Literature DB >> 29707669

Effect of biogenic selenium nanoparticles on ERG11 and CDR1 gene expression in both fluconazole-resistant and -susceptible Candida albicans isolates.

Nasrin Parsameher1, Sassan Rezaei2, Sadegh Khodavasiy2, Samira Salari1, Sanaz Hadizade1, Mohammad Kord2, Seyed Amin Ayatollahi Mousavi1.   

Abstract

BACKGROUND AND
PURPOSE: Candida albicans is the most common Candida species (sp.) isolated from fungal infections. Azole resistance in Candida species has been considerably increased in the last decades. Given the toxicity of the antimicrobial drugs, resistance to antifungal agents, and drug interactions, the identification of new antifungal agents seems essential. In this study, we assessed the antifungal effects of biogenic selenium nanoparticles on C. albicans and determined the expression of ERG11 and CDR1 genes.
MATERIALS AND METHODS: Selenium nanoparticles were synthesized with Bacillus sp. MSH-1. The ultrastructure of selenium nanoparticles was evaluated with a transmission electron microscope. The antifungal susceptibility test was performed according to the modified Clinical and Laboratory Standards Institute M27-A3 standard protocol. The expression levels of the CDR1 and ERG11 genes were analyzed using the quantitative real-time polymerase chain reaction (PCR) assay.
RESULTS: The azole-resistant C. albicans and wild type C. albicans strains were inhibited by 100 and 70 µg/mL of selenium nanoparticle concentrations, respectively. The expression of CDR1 and ERG11 genes was significantly down-regulated in these selenium nanoparticle concentrations.
CONCLUSION: As the findings indicated, selenium nanoparticles had an appropriate antifungal activity against fluconazole-resistant and -susceptible C.albicans strains. Accordingly, these nanoparticles reduced the expression of CDR1 and ERG11 genes associated with azole resistance. Further studies are needed to investigate the synergistic effects of selenium nanoparticles using other antifungal drugs.

Entities:  

Keywords:  CDR1; Candida albicans; ERG 11; Nanoparticles

Year:  2017        PMID: 29707669      PMCID: PMC5914922          DOI: 10.29252/cmm.3.3.16

Source DB:  PubMed          Journal:  Curr Med Mycol        ISSN: 2423-3420


Introduction

Over the past decade, Candida infections has dramatically increased among the high-risk patients [1]. The excessive use of antifungal agents due to the limited availability of antifungal medications leads to the emergence of drug resistance in pathogenic species [2]. Regardless of drug resistance, the long-term use of antifungal medications has irreparable side effects in patients, which can lead to death in some cases [3, 4]. The rate of azole resistance is on a growing trend in Candida species. Accordingly, there are extensive biochemical studies highlighting a significant diversity in the mechanisms conferring resistance to azoles. Some of these mechanisms include changes in the efflux system and mutation in ergosterol biosynthesis pathway genes [5]. The increased mRNA levels of Candida drug resistance gene family (CDR) and multi-drug resistance (MDR) have been associated with azole resistance [5, 6]. In addition, the overexpression of CDR1 and CDR2 in C. albicans is associated with cross-resistance to the azoles [7]. Ergosterol biosynthesis pathway is another pathway of azole resistance. The overexpression of ERG11 gene leads to an increase in the target drug. Therefore, a higher concentration of drug is required to react to all of enzyme molecules present in the cells, and thereby decrease the susceptibility to azole in Candida species [8]. The advent of this drug resistance necessitates the development of new antifungal agents to overcome the resistant strains. Nanoparticles (NPs) are a new generation of antimicrobial agents that have been highly studied in the last two decades [9-11]. Among them, metal NPs and metal oxide have unique properties and are considered as antimicrobial agents [12]. Selenium is one of the essential elements for human health that improves the immune system and exerts anti-cancer effects. Nevertheless, there are problems with the pharmaceutical application of selenium for the treatment of infections. The nanotechnology recommends the use of this element for nutritional and pharmaceutical purposes [13]. On the other hand, selenium nanoparticles (Se NPs), as strong antioxidants, are much less toxic than selenium. Moreover, they have high power in scavenging free radicals; consequently, they can be used as a natural antioxidant [14]. Selenium sulfide has long been known as an antifungal agent used as anti-dandruff [15]. However, few studies have been published on the antifungal effects of Se NPs. The expression of ERG11 and CDR genes have been identified as the mechanisms responsible for resistance to azole in Candida species. Regarding this and given the alterations in the structure of these two genes, the present study aimed to investigate the inhibitory effect of biogenic Se NPs on fluconazole-resistant C. albicans. In addition, the alternation in ERG11 and CDR1 gene expression was assessed in fluconazole-resistant C. albicans using the real-time polymerase chain (PCR) reaction technique.

