TSCC tissues, which involved 89 cancers with the matched ANT tissues. Our results manifested that 95.5%(85/89) of the tumor tissues expressed significantly higher CRBP-1 levels than those of the matched ANT tissues. Three pairs of representative slides are displayed in Fig. 2b.
Fig. 1

Expression of CRBP-1 mRNA in human TSCC tissues and matched adjacent non-tumorous tissues. a The relative CRBP-1 mRNA expression levels significantly increased in TSCC tissues (T) compared with those of the matched adjacent non-tumorous tissues (ANT)(n = 48, P < 0.001). The mRNA expression level of CRBP-1 was measured by qRT-PCR. b CRBP-1 is overexpressed in human TSCC tissues(T) than the adjacent normal tissues(N) in multiple cancer microarray data sets available from Oncomine. c CRBP-1 is overexpressed in HNSCC tissues(T) than the adjacent normal tissues(N) in multiple cancer microarray data sets available from Oncomine. Data is presented as mean ± S.D. **P < 0.01 versus the corresponding control groups

Fig. 2

Expression of CRBP-1 protein in human TSCC tissues and matched adjacent non-tumorous tissues. a The relative CRBP-1 protein expression in 7 pairs of TSCC tissues (T) and the matched adjacent non-tumorous tissues (ANT). GAPDH was measured as the loading control. b Immunohistochemical staining of CRBP-1 in three pairs of representative TSCC tissues (T) and the adjacent non-tumorous tissues (ANT)(× 100)

Expression of CRBP-1 mRNA in human TSCC tissues and matched adjacent non-tumorous tissues. a The relative CRBP-1 mRNA expression levels significantly increased in TSCC tissues (T) compared with those of the matched adjacent non-tumorous tissues (ANT)(n = 48, P < 0.001). The mRNA expression level of CRBP-1 was measured by qRT-PCR. b CRBP-1 is overexpressed in human TSCC tissues(T) than the adjacent normal tissues(N) in multiple cancer microarray data sets available from Oncomine. c CRBP-1 is overexpressed in HNSCC tissues(T) than the adjacent normal tissues(N) in multiple cancer microarray data sets available from Oncomine. Data is presented as mean ± S.D. **P < 0.01 versus the corresponding control groups Expression of CRBP-1 protein in human TSCC tissues and matched adjacent non-tumorous tissues. a The relative CRBP-1 protein expression in 7 pairs of TSCC tissues (T) and the matched adjacent non-tumorous tissues (ANT). GAPDH was measured as the loading control. b Immunohistochemical staining of CRBP-1 in three pairs of representative TSCC tissues (T) and the adjacent non-tumorous tissues (ANT)(× 100)

Correlation between CRBP-1 expression and clinicopathological features

Next, we analyzed the potential correlation between the CRBP-1 protein expression levels of 101 TSCC surgical specimens and the clinicopathological features of the TSCC patients. In Table 2, we observed that 51.5% (52/101) of the cases exhibited high CRBP-1 expression, while 48.5%(49/101) of the cases showed relatively low CRBP-1 expression. The samples consisted of 62.4%(63/101) of the cases in clinical stage I, 14.8%(15/101) of the cases in clinical stage II, 9.9%(10/101) of the cases in clinical stage III and 12.9%(13/101) of the cases in clinical stage IV.
Table 2

Correlation between CRBP-1 expression and clinicopathological variables of 101TSCCcases

