Literature DB >> 29670836

Construction and Development of a Cardiac Tissue-Specific and Hypoxia-Inducible Expression Vector.

Shahrooz Ghaderi1,2,3, Neda Alidadiani1, Jafar Soleimani Rad4, Hamid Reza Heidari5, Nafi Dilaver6, Behzad Mansoori1, Reza Rhabarghazi7,8, Rezayat Parvizi9, Vahid Khaze Shahgoli1, Behzad Baradaran1.   

Abstract

Purpose: Cardiovascular gene therapy is a sophisticated approach, thanks to the safety of vectors, stable transgene expression, delivery method, and different layers of the heart. To date, numerous expression vectors have been introduced in biotechnology and biopharmacy industries in relation to genetic manipulation. Despite the rapid growth of these modalities, they must be intelligently designed, addressing the cardiac-specific transgene expression and less side effects. Herein, we conducted a pilot project aiming to design a cardiac-specific hypoxia-inducible expression cassette.
Methods: We explored a new approach to design an expression cassette containing cardiac specific enhancer, hypoxia response elements (HRE), cardiac specific promoter, internal ribosome entry site (IRES), and beta globin poly A sequence to elicit specific and inducible expression of the gene of interest. Enhanced green fluorescent protein (eGFP) was sub-cloned by BglII and NotI into the cassette. The specificity and inducible expression of the cassette was determined in both mouse myoblast C2C12 and mammary glandular tumor 4T1 as 'twin' cells. eGFP expression was evaluated by immunofluorescence microscope and flow cytometry at 520 nm emission peak.
Results: Our data revealed that the designed expression cassette provided tissue specific and hypoxia inducible (O2<1%) transgene expression.
Conclusion: It is suggested that cardiac-specific enhancer combined with cardiac-specific promoter are efficient for myoblast specific gene expression. As well, this is for the first time that HRE are derived from three well known hypoxia-regulated promoters. Therefore, there is no longer need to overlap PCR process for one repeated sequence just in one promoter.

Entities:  

Keywords:  Cis regulatory elements; Hypoxia; Hypoxia response element

Year:  2018        PMID: 29670836      PMCID: PMC5896393          DOI: 10.15171/apb.2018.004

Source DB:  PubMed          Journal:  Adv Pharm Bull        ISSN: 2228-5881


Introduction

Since identification and description of hypoxia-inducible factor 1 (HIF-1) by Wang et al.,[1] more than 200,000 articles have been published in scientific literatures. HIF-1 is an inducible transcription factor, which binds to hypoxia response elements (HREs) or enhancer elements during hypoxia. HREs are located in the upstream of promoter region. HIF-1 regulates several genes, such as vascular endothelial growth factor (VEGF) and erythropoietin (EPO).[2] hypoxia inducible factor-1 alpha (HlF-1) is comprised of a heterodimer basic helix-loop-helix (bHLH) transcriptional complex and is divided into distinct subsets, including HIF-1α and aryl hydrocarbon receptor nuclear translocator (ARNT), encoding a protein that is referred to beta (β) subunit. HIF-1 belongs to a conserved subfamily of PER-ARNT-SIM (PAS), which functions as oxygen sensors. The PAS domain is a subfamily of bHLH, which is a transcription factor. The HIF family consists of HIF-1α, -1β, -2α, -2β, -3α, -3β.[3,4] In normoxia, HIF-1α is degraded by ubiquitin-mediated proteolysis activity, while being transcribed into mature RNA under hypoxic conditions, leading to an increase in oxygen delivery to the tissues. Therefore, HIF-1α has an essential role both in physiologic and pathologic conditions, including, but not limited to, myocardial ischemia, coronary artery disease, organ rejection and some cancers.[5,6] Among all the above-mentioned circumstances, HIF-1α plays a great role in cardiovascular diseases. Lack of oxygen contributes to augmented hypoxia in coronary and cardiac tissue, subsequently leading to a cardiac stroke. Despite the emergence of novel surgical and medical approaches, cardiac infarction is set to become the leading cause of death up to the year 2020.[7] Several reports have indicated that cardiac function, if not completely, then partially, can be ameliorated following gene or cell therapy in experimental models of infarction.[8,9] However, ectopic gene expression has its disadvantages, such as hemangioma or uncontrolled vascular formation. It is, therefore, essential to regulate gene expression via the modulation of upstream elements of promoters like HREs. It should also be noted that hypoxia may subsequently exist in other tissues as a result of physiologic statement. Hence, tissue specific gene expression is essential to develop suitable vectors for gene therapy. This approach is also considered to be useful for sophisticated studies in the field of biomedical research such as cellular imaging and tracking,[10] genome editing,[11] stem cell engineering,[12] and the study of signaling pathways.[13-15] In this study, we investigated the cardiac specific promoter and cardiac specific enhancer combined with HREs consensus sequence.