Materials and Methods

Fluconazole-resistant C. albicans (ATCC 76615) and fluconazole-susceptible C. albicans (ATCC 10231) were used to test antifungal susceptibility and gene expression by real-time PCR. The biosynthesis of Se NPs was accomplished using Bacillus sp. MSh-1 strain, which was previously isolated from the Caspian Sea (located in the northern part of Iran) and identified by 16S rDNA gene analysis technique (GenBank accession number: GU183144.1), based on a method described by Shakibaie et al. [16]. Briefly, selenium dioxide powder (Merk, Germany) was dissolved in sterilized distilled water, and then filtered by a 0.22 μm diameter pore. In the next step, 1 mL of this solution was added to 99 mL nutrient medium; subsequently, 1 mL of Bacillus sp. Msh-1 suspension was added. After 14 h, the obtained solution was centrifuged for 10 min at 5000 rpm, and the supernatant was removed. Sediment was washed twice with 0.9% sodium chloride. The cells were then broken down by the liquid nitrogen and sonication (5 min/100 W). Subsequently, 4 ml of the above suspension was added to 2 ml ethanol and mixed vigorously. The tubes were centrifuged at 3000 rpm for 5 min and cooled for 24 h at 4°C to separate the two phases. After the gentle removal of the supernatant, the residual nanoparticles were washed with the chloroform, ethanol 70%, and distilled water, respectively. The size and morphology of Se NPs were examined by using a transmission electron microscope (TEM, Zeiss Supra 55 VP TEM, operated at 100 KV). The chemical properties of nanoparticles were also characterized by the energy-dispersive X-ray spectroscopy technique [17]. Fungistatic activity and minimum inhibitory concentrations (MICs) of Se NPs against C. albicans strains were determined according to the recommend-dations stated in the Clinical and Laboratory Standards Institute M27-A3 and M27-S4 documents [18]. An RPMI-1640 medium buffered at pH 7.0 with 3-N-morpholino propanesulfonic acid was used as the culture medium. The inoculum size of C. albicans was 0.5-2.5×103 cells/mL. The concentration of Se NPs in the dispersion ranged within 10-200 µg/mL. Subsequently, 100 μL of yeast suspension and 100 μL of each concentration of Se NPs were added to the respective well of microtiter plates. The microdilution plates inoculated at 35oC for 48 h. The lowest concentration of the Se NPs, inhibiting the visible growth of microorganisms, was considered as the MIC. C. parapsilosis ATCC 22019 standard strain was used as quality control. We extracted RNA from the last dilution of the drug based on MIC, and also from the positive control sample. Afterwards, 6×108 cells of the fungal suspension were centrifuged for 2 min/12000 g, and the supernatant was removed. RNA was extracted using the RNA extraction kit (Gene, JET RNA purification kit, fermentase, Germany). After centrifugation, the sediment was stored at -20oC until use. The complementary DNA (cDNA) was synthesized according to the manufacturer's recommendations using a cDNA synthesis kit (Fermentas, USA). The materials used for making cDNA included 0.9-1.5 μL RNA template, 1 μL of random hexamer primer, 9.5-10.1 μL DW, 4 μL 5x reaction buffer, 1 μL RiboLock RNase Inhibitor, 2 μL of 10 mM dNTP Mix, and 1 μL reverse transcriptase in a final volume of 20 μL. Real-time PCR was performed using a Corbett Rotor-Gene 3000 (Corbett Robotics, Australia), and SYBR Premix Ex Taq II (BioFact, Daejeon, Korea). The sequence of primers and their characteristics are illustrated in Table 1. All PCR mixtures contained 10 μL SYBR Premix Ex Taq II (2×), 2 μL of first strand cDNA, 1 μL of each specific primers (4 pmol) and 6 μL of diethyl pyrocarbonate water in a final volume of 20 μL. The amplification was initiated at 95°C for 15 min, followed by 45 cycles of denaturation at 95°C for 30 sec, annealing at 60°C for 40 sec, and extension at 72°C for 30 sec.
Table 1