CRBP-1 expression
LowHigh P
Age (years)0.685
 ≤451413
 > 453539
Gender0.327
 Male3229
 Female1723
Tumor size0.795
 ≤2 cm3637
 > 2 cm1315
Differentiation status0.003
 Well4032
 Moderate519
 Poor41
T classification0.795
 T13648
 T2+T3+T41315
N classification0.048
 N04236
 N1+N2+N3716
M classification1.000
 M04951
 M101
Clinical stage0.048
 I-II3648
 III-IV1315
Relapse0.134
 Yes815
 No4137
Death0.006
 Yes720
 No4232
Correlation between CRBP-1 expression and clinicopathological variables of 101TSCCcases The relationship between the clinical and pathological characteristics of TSCC patients and the levels of CRBP-1 expression are described in Table 2. The results showed that the expression levels of CRBP-1 significantly correlated with multiple variables, including the differentiation state (P = 0.003), N classification (P = 0.048), clinical stage (P = 0.048) and death (P = 0.006), but not with age (P = 0.685), gender (P = 0.327), tumor size (P = 0.795), T classification (P = 0.795) and M classification (P = 1.000). The representative IHC-stained slides displaying the adverse connections between the tumor clinical states and CRBP-1 expression levels are shown in Fig. 3a Likewise, high expression levels of CRBP-1 were observed in the TSCC tissues with poor differentiation in Fig. 3b.
Fig. 3

Correlation between CRBP-1 expression in TSCC and clinicopathological features. a Increased expression of CRBP-1 in advanced stages of TSCC. Representative IHC analysis of CRBP-1 expression in TSCC specimens (T) and the matched adjacent non-tumorous tissues (ANT) of different clinical stages. b CRBP-1 expression in TSCC tissues with different differentiation states

Correlation between CRBP-1 expression in TSCC and clinicopathological features. a Increased expression of CRBP-1 in advanced stages of TSCC. Representative IHC analysis of CRBP-1 expression in TSCC specimens (T) and the matched adjacent non-tumorous tissues (ANT) of different clinical stages. b CRBP-1 expression in TSCC tissues with different differentiation states

CRBP-1 expression and patient survival analysis

Patient survival analysis revealed that the overall survival (OS) in TSCC patients was different among 101 patients in accordance with CRBP-1 expression levels. High expression of CRBP-1 was correlated with a shorter overall survival time (P = 0.008) as shown in Fig. 4.
Fig. 4

Kaplan-Meier survival curves for TSCC patients with high CRBP-1 expression (red line) versus low CRBP-1 expression (blue line). The overall survival of patients with high or low CRBP-1 expression

Kaplan-Meier survival curves for TSCC patients with high CRBP-1 expression (red line) versus low CRBP-1 expression (blue line). The overall survival of patients with high or low CRBP-1 expression To investigate the independent prognostic value of CRBP-1 expression levels, a univariate and multivariate Cox regression analysis were performed (Table 3). Our results found that CRBP-1 expression, tumor size, differentiation state and clinical state were especially associated with the overall survival rates of TSCC patients. Further, CRBP-1 expression levels, the differentiation states and the clinical states were responsible for the poor OS in TSCC patients as determined by a multivariate Cox regression analysis.
Table 3

Univariable and multivariable analysis of overall survival of TSCC patients

VariablesUnivariable analysisMultivariable analysis
HR95%CIPHR95%CIP
CRBP-1 expression (low vs. high)3.0111.272–7.1260.0122.7531.140–6.6500.024
Age (≤45 vs. > 45)1.6930.641–4.4770.288
Gender (male vs. female)0.6640.312–1.4130.288
Tumor size (≤2 cm vs. > 2 cm)2.7881.309–5.9370.0081.6530.716–3.8180.239
Differentiation stage2.6271.523–4.5310.0013.3571.726–6.529< 0.001
Clinical stage (I + II VS. III + IV)4.3172.010–9.276< 0.00134.3281.977–9.477< 0.001
Univariable and multivariable analysis of overall survival of TSCC patients

CRBP-1 expression in TSCC cell lines and CRBP-1 shRNA

We then investigated CRBP-1 expression in CAL-27, Tca8113, SCC-25, SCC-9 and SCC-15 cell lines using western blotting analysis. Among the five TSCC cell lines analyzed, CAL-27 and SCC-25 cells had obviously high expression of CRBP-1 at protein levels (Fig. 5a). To achieve significant experimental results, CRBP-1 was stably knocked down in CAL-27 and SCC-25 cells which exhibited lower expression levels of CRBP-1 using lentiviral CRBP-1 shRNA cells compared to their control cells (Fig. 5b). Thus, the shCRBP-1 was successful in reducing CRBP-1 protein levels in these cell lines.
Fig. 5

