Effect of lysophosphatidic acid on the follicular development and the expression of lysophosphatidic acid receptor genes during in vitro culture of mouse ovary.

Lysophosphatidic acid (LPA) known as a serum-derived growth factor, is involved in several cell physiological functions in the female reproductive system including: oocyte maturation, in vitro fertilization and embryo implantation by its transmembrane G protein-coupled receptors. The aim of the present study was to examine the effect of LPA on in vitro follicular development of mouse ovarian tissue. Neonatal mouse ovarian tissues were cultured in five different concentrations of LPA (0, 5, 10, 20 and 40 µM). The developmental competence and the function of cultured ovarian tissue were assessed by morphological study using hematoxylin and eosin staining and hormonal analysis. The expression of LPA receptor (LPAR 1-4) genes were analyzed by real-time RT-PCR. The proportion of preantral follicles and the level of E2 hormone were significantly higher in the 20 µM LPA-treated group than those in the other treatment groups. There was a significant difference in the expression of LPAR 1-4 genes in 20 µM LPA treated group in comparison with 0 µM LPA (control group) treated and non-cultured groups. In addition, the expression of LPAR1 gene was higher than other receptor genes in all studied groups. In conclusion supplementation of the media with 20 µM LPA, could improve the survival and developmental potential of follicles and it had positive effects on cell function and stimulation of E2 synthesis in mouse whole ovarian tissues.

Introduction

In vitro culture (IVC) of ovarian tissue has been introduced as an alternative approach for follicular development in the field of reproductive biology.[1]-[4] However, the low survival rate of follicles, maturation rate of oocytes and embryo development was published and up to now no pregnancy was recorded in human.[5] Therefore, the improvement of in vitro culture of ovarian tissue is challenging because it isn’t defined the optimal maturation condition (physical and biochemical condition) for IVC of mouse ovarian tissue.[6],[7]

Many researchers have also been committed to trigger the activation of primordial follicles and oocyte maturation by adding some supplements to culture media such as growth factors, antioxidants, gonadotropins, nutrients.[5],[8]-[10]

Lysophosphatidic acid (LPA) is a phospholipid with 430-480 Da molecular weight[11] that was detected in the blood serum. It is produced by cell components of follicle in all stages of follicular development.[12] It is known as a serum-derived growth factor, involving in several physiological functions of the cells in the female reproductive system[13]-[16] including: oocyte maturation, in vitro fertilization and embryo implantation.[17]-[20] LPA mediates these functions by transmembrane G protein-coupled receptors.[21] It has been shown that following LPA binding to its receptors, multiple signaling pathways can be activated via variety heterotrimeric G proteins subtypes.[20],[22]-[25]

Previous studies demonstrated that the specific cell surface receptors of LPA (LPARs) are expressed in oocyte, cumulus cells, endometrial cells and mast cells.[18],[25]-[29] Available data regarding LPA receptor in the ovarian tissues and cells demonstrated that mRNA of LPAR1, LPAR2 and LPAR4 was detected in mouse ovarian tissues,[30],[31] while the expression of LPAR3 is not demonstrated in mouse ovary.[31],[32] It may be happened because LPAR3 participates in the initiation of downstream signaling cascades though main cellular mechanisms.[27],33-[40]

To the best of our knowledge, there is not sufficient information regarding to the effects of different concentrations of LPA on the follicular development of mouse ovarian tissue. Since the biological effects of LPA may be concentration dependent, therefore, in the present study, the survival and development of mouse ovarian follicles were investigated using different concentrations of LPA.

The results of this work can be used to provide better culture conditions for in vitro culture of human primordial follicles. Furthermore, the present study updates our knowledge on the effect of LPA on the expression of LPA receptor genes in neonatal and postnatal mouse ovaries.

Materials and Methods

Chemicals. All supplements were acquired from Sigma-Aldrich (Dusseldorf, Germany) except otherwise indicated.

Animals and ovarian tissue. In this experimental study, the ovaries were collected from neonatal (7-day-old) National Medical Research Institute (NMRI) mice that were kept under a controlled condition (22.00 ± 2.00 ˚C, 12 hr light: 12 hr dark and 40 to 50% humidity) in the animal house of Tarbiat Modares University. These experiments were performed according to the ethical guidelines for the Care and Use of Laboratory Animals in Tarbiat Modares University (Ref No: 52.8188). The mice (n = 45) were sacrificed by cervical dislocation, and their ovaries were removed and dissected mechanically and washed in alpha-minimal essential medium (α-MEM; Invitrogen, Paifley, UK) supplemented with 5.00% fetal bovine serum (Invitrogen), 100 IU mL-1 penicillin (Invitrogen), 100 µg mL-1 streptomycin (Invitrogen), 0.23 mMol sodium pyruvate (Sigma-Aldrich) and sodium bicarbonate (Sigma-Aldrich).