Nucleotide sequences of CDR1 and ERG11 primers

Name nt GC% Tm Sequence GeneBank
CDR1-S 20 50 53.65 5’GGTGCTAATATCCAATGTTGG’3 X77589.1
CDR1-AS 20 50 50.22 5’GTAATGGTTCTCTTTCAGCTG’3
ERG11-S 20 45 59.88 5’CAGAAAAGTGGCGTTGTTGA’3 KM875729.1
ERG11-AS 20 45 59.69 5’GCAGCATCACGTTTCCAATA’3
Nucleotide sequences of CDR1 and ERG11 primers The expression of all genes was normalized to the housekeeping gene β actin. Standard curves for each gene were established with five serially diluted cDNA, obtained from the cells grown to mid-logarithmic phase, using specific primers under the appropriate PCR conditions. Experiments under each condition were performed in duplicate, and negative control (water as template) was included in each run. The CDR1 and ERG11 gene expression was analyzed with REST software (2009; Version 2.0.7). The software uses the comparative Ct method (ΔΔCt) to analyze data.

Results

Spherical Se NPs were produced in a range of 80-200 nm by Bacillus sp. Msh-1 based on the transmission electron micrograph from pure Se NPs, and nanoparticles in the range of 125-150 nm were the most frequent ones. The energy-dispersive X-ray spectroscopy micro analysis of pure Se NPs showed three absorption peaks consisting of SeLα (1.37 keV), SeKα (11.22keV) and SeKβ (12.49 keV) (Figure 1). The MIC for fluconazole-resistant C. albicans and fluconazole-susceptible C. albicans in antifungal susceptibility test for Se NPs were 100 and 70 µg/mL, respectively.
Figure 1

Synthesis and characterization of selenium colloidal nanoparticles synthesized by using Bacillus sp. MSh-1, A) Transmission electron micrograph of pure selenium nanoparticles, B) Particle size distribution histogram of the biogenic selenium nanoparticles, C) Energy-dispersive X-ray images of purified selenium nanoparticles

Fluconazole-resistant and -susceptible C. albicans strains were shown to reduce the expression of CDR1 and ERG11 genes after exposure to 70 and 100 µg/mL Se NPs, respectively. The results of CDR1 and ERG11 gene expression are displayed in Table 2. In fluconazole susceptible-C. albicans, CDR1 and ERG11 were down-regulated in the sample group by the mean factors of 0.067 and 0.038 expression rates, respectively. Similarly, in fluconazole-resistant C. albicans, CDR1 and ERG11 were down-regulated in the sample group by the mean factors of 0.022 and 0.027 expression rates, respectively.
Table 2

Results of CDR1 and ERG11 genes expression in fluconazole-resistant and -susceptible C. albicans

Candida species Gene Type Reaction efficiency Expression Result
Fluconazole-resistant C. albicans CDR1 TRG0.690.022Down
ERG11 TRG1.00.027Down
Fluconazole-susceptible C. albicans CDR1 TRG0.640.067Down
ERG11 TRG1.00.038Down

TRG: target, REF: reference, Down: down-regulation

Synthesis and characterization of selenium colloidal nanoparticles synthesized by using Bacillus sp. MSh-1, A) Transmission electron micrograph of pure selenium nanoparticles, B) Particle size distribution histogram of the biogenic selenium nanoparticles, C) Energy-dispersive X-ray images of purified selenium nanoparticles Results of CDR1 and ERG11 genes expression in fluconazole-resistant and -susceptible C. albicans TRG: target, REF: reference, Down: down-regulation

