Hua Tao1,2, Yuan-Yuan Chen1,3, Zong-Wen Sun1, Hua-Lin Chen1, Ming Chen1,3. 1. Department of Oncology, The Second Affiliated Hospital of Soochow University, Suzhou, Jiangsu, P.R. China. 2. Department of Radiotherapy, Jiangsu Cancer Hospital, Jiangsu Institute of Cancer Research, Nanjing Medical University Affiliated Cancer Hospital, Nanjing, Jiangsu, P.R. China. 3. Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou, Zhejiang, P.R. China.
Abstract
Esophageal carcinoma is aggressive in nature and its prognosis is largely dependent on the degree of invasion. Histone deacetylase 6 (HDAC6), as the most unique member of HDACs family, has the positive activity to promote initiation and progression of various cancers via targeting multiple non-histone proteins in cytoplasm. In this study, we found that HDAC6 was over-expressed in three esophageal cancer cell lines (KYSE140, KYSE170, KYSE180) when compared to non-carcinoma esophageal epithelial cell HEEC-1. Then two HDAC6 specific siRNAs and HDAC6 inhibitor tubastatin A greatly suppressed KYSE140 and KYSE180 cells proliferation and migration, and the inhibition of cell motility was accompanied by elevated acetylation of α-tubulin, a target of HDAC6. Consistently, the microtubulin skeleton was stabilized after HDAC6 knockdown or inhibition. In addition, acetylation status of HSP90, another HDAC6 target, was also increased towards HDAC6 knockdown or inhibition by co-immunoprecipitation assay. Besides, co-treatment of HSP90 inhibitor (PU-H71) and HDAC6 inhibitor (tubastatin A) induced a stronger cell migration inhibition compared to administration of either drug alone. Furthermore, cell proliferation of KYSE140 and KYSE180 were also compromised in response to combination of HDAC6 and HSP90 inhibitors. Additionally, co-administration of HSP90 inhibitor and HDAC6 inhibitor strongly inhibited tumor growth in vivo. Taken together, our results indicated that HDAC6 is a promising target by inhibiting HSP90 function in ESCC.
Esophageal carcinoma is aggressive in nature and its prognosis is largely dependent on the degree of invasion. Histone deacetylase 6 (HDAC6), as the most unique member of HDACs family, has the positive activity to promote initiation and progression of various cancers via targeting multiple non-histone proteins in cytoplasm. In this study, we found that HDAC6 was over-expressed in three esophageal cancer cell lines (KYSE140, KYSE170, KYSE180) when compared to non-carcinoma esophageal epithelial cell HEEC-1. Then two HDAC6 specific siRNAs and HDAC6 inhibitor tubastatin A greatly suppressed KYSE140 and KYSE180 cells proliferation and migration, and the inhibition of cell motility was accompanied by elevated acetylation of α-tubulin, a target of HDAC6. Consistently, the microtubulin skeleton was stabilized after HDAC6 knockdown or inhibition. In addition, acetylation status of HSP90, another HDAC6 target, was also increased towards HDAC6 knockdown or inhibition by co-immunoprecipitation assay. Besides, co-treatment of HSP90 inhibitor (PU-H71) and HDAC6 inhibitor (tubastatin A) induced a stronger cell migration inhibition compared to administration of either drug alone. Furthermore, cell proliferation of KYSE140 and KYSE180 were also compromised in response to combination of HDAC6 and HSP90 inhibitors. Additionally, co-administration of HSP90 inhibitor and HDAC6 inhibitor strongly inhibited tumor growth in vivo. Taken together, our results indicated that HDAC6 is a promising target by inhibiting HSP90 function in ESCC.