Experimental design. The collected ovaries were randomly divided into six groups (n = 15 in each group and in three repeats). The ovaries were cultured in α-MEM supplemented with different concentrations of LPA (0, 5, 10, 20 and 40 µM).[19] One week after in vitro culture of mouse ovaries, the morphology of cultured ovaries were studied using hematoxylin and eosin staining and the expression of genes related to folliculogenesis and LPA receptors were evaluated by real time RT-PCR.

culture of ovarian tissue. The whole ovaries in all studied groups (n= 15 in each group) were cultured on inserts (Millicell-CM, 0.4-m pore size; Millipore Corp, Billerica, USA) in 24-well plates including 400 µL of basic culture medium consisted of α-MEM supplemented with 1% insulin, transferrin and selenium (ITS; Gibco), 5.00% fetal bovine serum, 100 mIU mL-1 recombinant FSH (rFSH Serono. Laboratories, Aubonne, Switzerland) and 5, 10, 20 and 40 µM LPA at 37 ˚C in a 5.00% CO2 for one week. Half of the culture medium (200 µL) was renewed with fresh medium every other day and the collected media were reserved at –20 ˚C for evaluation of 17-β-estradiol hormone.

Histological evaluation. Histological features of the ovarian tissues (n = 5 in each group) were evaluated by hematoxylin and eosin staining. The ovaries were fixed in Bouin’s fixative for eight hr. After fixation, the ovaries were embedded in paraffin and the tissue sections were prepared serially at 5 µm-thickness and subsequently mounted on slides with 5th intervals and stained with routine hematoxylin and eosin method. The morphology of ovarian tissues and the number of ovarian follicles were assessed under light microscope field by field. Classification of ovarian follicles (primordial, primary, preantral and antral) was performed according to the previously described method.[41] The follicles containing germinal vesicle in the oocyte were counted before and after seven days in vitro culturing. The normal follicles had intact oocyte and granulosa cells and the degenerated follicles had pyknotic oocyte nuclei and disarranged granulosa cells.

Ovarian surface area. The micrographs of each ovary at the same magnification during culture period (on days 0, 3, 5 and 7 of culture) were captured and the area of each ovary was analyzed and determined in cubic micrometers (µm2) by Digimizer software (MedCalc Software bvba, Acacialaan, Belgium).

RNA extraction and cDNA synthesis. Total RNA was extracted from 0 and seven days cultured ovaries (n = 3 in each group in three repeats) using the trizol reagent (Invitrogen) according to procedure described by the manufacturer’s instructions RNeasy Mini Kit (Qiagen, Hilden, Germany). Briefly, the ovaries were homogenized in 0.5 mL of trizol reagent then, 0.2 mL of chloroform was added per one mL of trizol and the samples were centrifuged at 12000 g for 10 min. The upper colorless aqueous phase was transferred to a fresh two mL microtube and 700 μL of 100% isopropanol (Sigma-Aldrich) were added and centrifuged at 12000 g for 10 min. Then 1.5 mL 70% ethanol (Merck, Dusseldorf, Germany) per one mL of trizol reagent was added. RNA concentration was determined using spectrophotometry (Eppendorf, Hamburg, Germany).

The cDNA was synthesized using cDNA synthesis kit (ThermoFisher Scientific, Lithuania, USA) according to the manufacturer’s instructions. Oligo (dT) was used for cDNA synthesis and reverse transcriptase reaction was incubated at 42 ˚C for 60 min. After inactivation of the reverse transcriptase enzyme, the resultant product was stored at – 20 ˚C.