Materials and Methods

Expression cassette designing and cloning

In order to construct the expression cassette, all the elements were synthesized by Generay Biotechnology Company (Shanghai, China) and sub-cloned into pGH cloning vector by NdeI and NheI restriction enzymes (Fermentas, Germany) (Figure 1). eGFP was sub-cloned into the cassette by Bglll and Notl (Figure 2). Briefly, 1 µg plasmid DNA was digested by BglII and NotI (Fermentas, Germany) and the relevant buffer was added up to the final volume of 20 µl in 37 °C for 1 h. Enzymatic reaction was inactivated by chloroform and the cloning procedure was confirmed by HindIII digestion.
Figure 1
Figure 2
Schematic view of expression cassette. Expression cassette contains CASQ2 enhancer, HRE, MLC2v promoter, IRES, and β-globin poly A sequence. Schematic view of eGFP cloning into the cassette. eGFP was cloned into the cassette by NotI and BglII restriction enzymes.

Bacterial strains and plasmid preparation

Two strains of Escherichia Coli (E. coli) were used including DH5α and DH10β (Top10, Invitrogen, Thermo Fisher Scientific, USA). The plasmid was transformed into cells using the calcium chloride (CaCl2) method.[16] E. coli bearing the desired plasmid was cultured in lysogeny broth (LB) media for 16 hrs at 37 °C in a shaker incubator. Cells with a density of 3-4×109 cells/ml with OD600=3 were harvested and DNA was extracted by plasmid DNA extraction kit (Qiagen, Midiprep Plasmid DNA Extraction Kit).

Cell Culture

The mouse myoblast cell line C2C12 (CRL-1772) and the mouse mammary gland cell line 4T1 (CRL-2539) was purchased from American Type Culture Collection (ATCC, Rockville, MD, USA). C2C12 cells were cultured in high glucose Dulbecco's Modified Eagle's Medium (DMEM) with 10% fetal bovine serum (FBS, Invitrogen, USA) and 0.584 g/L L-glutamine (Sigma-Aldrich, USA) in 37°C incubator and humidified 5% CO2 and 95% air.[17] 4T1 cells, a 6-thioguanine resistant cell line,[18] were cultured in RPMI-1640 (Sigma-Aldrich, USA) and 10% FBS (Invitrogen Gibco) in 37°C incubator and humidified atmosphere with 5% CO2 and 95% air. Cell lines were passaged after 80% confluence.

The induction of hypoxic condition

To create hypoxia, C2C12 and 4T1 cell lines were incubated for 90 min in a hypoxic condition, containing 94% N2, 4% CO2 and 1% O2, and hanks buffer. As a normoxia control “twin” cells were kept in a normoxic incubator.

Plasmid Transient Transfection

For achieving transient transfection, Gene Pulser XcellTM electroporation system (Bio-Rad, USA) was used. Following 60% confluence, media was removed and cells were harvested using 0.25% Trypsin-EDTA solution. Approximately 4-5 ×106 cells were harvested by adding 3 ml complete media and then centrifuged for 5 min at 1000g and 4°C.[19] Thereafter, cells were re-suspended in 400µl opti-MEM (buffer O).[20] Then, 10µg of supercoiled DNA was overlaid to the cell suspension and mixed in wells. The cuvette was placed on ice for 5 min. Then, cells were transfected with the optimized exponential protocol (one shock for 18 seconds, at a voltage 120).

Fluorescence microscopy

Slides were visualized with a Zeiss Axioplan using 485 band pass filters set to view eGFP. All images were analyzed with AxioCam digital camera and Zeiss proprietary software (Axiovision Ver. 3.0.6.0). Images were manipulated in Adobe Photoshop 5.5.