Knockdown of CBRP-1 reduced the cell proliferation and invasion ability in CAL-27 and SCC-25 cells. a The relative expression levels of CRBP-1 in TSCC cell lines were evaluated by western blotting. b Immunoblotting analysis of CRBP-1 in CAL-27 and SCC-25 cells transduced with two specific shRNA. c Growth curves of CAL-27 and SCC-25 cells with knockdown of CRBP-1. Scramble (sc): the lentiviral vector with a scrambled sequence that does not target any mRNA. d Images (upper panel) and quantification (lower panel) of invaded TSCC cells treated with melatonin for 24 h were analyzed in a transwell matrix penetration assay. Scar bar: 100 μm. Data is presented as mean ± S.D. **P < 0.01 versus the corresponding control groups

Knockdown of CBRP-1 reduced the cell proliferation and invasion ability in CAL-27 and SCC-25 cells. a The relative expression levels of CRBP-1 in TSCC cell lines were evaluated by western blotting. b Immunoblotting analysis of CRBP-1 in CAL-27 and SCC-25 cells transduced with two specific shRNA. c Growth curves of CAL-27 and SCC-25 cells with knockdown of CRBP-1. Scramble (sc): the lentiviral vector with a scrambled sequence that does not target any mRNA. d Images (upper panel) and quantification (lower panel) of invaded TSCC cells treated with melatonin for 24 h were analyzed in a transwell matrix penetration assay. Scar bar: 100 μm. Data is presented as mean ± S.D. **P < 0.01 versus the corresponding control groups

Functional consequences of reduction CRBP-1 expression in vitro

Because cancer is usually characterized by uncontrolled cell proliferation, we first examined the proliferation feature of the control cells and CRBP-1-knockdown cells in CAL-27 and SCC-25 cell lines respectively. MTT assay revealed that the proliferation of CRBP-1-knockdown cells was significantly inhibited (Fig. 5c). It is known that regional lymph node metastasis is an adverse prognostic factor of TSCC. The ability of cancer cells to invade from their primary site and then into tissues is a crucial step in the formation of metastasis, so we then tested the invasive capacity of CRBP-1-knockdown cells using a transwell invasion assay. As a pro-metastasis role for CRBP-1, the number of cells invading through the membranes was significantly reduced in CRBP-1-knockdown cells in comparison to the control cells (Fig.d).