Esophageal carcinoma is one of the most common cancer types worldwide.1 It can be categorized into two main types, including adenocarcinoma and squamous cell carcinoma due to different etiology and epidemiology. In all esophageal cancer cases, esophageal squamous cell carcinoma (ESCC) accounts for more than 90% cases.2 Although clinical therapy has greatly provided benefit to esophageal carcinomapatients such as chemotherapy, surgery, the outcome is still unsatisfactory. The poor prognosis of ESCC is largely due to invasion and metastases of ESCC to adjacent tissue and distant organs.3 Therefore, understanding the molecular mechanism behind its strong invasion and metastasis ability is necessary to develop effective therapeutic approach and improve clinical outcome for ESCC patients.HDAC6 is a member of HDACs with different molecular features and functions from other family members. Unlike nuclear location of other HDAC family members, HDAC6 is a unique deacetylase for its cytoplasm localization and ability to deacetylate proteins other than histone.4 Overexpression of HDAC6 was reported to be associated with cancer cell migration and invasion through deacetylating its substrate in several cancer types. In bladder cancer cells, HDAC6 promoted cell metastasis by targeting cortactin.5 In breast cancer cell line MCF7, HDAC6 could deacetylate α‐tubulin to drive cell migration.6 However, the role of HDAC6 in ESCC remains largely unknown.HSP90 serves as a molecular chaperone that is crucial for the stability and function of numerous proteins to maintain cellular protein homeostasis and cell survival.7 Likewise, during oncogenesis, HSP90 is crucial for the stability and function of multiple oncogenic proteins that are indispensable for tumor development.8 In esophageal carcinoma, overexpression of HSP90 was observed in ESCC epithelium compared to normal epithelium, and inhibition of HSP90 by its inhibitor 17‐AAG could decrease proliferation of esophageal cancer cell in vitro.9 HSP90 is a substrate of HDAC6, inactivation or knockdown of HDAC6 leads to HSP90 hyper‐acetylation and loss of HSP90 chaperone activity.10 In humanleukemia cells, combination inhibition of HDAC6 and HSP90 show synergistic effect in anticancer activity.11 Thus, drugging HSP90‐HDAC6 may be a promising strategy in esophageal cancer.In this study, we found that HDAC6 was highly expressed in ESCC cells compared to non‐carcinoma esophageal epithelial cell HEEC. Inhibition or knockdown of HDAC6 could greatly inhibited cell proliferation and cell motility in ESCC cell KYSE140 and KYSE180, which may be correlated to an increase of acetylation of α‐tubulin. In addition, acetylation level of HSP90 was also increased in response to HDAC6 inhibition, which may indicated that inhibition of HDAC6 could suppress ESCC proliferation and migration by disrupting chaperone function of HSP90. Further, ESCC cells treated with HDAC6 inhibitor, HSP90 inhibitor triggered a significant decrease of cell proliferation and migration. Importantly, co‐administration of HDAC6 inhibitor and HSP90 inhibitor dramatically inhibited tumor growth in vivo. Taken together, these data indicated that a role of HDAC6 in ESCC proliferation and migration by disrupting HSP90 and providing new strategy for ESCC treatment.
MATERIALS AND METHODS
Cell culture and reagent
ESCC cell lines (KYSE140, KYSE170, KYSE180) were purchased from DSMZ, the German Resource Center for Biological Material. Non‐carcinoma esophageal epithelial cell line (HEEC) was obtained from ScienCell Research Laboratories (Invitrogen, Carlsbad, CA). HEEC was maintained in keratinocyte serum‐free medium (Invitrogen) containing 2.5 µg of epidermal growth factor (Sigma‐Aldrich, St. Louis, MO) and 25 µg of bovine pituitary extract (Invitrogen). ESCC cell lines were cultured in RPMI‐1640 (Wisent) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT). All cells were maintained at 37°C in a humidified atmosphere of 5% CO2. PU‐H71 (HSP90 inhibitor) and Tubastatin A (HDAC6 inhibitor) were bought from Selleck Chemical.
Gene silencing with siRNAs
Cells were transfected with non‐targeting negative control siRNA (Dharmacon, Lafayette, CO) or HDAC6 siRNA1 or HDAC6 siRNA2 (Dharmacon) using LipoRNAiMax according to manufacture's protocol. The cells were maintained for 72 h and then sujected to protein extraction.
Quantitative real time (qRT)‐PCR
For qRT‐PCR, total RNA of cell samples were prepared using RNeasy kit (Qiagen, Hilden, Germany) according to manufacture's protocol. Reverse transcription of RNA was done with PrimeScript RT reagent kit (TaKaRa, Otsu, Shiga). The qRT‐PCR was performed on a Bio‐Rad CFX96 Real‐Time PCR System (Bio‐rad, Hercules, CA) and normalized to internal control GAPDH. The primer sequences were as follow: GAPDH Forward: AATCCCATCACCATCTTCCA, GAPDH Reverse: TGGACTCCACGACGTACTCA, HDAC6 Forward: TGGCAT CCCAGAACTGATGA, HDAC6 Reverse: CAATGGTGTTCTACCGGGCT.