Flow cytometry

eGFP expression was detected 48 hrs after transfection. Myocyte cells were harvested by trypsin/EDTA. Cells were centrifuged at 1000g for 10 min at 4°C. The cells were then washed three times with 500 µl of PBS. Fluorescence-activated cell sorting (FACS) caliber-micro flow cytometer (Becton Dickinson, NJ, USA) was used to analyze eGFP expression. GFP was excited by an argon laser and fluorescence’s at 485/520 nm band pass filter in the FL1 channel. All raw data were analyzed using FlowJo software version 7.6.1.

Western Blotting

Cells in the both hypoxia and normoxia groups were collected from the wells and their protein contents were detected using an extraction Kit (Santa Cruz, USA) following the manufacturer’s protocol. Total protein concentration was measured using a Nanodrop (Thermo-Scientific, USA). Samples were prepared for western blotting by adding loading buffer to each sample. Proteins were electrophoresed on 12% SDS-polyacrylamide gel and transferred to PVDF membranes. The membranes were blocked by incubating with 0.3 g bovine serum albumin in 10 ml of washing buffer at 4ºC overnight. Membranes were then washed three times with PBS for 10 min. Then, the membranes were incubated with anti-HIF-1α antibody (dilution: 1:500; Santa-Cruz) for 4 hrs at 4ºC. The membranes were then washed three times for 10 min each and incubated with the secondary antibody for 2 hrs. Roche ECL kit and semi-dry X-ray were used for imaging of immunoreactive protein bands.

Results

eGFP Cloning confirmation with HindIII digestion

To confirm eGFP cloning, the expression cassette was digested by HindIII and positive colony was determined by three sharp plasmid DNA band, including 3000, 2000 and 1500 bps on gel electrophoresis. Meanwhile, empty expression cassette was digested into two bands on 2500 and 1500 bps (Figure 3A and B).
Figure 3
A; Confirmation of eGFP cloning into the cassette. Expression cassette was linearized by HindIII two sharp plasmid DNA band on 2500 and 1500 bps (Ladder 4000bps). B; Confirmation of eGFP cloning into the cassette by HindIII digestion three sharp plasmid DNA band on 3000, 2000 and 1500bps (Ladder 3000bps).

Exploration of the CASQ2 enhancer and cardiac tissue specific promoter

Calsequestrin 2 (CASQ2) as a cardiac specific enhancer plus myosin light chain-2 (MLC2v) cardiac specific promoter provided tissue specificity. Thanks to highly cardiac specific sequence expression, eGFP was detected in myoblast C2C12 cell line, but not in 4T1 ‘twin’ cell.

Exploring of HRE

In this study, 35 putative sites, including 9 ARNT, HIF-1, and 26 sp1 from EPO, VEGF-A, and phosphoglycerate kinase 1 (PGK-1) promoters were driven (Figure 4A and B, Table 1). HRE sequence was analyzed for insulator boundary elements to prevent enhancer and promoter interaction (Table 2). The elements provided hypoxia inducible expression. eGFP was detected under hypoxia and was not expressed under normoxia condition.
Figure 4
Table 1