Discussion

CRBP-1, a member of cellular retinol-binding proteins(CRBPs),belongs to the family of fatty acid-binding proteins, which widely expresses in many tissues [23]. Ghyselinck et al. found that CRBP-1 is essential in liver vitamin A esterification and storage in their study of mice [24]. Aberrant CRBP-1 expression has been found closely connected with different tumors and affected patient’s prognosis. Some researches discovered that CRBP-1 was downregulated in hepatocellular carcinoma [25], endometrial carcinoma [19], ovarian carcinoma [20] and breast carcinoma [18]. On the contrary, CRBP-1 was upregulated in astrocytic gliomas [26], leiomyosarcoma [27] and lung adenocarcinoma [15]. Moreover, decreased expression of CRBP-1 was found relevant to shorter survival time in endometrial carcinoma, ovarian carcinoma and breast carcinoma, while increased expression of CRBP-1 was verified to damage survival time in astrocytic gliomas [26], leiomyosarcoma [27] and lung adenocarcinoma [15]. Some reserchers also found that aberrant CRBP-1 expression related to the differentiation status of breast carcinoma [18], endometrial carcinoma [19] and larynx carcinoma [28]. Although CRBP-1 has been found overexpressed in Talbot’s, Estilo’s and Ye’s datasets in TSCC and Cromer’s, Peng’s, Toruner’s and Ginos’ data sets in HNSCC through microarray studies, but no one of them deepened their researches to dig out the relationship between CRBP-1 expression and the prognosis of TSCC patients and the role of CRBP-1 in TSCC cell lines. In our study, CRBP-1 expression was investigated at transcription and translation levels in matched TSCC specimens by qPT-PCR and western blotting analysis. The mRNA and protein levels of CRBP-1 increased in tumorous tissues compared to those in the matched non-tumorous tissues. Because of individual difference, the expression of CRBP-1 in TSCC tissues and the matched adjacent normal tissues was different. Some tumor tissues with low expression were almost equal to the normal tissues with high expression. But CRBP-1 was significantly overexpressed in TSCC tissues than the adjacent normal tissues compared by the Student’s t-test (p < 0.05). Moreover, the CRBP-1 expression levels in the immunohistochemical analysis increased in 95.5% of the TSCC tissues (85/89), compared with those in the matched adjacent non-tumorous tissues. All of these experimental results confirmed that CRBP-1 was overexpression in TSCC tissues and it was in accordance with the search results from Oncomine. In the Kaplan-Meier survival analysis, the CRBP-1 expression levels strongly correlated with TSCC patient survival rates. Patients with higher expression levels of CRBP-1 had a markedly decreased survival rate. Consistently, Elena et al. found the same results in lung adenocarcinoma [15]. Furthermore, we discovered that CRBP-1 expression, together with the differentiation state and clinical state, was an independent risk factor for TSCC patients by the Cox hazard ratio regression analysis. We also found that CRBP-1 expression is closely connected with the differentiation status, T classification,clinical stage and death. So up-regulation of CRBP-1 expression might play an important role in tumor differentiation and lymph node metastasis. Under normal conditions, CRBP-1 not only regulates intracellular retinol trafficking and bioconversion, but also facilitates its biological functions [12]. Specifically, retinol can stimulate the proliferation and differentiation of epithelial cell. High expression levels of CRBP-1 in TSCC were correlated with increased CRBP- 1 gene copy numbers and were also parallel to increased tumor grades, suggesting that high expression levels of CRBP-1 reflects a more aggressive and dedifferentiated phenotype of squamous cell carcinoma. These results are consistent with Elena et al.’s study. They found that 62.3% of adenocarcinomas expressed high level of CRBP-1 which associated with increased tumor grade and reduced OS [15]. We wondered whether CRBP-1 made a great contribution to tumor proliferation and metastasis. To find out the answer, MTT and transwell assay were conducted in CAL-27 and SCC-25 cell lines with CRBP-1 knocked down. The result revealed that the proliferation and invasion of CRBP-1-knockdown cells was significantly inhibited. A recent study got the similar result in which they found significant inhibition of proliferation of A549 cells transfected with CRBP-1comparing to the control group. We ascertained that CRBP-1 was distinctly upregulated in TSCC tissues and CRBP-1 upregulation was closely contected with reduced survival of TSCC patients. Besides, CRBP-1 expression of TSCC patients was in relation to tumor differentiation and lymph node metastasis. In addition, in vitro studies revealed that knocking down CRBP-1 inhibit the proliferation and invasion of CAL-27 and SCC-25 cell lines. However, further research is necessary to help us clarify the molecular mechanism of CRBP-1 in TSCC. To summarize, our results declare that CRBP-1 can serve as a prognostic biomarker of TSCC and a potential therapeutic target for TSCC treatment.

Conclusion

In this study, we found that CRBP-1 expression levels increased in patients with TSCC, and high expression levels of CRBP-1 indicated a poor prognosis. Knockdown of CRBP-1 weaken the proliferation and invasion ability of TSCC cells. Our results suggest that CRBP-1 may be a promising prognostic biomarker of TSCC patients and therapeutic target for TSCC treatment.
  27 in total

1.  Prognostic factors in intraoral squamous cell carcinoma: the influence of histologic grade.

Authors:  Deepak Kademani; R Bryan Bell; Shahrokh Bagheri; Eric Holmgren; Eric Dierks; Bryce Potter; Louis Homer
Journal:  J Oral Maxillofac Surg       Date:  2005-11       Impact factor: 1.895

Review 2.  Lymphangiogenesis in development and human disease.