Western blot
Acetylated‐α‐tubulin, α‐tubulin and GAPDH antibodies were purchased from Sigma‐Aldrich. Anti‐HDAC6, anti‐acetylated‐Lysine and anti‐HSP90 antibody were bought from Cell Signaling Technology (Beverly, MA). Anti‐mouse and anti‐rabbit secondary antibodies were obtained from Proteintech (Chicago, IL). Protein lysates were prepared using RIPA lysis buffer. Lysates were then subjected to SDS‐polyacrylamide gel electrophoresis and transferred to PVDF membranes. After blocking with non‐fat milk, blots were incubated overnight at 4°C with indicated antibodies. On the next day, membranes were washed and incubated 1 h at room temperature with corresponding secondary antibody. For protein detection, membranes were developed with SuperSignal West Femto Maximum Sensitivity Substrate (Pierce, Rockford, IL) and the Gel‐Pro Analyzer 6.0 software was applied for image analysis.
Immunofluorescence
For immunofluorescence, cells were plated on glass slides in 24‐well plate. On the next day, 1 µM PU‐H71 or vehicle was added to cultured cells for 24 h. After that, cells were incubated on ice for 20 min to induce microtubule depolymerization and then fixed with 4% PFA, and then incubated with 0.5% triton X‐100 for 10 min. The coverslips were blocked with 2% (w/v) BSA/PBS for 30 min and then incubated with α‐tubulin antibody for 2 h. After washing with PBS for three times, the cells were incubated with Alexa Fluor 488goat‐anti‐rabbit antibody for additional 2 h. The coverslips were mounted using the mounting media (Vector Laboratories, Cambridgeshire, UK) on glass slides. Cells were examined using Nikon Eclipse TE2000‐U fluorescence microscope.
Cell proliferation assay
The cell proliferation of indicated cells was realized using CCK‐8 kit (Dojindo Laboratories, Kumamoto, Japan). Briefly, cells were plated to 96‐well plate, on the next day, vehicle or indicated concentration of drug was added into wells. Every 24 h, 10 µL CCK‐8 solution was added into each well in 96‐well plate and sustained for 2 h, the absorbance at 450 nm was measured to reflect cell number.
Cell migration assay
Transwell assay (Transwell®, Corning Life Sciences, membrane pore size: 3.0 µm) was adopted to determine cell migration. Cells (2.5 × 105 cells/mL) were suspended in serum‐free RPMI‐1640. The suspension was seeded in the upper chamber, while the bottom wells were added with 2 mL RPMI‐1640, 10% (v/v) FBS, penicillin (100 mg/mL), and streptomycin (10 mg/mL). Wells were incubated at 37°C. After the removement of medium, cells were fixed by formaldheyde for 2 min at room temperature; permeabilized with polyoxymethylene for 20 min at room temperature; stained with crystal violet for 15 min at room temperature; at last, washed with PBS. Non‐migrated cells were removed by cotton swabs, while migrated cells were counted via a phase contrast microscope (Motic AE21, Seneco Srl, Italy). Membranes were photographed, images were captured by Visicam 3.0 and analyzed by VisiCam Image Analyzer, version 6.1.3.3 (VWR International Srl, Milano, Italy).
Co‐immunoprecipitation assay
For co‐immunoprecipitation assay, cells were lysed in lysis buffer. After centrifugation, cell extracts were incubated overnight with primary antibodies conjugated to protein G agarose beads. After stringent washing, proteins associated with the beads were eluted and resolved on SDS‐PAGE, which was followed by Western blotting.
In vivo tumorigenesis in nude mice
Mice were obtained from Shang hai Jiesijie Laboratory Animal Center (Shanghai, China). Animal experiment was approved by the Animal Experiments Committee of Soochow University. 2 × 106 KYSE140 cells were injected into inguinal folds of mice. After two weeks of tumor growth, animals were treated with PU‐H71 (75 mg/kg/dose three times a week, i.p.) or Tubastatin A (50 mg/kg/dose three times a week, i.p.) or combination of PU‐H71 and Tubastatin A or vehicle. The mice were examed daily and tumors were measured with a caliper. After 21 days, mice were sacrificed and their tumors were removed for analysis.