35 Putative sites that is existing on Hypoxia Responses Elements (HRE) including 9 ARNT and 26 sp1.

The JASPAR database
35 putative sites were predicted with these settings (80%) in sequence named 1
Model ID Model name Score Relative score Start End Strand predicted site sequence
MA0079.2SP16.7360.80093663016568727361CCCCGGCGAC
MA0079.3SP11.6680.80212603084275538481CTTCCTGCTCC
MA0079.3SP114.5580.96429698782385944541GCTCCGCCCCT
MA0079.2SP19.5010.87057132760564945541CTCCGCCCCT
MA0079.1SP16.1220.8004080142377654655­1TAGGGGCGGA
MA0259.1ARNT::HIF1A8.7880.92807289403086781881CGGCGTGC
MA0259.1ARNT::HIF1A9.8170.95877047936735190971GGACGTGA
MA0259.1ARNT::HIF1A10.3960.976043464702457110117­1AGACGTGC
MA0259.1ARNT::HIF1A9.0250.9351431833649261451521ATACGTGG
MA0259.1ARNT::HIF1A10.3210.9738060313688941741811CTACGTGC
MA0079.1SP17.4760.847637728498468188197­1CAGGCTGTGT
MA0079.2SP16.7360.8009366301656872122211CCCCGGCGAC
MA0079.3SP11.6680.8021260308427552232331CTTCCTGCTCC
MA0079.3SP114.5580.9642969878238592292391GCTCCGCCCCT
MA0079.2SP19.5010.8705713276056492302391CTCCGCCCCT
MA0079.1SP16.1220.800408014237765231240­1TAGGGGCGGA
MA0259.1ARNT::HIF1A6.3910.8565645246901942662731GAGCGTGT
MA0259.1ARNT::HIF1A4.9360.813158318019073281288­1CTACGGGC
MA0259.1ARNT::HIF1A8.8540.930041835364402306313­1AAACGTGC
MA0259.1ARNT::HIF1A8.5750.9217185833635483163231CCGCGTGC
MA0079.1SP16.7650.8228368962685133443531CAGGGGCGGT
MA0079.2SP17.6110.822972926823903345354­1CACCGCCCCT
MA0079.3SP110.5600.913997570755554345355­1GCACCGCCCCT
MA0079.1SP17.2890.8411148654506463463551GGGGCGGTGC
MA0079.3SP13.1630.820934842377801350360­1CTCCCGCACCG
MA0079.2SP113.2140.964080778453597357366­1CCCCGCCTCC
MA0079.3SP113.4200.949979644996513357367­1ACCCCGCCTCC
MA0079.1SP111.0460.9721651139568933583671GAGGCGGGGT
MA0079.3SP13.1290.820507083453258362372­1CCCACACCCCG
MA0079.2SP18.6850.850020906950673364373­1CCCCACACCC
MA0079.3SP17.0960.870416485031539364374­1GCCCCACACCC
MA0079.2SP17.2020.812672532157377368377­1CCCGCCCCAC
MA0079.2SP18.7570.851834179361406369378­1TCCCGCCCCA
MA0079.3SP110.5090.913355932368739369379­1ATCCCGCCCCA
MA0079.1SP19.8700.9311443281588243703791GGGGCGGGAT
Table 2

Insulator sequences have been located on HRE sequence.

Motif PWM Motif Sequence Input Sequence Name Motif Start Location Motif Length Motif Orientation Score
REN_20CCTACGGGCACAGGGGACAC18720+-12.4488
MIT_LM2GCGTCGCCGGGGGGCCCAC115319+-13.4637
MIT_LM2GCGTCGCCGGGGGGCCCAC133819+-13.4637
MIT_LM7GAGACAGCACGTAGGGCAAG118920+-7.41144
MIT_LM23GAGACAGCACGTAGGGCAAG118920+-5.62159

Hypoxia induction in C2C12 and 4T1 cell lines

HIF-1α at transcriptional and translational levels was stabilized under hypoxic condition. Then, we detected HIF-1α protein in hypoxic condition. Notably, we could not detect any HIF-1α protein in normoxia (Figure 5C).
Figure 5
A; ARNT consensus sequence has been repeated 9 times in HRE. B; sp1 consensus sequence has been repeated 26 times in HRE A; The results of immunofluorescence microscopy 48 hrs post transfection presented the specific expression of eGFP in the hypoxic condition at C2C12 myoblast cell line. eGFP was not detected in 4T1 cells in both hypoxic and normoxic condition. B; Flow cytometry results indicate the expression of eGFP under hypoxic condition in C2C12 cell line. C; Confirmation of hypoxia induction in both C2C12 and 4T1 cell lines by western blotting.

Expression cassette optimization

After subsequent transfection (48 h and 72 h), HREs exhibited the most intense fluorescence 48 hrs after transient transfection only in the hypoxic condition. Both cell lines were incubated under normoxic and hypoxic conditions to determine the function of HREs, including HIF-1α and sp1 transcription factor binding site. The expression vector generated a sharp eGFP expression, which was detected by immunofluorescence microscope 48 hrs after transfection in the C2C12 cell line under hypoxic conditions. On the other hand, No significant eGFP was detected in 4T1 cells. eGFP was expressed in C2C12 cell line but not 4T1 under hypoxic (O2<1%) condition. Moreover, we cannot detect any significant eGFP signals in C2C12 under normoxia. Flow cytometry results showed that myoblast cells expressed eGFP in hypoxia. However, eGFP was not express in 4T1 cells in both hypoxia and normoxia. Overall, experiments demonstrated that our designed cassette was expressed and, hence, functioned appropriately (Figure 5A and B).

eGFP measured 72h after transient transfection

After confirmation of hypoxia inducible and tissue specific expressions in expression cassette, the green fluorescence signals were analyzed 72 h and 96 h after transient transfection. eGFP signals were detected after 72h of transient transfection by the immune fluorescence microscopy at 520 band pass filter. However, we could not detect eGFP signals after 96 h after transfection (Figure 6).
Figure 6
eGFP measurement 72 h after transfection. Arrow indicated the eGFP expression in C2C12.