Discussion

The use of nanotechnology has increased in many medical fields, especially drug delivery [12]. The synthesis of nanoparticles by microorganisms and plant extracts is suggested as a suitable method, compared to the physical and chemical methods [13]. Unique properties, such as high surface-to-volume ratio and their nanoscale size, are the advantages of nanoparticles. This high surface-to-volume ratio of the nanoparticles provides more active sites for interacting with biological entities, such as cells [19]. To date, the antifungal effects of different nanoparticles, such as iron NPs, silver NPs, and gold NPs, have been studied [20-23]. The Se NPs increase the efficiency of glutathione peroxidase and thioredosin reductase [24] . Nano selenium is also reported as an antioxidant with reduced risk of direct toxicity on cells [25]. The antibacterial, antiviral, and antioxidant activities of Se NPs, in addition to their lower toxicity, have introduced them as interesting compounds in nano-biotechnology [26, 27]. In this study, the antifungal activity of Se NPs against C. albicans as a model for fungi was investigated. The results of the study showed that the Se NPs produced by Bacillus MSH-1 had antifungal activity against C. albicans. Limited studies have been carried out on the Se NPs. The anti-biofilm activity of biogenic Se NPs and selenium dioxide against the clinical isolates of Staphylococcus aureus, Pseudomonas aeruginosa, and Proteus mirabilis has been demonstrated [28]. Kazempour et al. investigated the antifungal activity of Se NPs, produced by Klebsiella pneumonia, against Aspergillus niger and C .albicans. They reported the Se NPs MIC values of 250 and 2000 µg/mL for A. niger and C. albicans, respectively [29]. In addition, Shakibaei et al. showed the antifungal effects of Se NPs synthesized by Bacillus species on Aspergillus fumigatus and C. albicans. In the mentioned study, the MICs of Se NPs against C. albicans and A. fumigatus were 70 and 100 μg/mL, respectively [30], which is consistent with our results. Several genes associated with azole resistance (e.g., CDR1, CDR2, MDR1, ERG3, ERG6, ERG11, ERG9, RTA2, and NAG2) have been identified in Candida species. Each of these genes promotes the resistance of the organism to antifungal drugs with different molecular mechanisms [31-33]. All of these results indicate that Se NPs can be effective in the fungus with different mechanisms, compared to the conventional antifungal agents. According to the results of this study, Se NPs could reduce the resistance of C. albicans to antifungal drug by decreasing the expression of the drug-related genes. In our study, the real-time PCR revealed the down-regulation of CDR1 and ERG11 genes for C. albicans exposed to Se NPs with concentrations of 70 and 100 μg/mL, respectively.

Conclusion

In conclusion, Se NPs reduced the expression of CDR1 and ERG11 genes. The down-regulation of these genes can decrease the resistance of Candida strains to azole. Common antifungal agents that are currently prescribed for the treatment of various fungal infections, have limitations, such as toxicity and drug resistance. According to the obtained results, the synthetized Se NPs can be an appropriate agent against C. albicans; moreover, they can facilitate overcoming the azole resistance. However, it is required to conduct more in vitro and in vivo investigations in this regard.
  25 in total

1.  Energy dispersive X-ray spectroscopy of bimetallic nanoparticles in an aberration corrected scanning transmission electron microscope.

Authors:  Andrew A Herzing; Masashi Watanabe; Jennifer K Edwards; Marco Conte; Zi-rong Tang; Graham J Hutchings; Christopher J Kiely
Journal:  Faraday Discuss       Date:  2008       Impact factor: 4.008

Review 2.  Selenium in cancer prevention: a review of the evidence and mechanism of action.

Authors:  Margaret P Rayman
Journal:  Proc Nutr Soc       Date:  2005-11       Impact factor: 6.297

3.  Antibacterial action of selenium-enriched probiotics against pathogenic Escherichia coli.

Authors:  Jiajun Yang; Kehe Huang; Shunyi Qin; Xianshi Wu; Zhiping Zhao; Fu Chen
Journal:  Dig Dis Sci       Date:  2008-07-10       Impact factor: 3.199

Review 4.  Candida albicans drug resistance another way to cope with stress.