Real-time RT-PCR. The primers for LPAR1-4 genes were designed using Primer-BLAST tool in NCBI (Table 1). The designed primers were analyzed using Oligo-Analyser.[42] In the present study β-actin gene was considered as housekeeping gene. Real-time RT-PCR was performed using QuantiTect SYBR Green RT-PCR kit (Qiagen). Thermal program of the real-time RT-PCR was set with the following parameters: the initial holding stage for 5 min at 95 ˚C, 40 cycles cycling stage of 15 sec at 95 ˚C, 58 ˚C for 30 sec, and 72 ˚C for 15 sec, that was continued by a melt curve stage at 95 ˚C for 15 sec, 60 ˚C for 1 min, and 95 ˚C for 15 sec. After completing the PCR run, the melt curve was obtained using the amplicon. For determining of relative quantitation of target genes the Pfaffl method was used.[43]

Table 1.

The sequences of the designed primers used for evaluating the expression of LPAR 1-4 genes

Accession numbers	Gene	Primer Sequence	PCR product size (bp)
XM_011249935.1	LPAR1	Forward primer: CTGCCTCTACTTCCAGCCCTGReverse primer: GCTCACTGTGTTCCATTCTGTG	141
NM_020028.3	LPAR2	Forward primer: GACCACACTCAGCCTAGTCAAGACReverse primer: CTTACAGTCCAGGCCATCCA	106
NM_022983.4	LPAR3	Forward primer: CCACTTTCCCTTCTACTACCTGCTReverse primer: GACGGTCAACGATTTCGACACC	115
NM_175271.4	LPAR4	Forward primer: GCCAGTTGCCAGTTTACACGReverse primer: TGGACGCAGACGATCAGA GA	118
NM_031144.2	β-actin	Forward primer: CTATGTTGCCCTAGACTTCGReverse primer: AGGTCTTTACGGATGTCAAC	228

Hormonal assay. For the evaluation of the endocrine function of ovaries, the concentration of 17-β-estradiol (E2), was measured in the collected media obtained from cultured ovaries on days 3 and 7 (n = 15 per groups in three repeats) using microplate enzyme immunoassay kit (Mono-bind Inc., Lake Forest, USA) with sensitivity = 6.5 pg mL-1).[44]

Statistical analysis. Statistical analysis was performed using SPSS (version 21.0; IBM Corp., Armonk, USA). Values are given as mean ± SE. One-way ANOVA and post hoc Tukey was used to compare differences in follicular count, ovarian area and mRNA expression. The data of hormone level was analyzed with Student's t-test. A p value less than 0.05 was considered as statistically significant at the 95.00% confidence level.

Results

Morphology of ovaries and follicular count. The morphological observations of cultured ovaries under invert microscope in different groups of study were shown in Figure 1. Our results demonstrated that the follicles were grown more on the periphery of ovarian tissues and they had a large and clear antral cavity. The growth of follicles was parallel with increasing in the size of ovaries during the culture period. However, in the central parts of the ovaries the density of the tissue was higher than marginal and central parts of tissue was dark.

Fig. 1

Photomicrographs of mouse ovaries imaged under an inverted microscope on days 0, 5 and 7. A1-A3: cultured group (0 µM LPA) (Control); B1-B3: 5 µM LPA treated group; C1-C3:10 µM LPA treated group; D1-D3: 20 µM LPA treated group; E1-E3: 40 µM LPA treated group. The central area of cultured ovaries was observed dense and dark in some groups. The growth of follicles in the marginal parts caused to increase in the size of ovaries during the culture period

Light microscopy. The light microscopic observations of examined groups using H&E staining are shown in Figure 2. Before in vitro culturing, the primordial follicles were mainly seen and located in the peripheral part of the ovaries. After seven days of ovaries culture, the primordial, primary and antral follicles were prominent within the ovarian tissue (Fig. 2). The healthy follicles with normal structure were visible in all examined groups especially in 20 µM LPA supplemented group (Fig. 2: D1-D3). The granulosa cells of follicles arranged well around the oocyte. The damage follicles (pyknotic nuclei oocytes and disarranged granulosa cells) were prominent (Fig. 2: A1-A3) especially in the central area of ovaries that were cultured in the absence of LPA (control group; Fig. 2). In addition, in 40 µM LPA-treated group some premature antral follicles were seen (Fig. 2: E1-E3).