Immunohistochemistry (IHC)
Tumor were freshly isolated and fixed in 10% neutral buffered formalin and then embedded in paraffin wax. Tumor sections with a thickness of 4 μm were mounted onto slides. Slides were deparaffinized with xylene, rehydrated with ethanol, and incubated with H2O2 at 37°C for 10 min. Following blocking using 1.5% normal goat serum at 37°C for 20 min, sections were incubated overnight with antibody (1:1000 dilutions). The sections were incubated with biotin‐conjugated goat‐anti‐rabbit immunoglobulin G secondary antibody (diluted with 3% bovine serum albumin/PBS) at 37°C for 30 min, and then incubated with horseradish peroxidase‐conjugated streptavidin at 37°C for 30 min. 3, 3′‐diaminobenzidine (DAB) was used as chromogenic agent. Images were obtained using a fluorescence microscope (FSX100; Olympus, Southend‐on‐Sea, UK).
Statistical analysis
Graphpad Prism 5.0 software (GraphPad Software Inc., San Diego, CA) was used to analyze all data for data significance. The data were represented as means ± SD (N = 3). The differences between two groups were statistically analyzed using student's t‐test. One‐way analysis of variance was applied to compare difference between multiple groups. A P‐value <0.05 was considered as statistically significant.
RESULTS
HDAC6 is overexpressed in ESCC cell lines
To evaluate HDAC6 as a potential target for therapy in ESCC, protein expression of HDAC6 in human ESCC cell lines were explored. The result indicated that expression of HDAC6 dramatically up‐regulated in three ESCC cell lines (KYSE140, KYSE170, and KYSE180) compared to human esophageal epithelial cell line (HEEC‐1), especially for KYSE140 and KYSE180 cells (Figure 1). Further, we selected KYSE140 and KYSE180 cells to investigate the role of HDAC6 in ESCC.
Figure 1
HDAC6 is overexpressed in ESCC cell lines. A strong expression of HDAC6 in all three ESCC cell lines was discovered
HDAC6 is overexpressed in ESCC cell lines. A strong expression of HDAC6 in all three ESCC cell lines was discovered
HDAC6 contributes to ESCC cell proliferation and motility
The high expression of HDAC6 suggested it might be a driver for ESCC cells, so we next investigated the role of HDAC6 in cell proliferation by performing specific inhibition using siRNAs. In both KYSE140 and KYSE180 cells, siRNA transfection successfully inhibited HDAC6 expression (Figures 2A and 2B) by qRT‐PCR and Western bolt analysis, and HDAC6 silencing dramatically inhibited cell proliferation (Figure 2C). Considering HDAC6 was reported to control cell motility, we analyzed cell migration ability. Indeed, HDAC6 silencing greatly reduced cell number invaded through matrigel indicating its role in regulating cell motility capacity (Figure 2D). For further confirmation, Tubastatin A, a kind of HDAC6 specific inhibitor, was applied. Consistently, Tubastatin A administration had positive inhibitory activity on cell proliferation in both KYSE140 and KYSE180 cells (Figure 2E), and evoked a sharp decrease of cell migration in a dose‐dependent manner (Figure 2F).