Authors:  Richard D Cannon; Erwin Lamping; Ann R Holmes; Kyoko Niimi; Koichi Tanabe; Masakazu Niimi; Brian C Monk
Journal:  Microbiology       Date:  2007-10       Impact factor: 2.777

5.  Elemental selenium at nano size possesses lower toxicity without compromising the fundamental effect on selenoenzymes: comparison with selenomethionine in mice.

Authors:  Huali Wang; Jinsong Zhang; Hanqing Yu
Journal:  Free Radic Biol Med       Date:  2007-02-20       Impact factor: 7.376

6.  Decreased incidence of prostate cancer with selenium supplementation: results of a double-blind cancer prevention trial.

Authors:  L C Clark; B Dalkin; A Krongrad; G F Combs; B W Turnbull; E H Slate; R Witherington; J H Herlong; E Janosko; D Carpenter; C Borosso; S Falk; J Rounder
Journal:  Br J Urol       Date:  1998-05

7.  Evaluation of reference genes for real-time quantitative PCR studies in Candida glabrata following azole treatment.

Authors:  Qingdi Quentin Li; Jeff Skinner; John E Bennett
Journal:  BMC Mol Biol       Date:  2012-06-29       Impact factor: 2.946

8.  Functional characterization of the Chlamydomonas reinhardtii ERG3 ortholog, a gene involved in the biosynthesis of ergosterol.

Authors:  Kristy M Brumfield; James V Moroney; Thomas S Moore; Tiffany A Simms; David Donze
Journal:  PLoS One       Date:  2010-01-11       Impact factor: 3.240

9.  Sub-inhibitory concentration of biogenic selenium nanoparticles lacks post antifungal effect for Aspergillus niger and Candida albicans and stimulates the growth of Aspergillus niger.

Authors:  Zahra Bahri Kazempour; Mohammad Hossein Yazdi; Fatemeh Rafii; Ahmad Reza Shahverdi
Journal:  Iran J Microbiol       Date:  2013-03

10.  Antifungal Activity of Selenium Nanoparticles Synthesized by Bacillus species Msh-1 Against Aspergillus fumigatus and Candida albicans.

Authors:  Mojtaba Shakibaie; Naser Salari Mohazab; Seyyed Amin Ayatollahi Mousavi
Journal:  Jundishapur J Microbiol       Date:  2015-09-08       Impact factor: 0.747

View more
  5 in total

1.  Effect of Allium cepa loaded polyacrylonitrile and polyvinyl pyrrolidone nanofibers on Candida albicans growth and the expression of CDR1 and CDR2 genes.

Authors:  Azam Nademi; Masoomeh Shams-Ghahfarokhi; Mehdi Razzaghi-Abyaneh
Journal:  Curr Med Mycol       Date:  2021-12

2.  In-Vitro Activity of Nano Fluconazole and Conventional Fluconazole against Clinically Important Dermatophytes.

Authors:  Najmossadat Musavi Bafrui; Seyed Jamal Hashemi Hazaveh; Mansour Bayat
Journal:  Iran J Public Health       Date:  2020-10       Impact factor: 1.429

3.  Effect of fluconazole and terbinafine nanoparticles on the treatment of dermatophytosis induced by Trichophyton mentagrophytes in guinea pig.

Authors:  Mahshid Lalvand; Seyed Jamal Hashemi; Mansour Bayat
Journal:  Iran J Microbiol       Date:  2021-10

4.  Fluconazole conjugated-gold nanorods as an antifungal nanomedicine with low cytotoxicity against human dermal fibroblasts.

Authors:  Khawla M Hamad; Nouf N Mahmoud; Sabaa Al-Dabash; Luma A Al-Samad; Maha Abdallah; Amal G Al-Bakri
Journal:  RSC Adv       Date:  2020-07-08       Impact factor: 4.036

5.  Inhibitory effect of magnetic iron-oxide nanoparticles on the pattern of expression of lanosterol 14α-demethylase (ERG11) in fluconazole-resistant colonising isolate of Candida albicans.

Authors:  Mohammad Zare-Khafri; Fahimeh Alizadeh; Sadegh Nouripour-Sisakht; Alireza Khodavandi; Majid Gerami
Journal:  IET Nanobiotechnol       Date:  2020-07       Impact factor: 1.847

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.