Fig. 2

Photomicrographs of mouse ovarian tissues imaged under the light microscope after seven-day culture using hematoxylin and eosin staining: A1-A3: cultured group (0 µM LPA) (control); B1-B3: 5 µM LPA treated group; C1-C3: 10 µM LPA treated group; D1-D3: 20 µM LPA treated group; E1-E3: 40 µM LPA treated group. Note: the follicles that were at advanced stages of development with normal and atretic morphology, were seen on day 7 of culture in all examined groups, atretic follicles especially in low concentration of LPA treated groups (less than 20 µM) were prominent than the other groups in central area of ovaries

The number of normal follicles in the examined groups. The percentages of normal and atretic follicles at different developmental stages at the end of seven days of culture were summarized in Table 2. Before in vitro culturing, the proportion of primordial follicles were higher than other stages of follicles but after seven days culture, the percentage of primordial and primary follicles were decreased and the percentages of preantral follicles were significantly increased in all groups (p < 0.05). The percent of preantral follicles was significantly higher in the concentration of 20 µM LPA than other groups (p < 0.05; Table 2).

Table 2

Number of (percentage ± SD) of follicles at different developmental stages in all studied groups

Groups	Normal follicles	Primordial follicles	Primary follicles	Preantral follicles	Degenerated follicles	Antral follicles
Before culture	3248	2987 (91.96 ± 2.28)	184 (5.67 ± 1.88)	77 (2.37 ± 1.04)	490 (13.10 ± 2.53)	0
Cultured 0 µM LPA	1351	903 (66.84 ± 3.28) a	152 (11.25 ± 0.70) a	296 (21.91 ± 1.60) a	486 (25.36 ± 2.54) a	0
Cultured 5 µM LPA	1375	907 (65.97 ± 0.99) a	152 (11.12 ± 1.59) a	315 (22.91 ± 1.85) a	461 (25.92 ± 3.00) a	0
Cultured 10 µM LPA	1329	849 (63.93 ± 1.53) a	172 (12.95 ± 1.32) a	308 (23.19 ± 1.48) a	444 (25.04 ± 2.09) a	0
Cultured 20 µM LPA	1317	674 (51.17 ± 1.18) ab	152 (11.55 ± 0.52) ab	491 (37.28 ± 1.23) ab	255 (16.22 ± 0.63) ab	0
Cultured 40 µM LPA	1446	802 (55.43 ± 1.73) a	200 (13.81 ± 1.03) a	313 (21.64 ± 0.85) a	407 (21.96 ± 2.89) a	131 (9.12 ± 1.23)

The percentage of follicles at different developmental stages ovaries before and after culturing in the presence of different doses of LPA.

indicates significant differences with before cultured ovaries in different developmental stage (p < 0.05) and

indicates significant with other groups after culture (p < 0.05).

Ovarian surface area. The analysis of ovarian surface area data in all groups of study during in vitro culture was shown in Figure 3. The mean surface area was significantly increased during seven days culture (Fig. 3) and the surface area was markedly higher in the 20 µM LPA-treated group than those of other groups (p < 0.05).

Fig. 3

The mean area of mouse cultured ovaries on days 0, 5 and 7 of culture period. * indicates significant difference with other groups after culturing (using 20 µM of LPA

Real time RT-PCR results. The expression ratio of the LPA receptors genes to β-actin gene in non-cultured, 20 µM LPA-treated and without LPA cultured (control) groups were demonstrated and compared in Figure 4A to 4D. As the results shown, the expression ratio of LPAR1-4 genes in non-cultured group were 0.27 ± 0.04, 0.21 ± 0.04, 0.21 ± 0.03, 0.15 ± 0.01 in control cultured groups were 0.20 ± 0.03, 0.21 ± 0.01, 0.31 ± 0.01, 0.22 ± 0.01 and in 20 µM LPA-treated cultured group were 0.35 ± 0.02, 0.26 ± 0.01, 0.43 ± 0.01, and 0.35 ± 0.02, respectively (p < 0.05).

Fig. 4. A, B, C, and D

The mRNA expression of LPA receptor genes (LPAR 1, LPAR 2, LPAR 3, LPAR 4) before and after in-vitro culture (0 and 20 µM LPA-treated groups) of mouse ovarian tissues. * indicates a significant difference with non-cultured group

There was no significant difference between control cultured group and non-cultured group. However, there was a significant difference between 20 µM LPA treated cultured group and other two groups (p < 0.05). The results demonstrated that the expression of LPAR1 gene was higher than other genes in all examined groups (p < 0.05).

Hormonal assay. The concentrations of E2 hormone obtained from collected media in different groups on days three and seven of culturing period are presented in Table 3. There was a significant difference in the level of E2 hormone on day three of culture between two groups (p < 0.05). The level of E2 hormone significantly increased in 20 µM LPA-treated group in comparison with control group (p < 0.05).