Discussion

The results obtained through the experiments support some of our hypotheses. The current study explored the application of bioinformatics to improve the efficiency of cardiac gene therapy. Based on in silico analysis, we chose a cardiac specific cis-regulatory conserved motif that belonged to calsequestrin 2 (CASQ2) gene. The corresponding gene is specifically expressed in the heart. Tissue-specific cis-regulatory elements and correlated transcription factors, including myogenic regulatory factors (MRFs) like myogenic differentiation 1 (MYOD1), myogenic factor 5 (MYF5), myogenin and myogenin regulator factor 4 (MRF4), myogenic factor 6 (MYF6) interact with other transcription factors, particularly T box protein 2 (TBX2) and NK2 homeobox 5 (Nkx2.5).,[21-24] which play a pivotal role in the correct differentiation and progressive formation of cardiac muscle (Table 3). This summary helps us to understand the role of specific cis-regulatory elements in designing tissue-specific expression cassettes. Both CASQ2 and MLC2v have a specific transcription factor binding site (TFBSs), which is efficient for cardiac-specific transgene expression.
Table 3

Cardiac specific transcription binding sites located on the CASQ2 enhancer.

Model ID Model name Score Relative score Start End Strand Predicted site sequence
MA0037.2GATA33.2790.8205940502455567141AGAAAAAC
MA0052.2MEF2A5.4980.80187277339761251651TACCTTACATAGCTC
MA0052.2MEF2A8.6180.84387374331526490104-1TCCTAAAAATGGAGT
MA0083.2SRF8.2300.81781313398238390107-1GCATCCTAAAAATGGAGT
MA0499.1Myod15.4030.8596689689022111051171TGCAGTTGTTTCA
MA0052.2MEF2A17.0950.9579898401075491181321GGCTAAAAATAAATC
MA0063.1Nkx2-55.1890.833795488710155136142-1TTCATTG
MA0035.3Gata12.4020.800738582375976151161-1GTCGTATCTAA
MA0037.2GATA36.5880.8726599310824881531601AGATACGA
MA0482.1Gata42.1240.802327146192479176186-1CTGTATCAGCG
MA0499.1Myod10.8380.800984257597511191203-1TTCACCAGTCGGA
MA0482.1Gata42.1140.802183373083414202212-1TCTTCCCTCTT
MA0482.1Gata46.7270.868505908295031223233-1TCTTGTCTTTT
MA0036.2GATA27.2060.849841616420247224237-1ACATTCTTGTCTTT
MA0035.3Gata16.5250.857230665045272224234-1TTCTTGTCTTT
MA0037.2GATA36.5880.8726599310824882262331
MA0482.1Gata46.7760.869210396529448244254-1CCTTATTTCAT
MA0036.2GATA25.0690.820706175169384245258-1GCCTCCTTATTTCA
MA0035.3Gata15.0990.837692049986718245255-1TCCTTATTTCA
MA0037.2GATA35.2810.8520947735563872472541AAATAAGG
MA0482.1Gata45.4840.850634910838269271281-1CTTTCTCTTCT
MA0035.3Gata12.8020.806219259811756272282-1TCTTTCTCTTC
MA0037.2GATA33.9210.8306956807977812742811AGAGAAAG
Rincon et al.,[25] previously showed that CASQ2 had a strong specificity for cardiac muscle. They made a construct consisting of CASQ2 and myosin heavy chain α (MHCα) as a cardiac specific promoter. In this study, we used MLC2v because of its cardiac-specific regulatory elements (Table 4). For inducible expression under hypoxic conditions, we used HREs derived from phosphoglycerate kinase (PGK1), VEGF-165, and EPO promoter. However, it was shown that HRE was a conserved sequence itself, but the most noted HRE sequence was derived from the EPO promoter.[26] To make copies of inducible elements obtained from one promoter, overlap PCR must be performed. For easier construct production of the desired elements, we used promoter and 5ʹUTRs of three different genes.[27,28]
Table 4

Specific transcription factor and their binding sites are Myosin Light Chain 2 (MLC2).