Figure 2
HDAC6 contributes to ESCC cell proliferation and motility. In KYSE140 and KYSE180, result of RT‐qPCR (A) and Western blot (B) showed that, siRNA transfection successfully knockdown HDAC6 expression. C, HDAC6 silencing slightly reduced cell proliferation in KYSE140 and KYSE180. D, HDAC6 siRNAs inhibited cell migration. E, Tubastatin A slightly reduced cell viability in KYSE140 and KYSE180. F, Tubastatin A evoked a sharp decrease of cell migration in a dose‐dependent manner. (*P < 0.05 vs the control group)
HDAC6 contributes to ESCC cell proliferation and motility. In KYSE140 and KYSE180, result of RT‐qPCR (A) and Western blot (B) showed that, siRNA transfection successfully knockdown HDAC6 expression. C, HDAC6 silencing slightly reduced cell proliferation in KYSE140 and KYSE180. D, HDAC6 siRNAs inhibited cell migration. E, Tubastatin A slightly reduced cell viability in KYSE140 and KYSE180. F, Tubastatin A evoked a sharp decrease of cell migration in a dose‐dependent manner. (*P < 0.05 vs the control group)
α‐tubulin is essential for HDAC6 regulated ESCC cell motility
α‐tubulin is one target of HDAC6 and has been reported to be related to cell motility. In KYSE140 and KYSE180 cells, Tubastatin A, and HDAC6 siRNAs triggered an increase of acetylation of α‐tubulin in a dose dependent manner (Figures 3A and 3B). Acetylation of α‐tubulin altered cytoskeleton dynamics and thus changed cell behavior. After cold‐induced microtubule disrupting, the microtubule was disassembled and can hardly be observed in KYSE140 and KYSE180. In contrast, much more microtubules were detected in Tubastatin A‐treated cells compared with control group, indicating an increased stability of the microtubule cytoskeleton (Figures 3C and 3D). The data indicated that HDAC6 regulated ESCC cell motility through targeting α‐tubulin.
Figure 3
α‐tubulin is essential for HDAC6 regulated ESCC cell motility. In KYSE140 and KYSE180, Tubastatin A (A) and HDAC6 siRNA (B) triggered an increase of acetylation of α‐tubulin in a dose dependent manner. C and D, Much more microtubules were detected in Tubastatin A‐treated cells than in control group in KYSE140
α‐tubulin is essential for HDAC6 regulated ESCC cell motility. In KYSE140 and KYSE180, Tubastatin A (A) and HDAC6 siRNA (B) triggered an increase of acetylation of α‐tubulin in a dose dependent manner. C and D, Much more microtubules were detected in Tubastatin A‐treated cells than in control group in KYSE140
HDAC6 regulated acetylation of HSP90
As acknowledged, HDAC6 could regulate the activity of HSP90. Herein, we found Tubastatin A and HDAC6 siRNA triggered an increase of acetylation of HSP90 in both KYSE140 and KYSE180 cells by co‐immunoprecipitation assay (Figure 4). As a chaperone, HSP90 regulates stability of multiple proteins to facilitate development of cancer. EGFR is a client protein of HSP90 and highly expressed in the majority of ESCC cells.12 EGFR signaling through PI3K‐AKT and MAPK‐ERK to exert its oncogene function.13 In KYSE140 and KYSE180 cells, PU‐H71, a kind of HSP90 inhibitor, induced a decrease of EGFR protein level. Correspondingly, phosphorylation level of AKT and ERK were also decreased in PU‐H71‐treated cells compared with control group (Figures 5A and 5B). In consistent with results of HSP90 inhibition, Tubastatin A treatment also evoked reduced protein level of EGFR, phospho‐AKT, and phospho‐ERK but to a less degree (Figures 5C and 5D).
Figure 4
Effect of inhibition of HDAC6 on the expression of acetylation of HSP90. The co‐immunoprecipitation assay was performed to evaluated the the expression of acetylation of HSP90. The result showed Tubastatin A and HDAC6 siRNA triggered an increase of acetylation of HSP90 in both KYSE140 and KYSE180 cells
Figure 5
PU‐H71 and Tubastatin A regulatedthe expressions of proteins. In KYSE140 (A) and KYSE180 (B), EGFR, AKT, phospho‐AKT and phospho‐ERK levels were decreased in PU‐H71‐treated cells compared with control group. Tubastatin treatment also evoked reduced protein level of EGFR, AKT, phospho‐AKT, and phospho‐ERK in KYSE140 (C) and KYSE180 (D)
Effect of inhibition of HDAC6 on the expression of acetylation of HSP90. The co‐immunoprecipitation assay was performed to evaluated the the expression of acetylation of HSP90. The result showed Tubastatin A and HDAC6 siRNA triggered an increase of acetylation of HSP90 in both KYSE140 and KYSE180 cellsPU‐H71 and Tubastatin A regulatedthe expressions of proteins. In KYSE140 (A) and KYSE180 (B), EGFR, AKT, phospho‐AKT and phospho‐ERK levels were decreased in PU‐H71‐treated cells compared with control group. Tubastatin treatment also evoked reduced protein level of EGFR, AKT, phospho‐AKT, and phospho‐ERK in KYSE140 (C) and KYSE180 (D)
Targeting HSP90‐HDAC6 is effective in ESCC cells
Combination of HSP90 and HDAC6 inhibition was proved to be promising in several cancer types. In KYSE140 and KYSE180 cells, combination of Tubastatin A and PU‐H71 significantly reduced cell proliferation and migration in comparison with treatment of either inhibitor alone (Figures 6A and 6B). Consistently, cells treated with both Tubastatin A and PU‐H71 exhibited lowest protein level of EGFR, phospho‐AKT, and phospho‐ERK in comparison with Tubastatin A or PU‐H71 treatment alone (Figure 6C).