Table 3.

Concentration of 17-β-estradiol (pg mL-1) in collected media during culture period. Data are presented as mean ± SD

Groups	Day 3 of culture	Day 7 of culture
Control	2341.47 ± 124.87a	8155.48 ± 439.22a
Cultured (20 µM LPA)	3095.29 ± 126.60b	12120.14 ± 300.86b

values with different letters in each column indicate significant differences p < 0.05.

Discussion

The findings of the present study confirmed that the supplementation of the mouse ovarian organ culture medium with 20 µM LPA could lead to achieve the higher percentages of follicular development (up to preantral stage), increase the mean surface area of ovaries and enhance the function of granulosa and theca cells by production of higher levels of 17-β-estradiol in comparison with the other groups. These results revealed that the LPA could stimulate the growth of primordial and primary follicles to preantral follicle stage and it seems these effects of LPA are dose dependent. The follicular growth rate was gradually improved during in vitro culture up to 20 µM concentration of LPA then this rate was decreased at concentrations of 40 µM of LPA. The previous studies postulated that LPA involved in the cell survival, activation of entire primordial follicle pool and promotion nuclear and cytoplasmic maturation of mouse oocytes by binding to its receptors and involving in the MAPK (mitogen-activated protein kinase)/p38 and PI3K (phosphoinositol 3-kinase)/Akt pathways.[16],[45] Similarly, Jo et al. revealed that treatment of mouse oocyte culture media with 30 µM LPA, could significantly enhances the maturation rate of oocyte, the fertilization rate and subsequently the developmental rate of blastocyst.[19] According to Boruszewska et al., the supplementation of bovine oocyte maturation medium with LPA increases mRNA abundances of genes involved in bovine oocyte maturation (FST and GDF9).[46] They confirmed that LPA plays a potential autocrine and/or paracrine role between the bovine oocytes and granulosa cells, via several LPARs. However, they did not see any significant influence of LPA on maturation rate of oocytes. They concluded that mRNA level the usage of low concentration of LPA can affect the expression of gene related to maturation of oocytes.[46]

In this study, we examined the expression of several LPA receptors genes in cultured mouse ovaries. Our results showed that in the ovarian tissues of this strain of NMRI mouse, all four types of LPARs (1-4) were expressed at the mRNA level. But there are controversial reports related to the expression of LPA receptors in mouse ovarian tissue.[32],[47] Huang et al. detected the expression of LPAR1-4 in C57BL/6 mouse ovarian tissue[47] and Ye et al. demonstrated that mouse ovary expressed LPAR1, LPAR2 and LPAR4 but there was no evidence about the presence of LPAR3.[32] While our study is the first to demonstrate that the four types of LPA receptors were expressed before and after in vitro culture (in the presence and absence of LPA) in mouse ovarian tissue. These different observations may be due to the mouse strain which have been used.

The LPA-LPARs binding activates various types of G-proteins and thereby induces signal intracellular transduction cascade and stimulates many vital pathways.[23] These signaling key pathways regulate many essential processes including cell proliferation, survival and growth, cytoskeletal rearrangement and primordial follicles activation through multiple downstream molecules.[24],[27],[48],[49]

In addition, in this study it was demonstrated that LPA stimulated granulosa and theca cell to produce 17-β-estradiol (functional marker) in mouse ovarian tissues that may promotes ovarian follicular development. Moreover, the levels of 17-β-estradiol was significantly enhanced in 20 µM LPA supplemented group. Boruszewska et al. postulated that LPA stimulated 17-β-estradiol synthesis in bovine granulosa cells that correlated with increasing in the follicle stimulating hormone ‎receptor and 17-β-hydroxy ‎ steroid dehydrogenase mRNA expression. In addition, they documented this stimulatory effect of LPA enhanced in the presence of follicle stimulating hormone and thereby, induced the expression of cytochrome P450 aromatase genes that convert the androgens to 17-β-estradiol in thecal cells.[50]

In conclusion, this study demonstrated that the addition of LPA to the IVC media, especially at 20 µM, could improve the survival and developmental potential of follicles in mouse whole ovarian tissues after 7 days of culture. Furthermore, the present study updates our knowledge on gene expression of LPA receptors in neonatal and postnatal mouse whole ovaries that may have positive effects on cell function and stimulation of 17-β-estradiol synthesis.