Entrez_ID Symbol Alias GO_P GO_C
4250SCGB2A2MGB1 UGB2nana
94234FOXQ1HFH1transcription; regulation of transcription, DNA dependent;hair follicle morphogenesisnucleus
6927TCF1HNF1 HNF1ALFB1 MODY3Bone resorption; positive regulation of transcription from RNA polymerase II promoternucleus;transcriptionfactor complex
6722SRFMCM1Heart looping; transcription; signal transduction; multicellular organismal development; Heart development; positive regulation of transcription from RNA polymerase II promoter; muscle maintenancenucleus
3170FOXA2HNF3BMGC19807TCF3Btranscription; regulation of transcription, DNA dependent;lung development; epithelial cell differentiation; positive regulation of transcription from RNA polymerase II promoter; branching morphogenesis of a tubenucleus
3169FOXA1HNF3AMGC33105TCF3Atranscription; regulation of transcription, DNA dependent;lung development; epithelial cell differentiation; hormone metabolic process; glucose homeostasis; positive regulation of transcription from RNA polymerase II promoter; branching morphogenesis of a tubenucleus
4763NF1DKFZp686J1293NFNS VRNFWSScell cycle; Ras protein signal transduction; negative regulation of cell proliferation; regulation of glial cell differentiation; negative regulation of progression through cell cycle; regulation of small GTPase mediated signaltransductionintracellular;cytoplasm
HIF-1α belongs to a family of transcription factor with dimeric helices, containing basic amino acid residues that simplify DNA binding. bHLH proteins usually bind to a consensus sequence, well-known as HREs. Additionally, Sp1 is a zinc finger transcription factor that binds to GC-rich motifs of some promoters.[29,30] Sp1 binding sites are located near the HRE regions on the promoter. More studies have shown that sp1 protein becomes overexpressed under hypoxic conditions.[31] on the other side, hypoxic conditions have dual translation models known as cap-dependent and cap-independent (IRES) mechanisms. Notably, hypoxia has a strong restrictive effect on cap-dependent mRNA translation.[32] However, cellular IRES has a significant role in adaptation to hypoxic stress but is not increased at translational level, possibly due to inhibition of protein synthesis in order to conserve energy. IRESs are natural translational enhancers and, hence, mediate internal initiation of translation when present between desired genes. In clinical assays, bicistronic IRES-based expression vectors have fewer side effects than monocistronic based expression vectors. When we designed a vector for hypoxia-inducible expression, strong viral IRESs were used for efficient cap-independent gene expression. Fundamentally, the IRES-based expression vector is efficient for in vitro and in vivo gene expression under hypoxic conditions.[33] Encephalomyocarditis virus (EMCV) is on-route into clinical studies and will hopefully be beneficial for patients. Our research, however, focused on in vitro studies. It is essential to study this cassette in vivo to evaluate all hypoxia-specific elements, such as enhancers (sp1, ARNT, and IRES) in a heterogenic population of myoblast and adult myocytes. However, we demonstrated that these elements were efficient for gene expression on hypoxic myoblasts in an in vitro model.

Conclusion

In conclusion, combination of the cardiac/muscle specific cis-regulatory elements, CASQ2, and myosin light chain-2 (MLC2v) have a significant specificity for myocytes. Both CASQ2 and MLC2v have a specific TFBS, which is efficient for cardiac-specific transgene expression. Sp1 binding sites are located near the HRE regions on the promoter. Therefore, Sp1 and HIF-1α have binding sites to a far distance of HREs derived from three promoters. Therefore, there is no longer need to overlap PCR process for one repeated sequence just in one promoter. This expression cassette well-designed for cardiac specific hypoxia inducible gene expression.

Acknowledgments

This work was a part of Ph.D. thesis and supported by the Research Council, Tabriz University of Medical Sciences. The authors thank the personnel of Immunology Research Center, Department of Pharmaceutical biotechnology for their kind guidance.

Ethical Issues

Not applicable.

Conflict of Interest

The authors declare “no” conflict of interest.