Figure 6
Targeting HSP90‐HDAC6 is effective in ESCC cells. A, In KYSE140 and KYSE180, combination of Tubastatin A and PU‐H71 significantly reduced cell viability in comparation with treatment of either inhibitor alone. B, Tubastatin A and PU‐H71Tubastatin A evoked a sharp decrease of cell migration. C, Cells treated with Tubastatin A and PU‐H71 exhibited lowest protein level of EGFR, phospho‐AKT and phospho‐ERK in comparation with Tubastatin A or PU‐H71 treatment alone. (*P < 0.05 vs the control group, #
P < 0.05 vs the drug treatment group)
Targeting HSP90‐HDAC6 is effective in ESCC cells. A, In KYSE140 and KYSE180, combination of Tubastatin A and PU‐H71 significantly reduced cell viability in comparation with treatment of either inhibitor alone. B, Tubastatin A and PU‐H71Tubastatin A evoked a sharp decrease of cell migration. C, Cells treated with Tubastatin A and PU‐H71 exhibited lowest protein level of EGFR, phospho‐AKT and phospho‐ERK in comparation with Tubastatin A or PU‐H71 treatment alone. (*P < 0.05 vs the control group, #
P < 0.05 vs the drug treatment group)
Targeting HSP90‐HDAC6 is a promising strategy for ESCC in vivo
Our data suggested that combination inhibition of HSP90 and HDAC6 might be effective for ESCC treatment, further, this hypothesis was confirmed in vivo model. The tumor growth of KYSE140 cells was significantly suppressed in all groups treated with inhibitors compared to control group. However, remarkable tumor inhibitory effect was only observed in mice treated with both Tubastatin A and PU‐H71 (Figures 7A and 7B). Consistently, the mice treat with Tubastatin A and PU‐H71 exhibited lowest protein level of EGFR, phospho‐AKT, and phospho‐ERK in comparison with Tubastatin A or PU‐H71 treatment alone in tumors (Figure 7C). In addition, the IHC assay indicated that co‐treatment with Tubastatin A and PU‐H71 significantly inhibited the expression of EGFR in tumors (Figure 7D).
Figure 7
Targeting HSP90‐HDAC6 is a promising strategy for ESCC in vivo. A and B, The tumor growth of KYSE140 cells was significantly suppressed in all groups treated with inhibitor compared with control group. C, The mice treat with Tubastatin A and PU‐H71 exhibited lowest protein level of EGFR, phospho‐AKT and phospho‐ERK in comparation with Tubastatin A or PU‐H71 treatment alone. D, IHC assay tested the expression of EGRF in tumor
Targeting HSP90‐HDAC6 is a promising strategy for ESCC in vivo. A and B, The tumor growth of KYSE140 cells was significantly suppressed in all groups treated with inhibitor compared with control group. C, The mice treat with Tubastatin A and PU‐H71 exhibited lowest protein level of EGFR, phospho‐AKT and phospho‐ERK in comparation with Tubastatin A or PU‐H71 treatment alone. D, IHC assay tested the expression of EGRF in tumor
DISCUSSION
Traditional therapeutic strategies for the treatment of esophageal cancer include surgery coupled with radiotherapy and chemotherapy. However, chemo/radio‐resistance often leads to treatment failure and poor prognosis in many patients.14 In addition, high incidence of metastasis to node lymph and distant organ threatens patient's life to a large extent.15 Fortunately, many targets have been defined and molecular therapies have rapidly been developed in recent years, several of them has been preclinical studied and found to be effective.16, 17 However, due to heterogeneity of esophageal cancer, the already discovered targets could not met drug development needs and further investigation was necessary.HDACs contribute to process of carcinogenesis of various types. In esophageal cancer, high expression of HDAC1 was detected in ESCC samples especially in the carcinoma invaded into the deeper layers