Authors:  Kari Alitalo; Tuomas Tammela; Tatiana V Petrova
Journal:  Nature       Date:  2005-12-15       Impact factor: 49.962

Review 3.  Nodal metastases: predictive factors.

Authors:  L P Kowalski; J E Medina
Journal:  Otolaryngol Clin North Am       Date:  1998-08       Impact factor: 3.346

4.  Cellular retinol binding protein-1 expression in endometrial hyperplasia and carcinoma: diagnostic and possible therapeutic implications.

Authors:  Augusto Orlandi; Amedeo Ferlosio; Alessandro Ciucci; Arianna Francesconi; Beatriz Lifschitz-Mercer; Giulio Gabbiani; Luigi G Spagnoli; Bernard Czernobilsky
Journal:  Mod Pathol       Date:  2006-06       Impact factor: 7.842

5.  Correlation between expression of cellular retinol-binding protein 1 and its methylation status in larynx cancer.

Authors:  Raúl Peralta; Alejandra Valdivia; Isabel Alvarado-Cabrero; Francisco Gallegos; Teresa Apresa; Dulce Hernández; Mónica Mendoza; Pablo Romero; Lucero Paniagua; Miguel Ibáñez; Lourdes Cabrera; Mauricio Salcedo
Journal:  J Clin Pathol       Date:  2011-11-02       Impact factor: 3.411

6.  Oral squamous cell carcinoma grading systems--analysis of the best survival predictor.

Authors:  Rhayany de Castro Ribeiro Lindenblatt; Gisele Lago Martinez; Licínio Esmeraldo Silva; Paulo Silvestre Faria; Danielle Resende Camisasca; Simone de Queiroz Chaves Lourenço
Journal:  J Oral Pathol Med       Date:  2011-09-08       Impact factor: 4.253

7.  Decreased expression of retinol-binding proteins is associated with malignant transformation of the ovarian surface epithelium.

Authors:  David Roberts; Stephen J Williams; Dusica Cvetkovic; Jillian K Weinstein; Andrew K Godwin; Steven W Johnson; Thomas C Hamilton
Journal:  DNA Cell Biol       Date:  2002-01       Impact factor: 3.311

8.  The role of prophylactic neck dissection and tumor thickness evaluation for patients with cN0 tongue squamous cell carcinoma.

Authors:  Nayuta Tsushima; Tomohiro Sakashita; Akihiro Homma; Hiromitsu Hatakeyama; Satoshi Kano; Takatsugu Mizumachi; Tomohiko Kakizaki; Takayoshi Suzuki; Satoshi Fukuda
Journal:  Eur Arch Otorhinolaryngol       Date:  2016-05-05       Impact factor: 2.503

9.  High levels of cellular retinol binding protein-1 expression in leiomyosarcoma: possible implications for diagnostic evaluation.

Authors:  Augusto Orlandi; Arianna Francesconi; Sophie Clément; Patricia Ropraz; Luigi Giusto Spagnoli; Giulio Gabbiani
Journal:  Virchows Arch       Date:  2002-01-31       Impact factor: 4.064

10.  Reduced expression of p21-activated protein kinase 1 correlates with poor histological differentiation in pancreatic cancer.

Authors:  Juan Han; Feng Wang; Shu-qiang Yuan; Ying Guo; Zhao-lei Zeng; Li-ren Li; Jing Yang; De-sen Wang; Mei-yuan Liu; Han Zhao; Kai-yan Liu; Jian-wei Liao; Qing-feng Zou; Rui-hua Xu
Journal:  BMC Cancer       Date:  2014-09-03       Impact factor: 4.430

View more
  11 in total

1.  Multi-marker analysis of genomic annotation on gastric cancer GWAS data from Chinese populations.

Authors:  Fei Yu; Tian Tian; Bin Deng; Tianpei Wang; Qi Qi; Meng Zhu; Caiwang Yan; Hui Ding; Jinchen Wang; Juncheng Dai; Hongxia Ma; Yanbing Ding; Guangfu Jin
Journal:  Gastric Cancer       Date:  2018-06-01       Impact factor: 7.370

2.  FSCN1 is an effective marker of poor prognosis and a potential therapeutic target in human tongue squamous cell carcinoma.