Abbreviations

HREs: hypoxia response elements, HIF-1α: hypoxia inducible factor-1 alpha, VEGF-A: vascular endothelial growth factor-A, PGK-1: phosphoglycerate kinase 1, MLC2v: myosin light chain, EPO: erythropoietin, ARNT: aryl hydrocarbon receptor nuclear translocator, eGFP: enhanced green fluorescent protein, CASQ2: calsequestrin 2, bHLH: basic helix-loop-helix , PAS: PER-ARNT-SIM, EMCV: encephalomyocarditis virus, UTR: untranslated region, IRES: internal ribosome entry site, MRFs: myogenic regulatory factors, MYOD1: myogenic differentiation 1, MYF5: myogenic factor 5, MYF6: myogenic factor 6, MHC-α: myosin heavy chain- alpha, TBX2: T box protein 2, NKX2-5: NK2 homeobox 5.
  31 in total

Review 1.  Sp1 phosphorylation and its regulation of gene transcription.

Authors:  Nicole Y Tan; Levon M Khachigian
Journal:  Mol Cell Biol       Date:  2009-03-09       Impact factor: 4.272

2.  Lentiviral vector design and imaging approaches to visualize the early stages of cellular reprogramming.

Authors:  Eva Warlich; Johannes Kuehle; Tobias Cantz; Martijn H Brugman; Tobias Maetzig; Melanie Galla; Adam A Filipczyk; Stephan Halle; Hannes Klump; Hans R Schöler; Christopher Baum; Timm Schroeder; Axel Schambach
Journal:  Mol Ther       Date:  2011-02-01       Impact factor: 11.454

Review 3.  RNA interference and its role in cancer therapy.

Authors:  Behzad Mansoori; Siamak Sandoghchian Shotorbani; Behzad Baradaran
Journal:  Adv Pharm Bull       Date:  2014-08-10

4.  Segregation of cardiac and skeletal muscle-specific regulatory elements of the beta-myosin heavy chain gene.

Authors:  H Rindt; S Knotts; J Robbins
Journal:  Proc Natl Acad Sci U S A       Date:  1995-02-28       Impact factor: 11.205

5.  Genome engineering using the CRISPR-Cas9 system.

Authors:  F Ann Ran; Patrick D Hsu; Jason Wright; Vineeta Agarwala; David A Scott; Feng Zhang
Journal:  Nat Protoc       Date:  2013-10-24       Impact factor: 13.491

Review 6.  Structural and functional analysis of hypoxia-inducible factor 1.

Authors:  G L Semenza; F Agani; G Booth; J Forsythe; N Iyer; B H Jiang; S Leung; R Roe; C Wiener; A Yu
Journal:  Kidney Int       Date:  1997-02       Impact factor: 10.612

7.  Cooperative action of Tbx2 and Nkx2.5 inhibits ANF expression in the atrioventricular canal: implications for cardiac chamber formation.

Authors:  Petra E M H Habets; Antoon F M Moorman; Danielle E W Clout; Marian A van Roon; Merel Lingbeek; Maarten van Lohuizen; Marina Campione; Vincent M Christoffels
Journal:  Genes Dev       Date:  2002-05-15       Impact factor: 11.361

Review 8.  Oxygen sensing, hypoxia-inducible factors, and disease pathophysiology.

Authors:  Gregg L Semenza
Journal:  Annu Rev Pathol       Date:  2013-08-07       Impact factor: 23.472

9.  Global, regional, and national age-sex specific all-cause and cause-specific mortality for 240 causes of death, 1990-2013: a systematic analysis for the Global Burden of Disease Study 2013.

Authors: 
Journal:  Lancet       Date:  2014-12-18       Impact factor: 79.321

10.  Genetic engineering of human pluripotent cells using TALE nucleases.

Authors:  Dirk Hockemeyer; Haoyi Wang; Samira Kiani; Christine S Lai; Qing Gao; John P Cassady; Gregory J Cost; Lei Zhang; Yolanda Santiago; Jeffrey C Miller; Bryan Zeitler; Jennifer M Cherone; Xiangdong Meng; Sarah J Hinkley; Edward J Rebar; Philip D Gregory; Fyodor D Urnov; Rudolf Jaenisch
Journal:  Nat Biotechnol       Date:  2011-07-07       Impact factor: 54.908

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.