of the esophageal wall.18 Application of Valproic acid, a class I HDAC inhibitor, enhanced sensitivity of ESCC cells toward radiotherapy.19 The expression and function of HDAC6 in esophageal cancer has not been studied yet. In the present study, we found that HDAC6 was overexpressed in esophageal cancer cells. HDAC6 deacetylated α‐tubulin to promote ESCC cell migration. Additionally, HDAC6 also support ESCC cell growth by targeting HSP90.The importance of HSP90 in process of carcinogenesis has been established for many years. Early IHC results shown that HSP90 expressed in esophageal tumors, whereas normal esophageal epithelium expressed no or very low levels of the protein.9 Considering HDAC6 is a client protein of HSP90,11 it might explain its high expression in esophageal cancer especially ESCC. The study also demonstrated that treatment of 17‐AAG, a HSP90 inhibitor, reduced cell proliferation, and increase radiosensitivity in two esophageal cancer cell lines.9 In our cell lines tested, esophageal cancer cells are not so sensitive towards HSP90 inhibition as been reported in KYSE70 and KYSE450.9 This might be due to different background of cell lines and different inhibitors used to inhibit HSP90 activity.Combination inhibition of HSP90‐HDAC6 interplay has been considered as an attractive strategy and achieved preclinical progress in humanleukemia and breast cancer.20, 21 HDAC6 and HSP90 regulate each other reciprocally in many aspects. In one hand, HDAC6 could deacetylate HSP90 and thus stabilized many oncogenic proteins, inhibition of HDAC6 strengthens the binding of HSP90 to 17‐AAG; on the other hand, HDAC6 itself is a client protein of HSP90 and its activity is upregulated by EGFR, another client protein of HSP90.22, 23, 24 We found that co‐administration of Tubastatin A and PU‐H71 greatly suppressed both proliferation and migration in ESCC cells examed. Additionally, the tumor growth in nude mice was also decreased upon combination treatment of Tubastatin A and PU‐H71. Protein level of EGFR, phospho‐AKT, and phospho‐ERK were downregulated toward PU‐H71 or Tubastatin A treatment and to a large extent towards combination treatment of PU‐H71 and Tubastatin A. These data validated that targeting HSP90‐HDAC6 interplay was also feasible in esophageal cancer.In conclusion, our results suggested that HDAC6 promoted ESCC cell motility and represented a novel target by regulating HSP90 in ESCC. Moreover, combination inhibition of HSP90 and HDAC6 could effectively inhibit ESCC cell proliferation and migration and thus might be a promising therapeutic strategy for ESCC patients.
Authors: Jacques Ferlay; Hai-Rim Shin; Freddie Bray; David Forman; Colin Mathers; Donald Maxwell Parkin Journal: Int J Cancer Date: 2010-12-15 Impact factor: 7.396
Authors: T Furihata; T Sakai; H Kawamata; F Omotehara; Y Shinagawa; J Imura; Y Ueda; K Kubota; T Fujimori Journal: Int J Oncol Date: 2001-11 Impact factor: 5.650
Authors: Katarzyna B Leszczynska; Greg Dobrynin; Rhea E Leslie; Jonathan Ient; Adam J Boumelha; Joana M Senra; Maria A Hawkins; Tim Maughan; Somnath Mukherjee; Ester M Hammond Journal: Radiother Oncol Date: 2016-11-10 Impact factor: 6.280
Authors: David S Liu; Sanne J M Hoefnagel; Oliver M Fisher; Kausilia K Krishnadath; Karen G Montgomery; Rita A Busuttil; Andrew J Colebatch; Matthew Read; Cuong P Duong; Wayne A Phillips; Nicholas J Clemons Journal: Oncotarget Date: 2016-12-13
Authors: Stephen Kershaw; David J Morgan; James Boyd; David G Spiller; Gareth Kitchen; Egor Zindy; Mudassar Iqbal; Magnus Rattray; Christopher M Sanderson; Andrew Brass; Claus Jorgensen; Tracy Hussell; Laura C Matthews; David W Ray Journal: J Cell Sci Date: 2020-06-11 Impact factor: 5.285