Authors:  Yue Chen; Tian Tian; Zhi-Yong Li; Chun-Yang Wang; Rong Deng; Wei-Ye Deng; An-Kui Yang; Yan-Feng Chen; Hao Li
Journal:  Cell Death Dis       Date:  2019-05-01       Impact factor: 8.469

3.  Comprehensive analysis of lncRNA-associated competing endogenous RNA network in tongue squamous cell carcinoma.

Authors:  Shusen Zhang; Ruoyan Cao; Qiulan Li; Mianfeng Yao; Yu Chen; Hongbo Zhou
Journal:  PeerJ       Date:  2019-02-06       Impact factor: 2.984

4.  Development of an Immunogenomic Landscape-Based Prognostic Index of Head and Neck Squamous Cell Carcinoma.

Authors:  Jinhua Long; Shichao Zhang; Xianlin Zeng; Yan Ouyang; Yun Wang; Zuquan Hu; Yuannong Ye; Weili Wu; Feng Jin; Shi Zhou; Zhu Zeng
Journal:  Front Mol Biosci       Date:  2020-11-24

5.  Cellular retinol binding protein-1 inhibits cancer stemness via upregulating WIF1 to suppress Wnt/β-catenin pathway in hepatocellular carcinoma.

Authors:  Xiangye Liu; Wenhua Shan; Tingting Li; Xiaoge Gao; Fanyun Kong; Hongjuan You; Delong Kong; Shuxi Qiao; Renxian Tang
Journal:  BMC Cancer       Date:  2021-11-14       Impact factor: 4.430

6.  The HSP90/Akt pathway may mediate artemether-induced apoptosis of Cal27 cells.

Authors:  Jianhua Wu; Lei Li; Yiting Wang; Xiaobin Ren; Ken Lin; Yongwen He
Journal:  FEBS Open Bio       Date:  2019-08-30       Impact factor: 2.693

7.  Knockdown of ectodysplasin-A receptor-associated adaptor protein exerts a tumor-suppressive effect in tongue squamous cell carcinoma cells.

Authors:  Meng Li; Yu-Ting Bai; Kun Han; Xiao-Dong Li; Jian Meng
Journal:  Exp Ther Med       Date:  2020-03-06       Impact factor: 2.447

8.  Anticancer Potential of Selected Flavonols: Fisetin, Kaempferol, and Quercetin on Head and Neck Cancers.

Authors:  Robert Kubina; Marcello Iriti; Agata Kabała-Dzik
Journal:  Nutrients       Date:  2021-03-05       Impact factor: 5.717

9.  Correlation of carbonic anhydrase 9 (CA9) with pathological T-stage and prognosis in patients with oral tongue squamous cell carcinoma.

Authors:  Shuang Wang; Zhiguang Fu; Yizhu Wang; Yaping Sun; Lei Cui; Chunfang Wang; Qiaoling Liu; Dan Shao; Yu Wang; Ning Wen
Journal:  Ann Transl Med       Date:  2020-11

10.  Integrative Analysis of Identifying Methylation-Driven Genes Signature Predicts Prognosis in Colorectal Carcinoma.

Authors:  Hao Huang; Jinming Fu; Lei Zhang; Jing Xu; Dapeng Li; Justina Ucheojor Onwuka; Ding Zhang; Liyuan Zhao; Simin Sun; Lin Zhu; Ting Zheng; Chenyang Jia; Binbin Cui; Yashuang Zhao
Journal:  Front Oncol       Date:  2021-06-11       Impact factor: 6.244

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.