Literature DB >> 29658611

Effects of nicotine on the metabolism and gene expression profile of Sprague‑Dawley rat primary osteoblasts.

Dan Liang1, Ke-Jing Wang1, Zhi-Qun Tang1, Run-He Liu1, Fulei Zeng1, Miao-Ying Cheng1, Qi-Si Lian1, Hong-Kun Wu1.   

Abstract

Smoking is a risk factor associated with bone and oral diseases, particularly periodontitis. Nicotine, the major toxic component of tobacco, is able to affect the quality and quantity of bone. Osteoblasts serve an important role in bone formation. Thus far, the effects of nicotine on metabolism‑associated gene and protein expression in osteoblasts have been controversial and the mechanisms remain unclear. The present study assessed alterations in osteogenic activity by performing a Cell Counting kit‑8 assay to investigate proliferation, Annexin V‑fluorescein isothiocyanate/propidium iodide staining to investigate apoptosis, alizarin red staining to investigate the formation of mineralized nodules, reverse transcription‑quantitative polymerase chain reaction and western blotting to investigate the mRNA and protein levels of collagen I, alkaline phosphatase, bone osteocalcin, bone sialoprotein and osteopontin; and mRNA microarray expression analysis, Kyoto Encyclopedia of Genes and Genomes and Gene Ontology analysis to investigate the whole genome expression profile of Sprague‑Dawley (SD) rat primary osteoblasts following treatment with different concentrations of nicotine. The results demonstrated that nicotine inhibited proliferation, promoted early apoptosis and inhibited mineralized nodule formation in a dose‑dependent manner by regulating alkaline phosphatase activity and the expression of osteoblast metabolism‑associated genes and proteins. According to microarray analysis, several genes associated with bone metabolism and genes in the Hedgehog and Notch signaling pathways were downregulated significantly in nicotine‑treated osteoblasts. The results of the present study indicated that nicotine may serve an inhibitory, dose‑dependent role in SD rat primary osteoblasts that may be caused by the perturbation of genes and signaling pathways associated with bone formation. These results may provide a theoretical basis for future research regarding bone metabolism and targeted treatment of oral diseases associated with smoking.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 29658611      PMCID: PMC5984003          DOI: 10.3892/mmr.2018.8884

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Smoking is a strong risk factor for various oral diseases and particularly for periodontitis (1,2), which primarily presents as alveolar bone resorption. A higher prevalence and more severe form of periodontitis has been associated with smokers compared with non-smokers (3). Nicotine is the major toxic component of tobacco and regulates bone metabolism by accelerating the loss of periodontal tissue attachment and alveolar bone absorption, exacerbating periapical disease, inducing peri-implantitis and decreasing the rate of bone regeneration following tooth extraction or surgery (4–7). The inhalation of tobacco leads to the accumulation of toxic components in the circulatory system and local oral tissue (8). Our unpublished data indicated that nicotine is directly deposited on tooth surfaces and in alveolar bone; therefore, we inferred that the deposition of nicotine may serve an important role in regulating bone metabolism. Bone metabolism depends on the dynamic balance between bone formation and absorption. Osteoblasts have an important role in bone formation. En-Nosse et al (9) identified a number of types of nicotinic acetylcholine receptors, to which nicotine can specifically bind, on the surface of osteoblasts. Therefore, the effects of nicotine on alveolar bone may be partially due to its effects on osteoblasts. In an in vitro osteogenesis process, osteoblasts adhere to the bone defect zone, synthesize and secrete collagen I to form bone matrix, and subsequently secrete various non-collagen matrix proteins, including alkaline phosphatase (ALP), bone osteocalcin (OCN), bone sialoprotein (BSP) and osteopontin (OPN) (10), which serve important roles in the mineralization of bone matrix. Previous studies have indicated the effects of nicotine on the proliferation and differentiation of osteoblasts in different types of models (11–15). Few of the studies used primary osteoblasts. Additionally, the results remain controversial, and the underlying mechanisms unclear. A number of the studies have demonstrated that nicotine has an inhibitory effect on bone metabolism, while others demonstrated a biphasic effect. In the present study, primary Sprague-Dawley (SD) rat osteoblasts were cultured and the effects of different concentrations of nicotine on osteogenic activity and the whole genome expression profile were investigated to clarify the molecular mechanisms and to provide a theoretical basis for diseases caused by smoking and associated with the imbalance of bone metabolism.

Materials and methods

Cell culture

The current study was approved by the Ethics Committee of West China Hospital of Stomatology of Sichuan University (Chengdu, China). A total of 80 male newborn SD rats (<72 h old, 6–8 g) were obtained from the West China Animal Experiment Center of Sichuan University and bred in constant specific-pathogen-free conditions (relative humidity, 50%; temperature, 25°C; 12-h light/dark cycle) and had free access to breast milk. The newborn rats were sacrificed by cervical dislocation. Primary osteoblasts were obtained from the parietal bone; the bone was chopped into 1 mm2 fragments, rinsed with PBS (Hyclone; GE Healthcare Life Sciences; Logan, UT, USA), digested with 5 ml trypsin (0.25%; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 10 min at 37°C and incubated with 10 ml collagenase I (1 g/l; Sigma-Aldrich; Merck KGaA) at 37°C for 90 min. The fragments were seeded into 25-cm2 flasks at a density of 15 fragments per flask, mixed with Dulbecco's modified Eagle's medium (DMEM; Hyclone; GE Healthcare Life Sciences) containing 10% fetal bovine serum (Hyclone; GE Healthcare Life Sciences), 100 units/ml penicillin and 100 µg/ml streptomycin (Sigma-Aldrich; Merck KGaA) and then cultured at 37°C with 5% CO2. The medium was changed every other day. Osteoblasts from passages 2–4 were used in subsequent experiments.

Cell identification

Cells were cultured at 37°C with 5% CO2 in osteogenic induction medium containing DMEM with 10% fetal bovine serum, β-glycerophosphate (10 mmol/l) and L-ascorbate (50 µg/ml), all purchased from Sigma-Aldrich (Merck KGaA), in 6-well plates at a density of 5×104 cells/ml. When the cells reached 80% confluence, they were thrice rinsed with PBS and fixed with 95% ethanol for 10 min at the room temperature. ALP was stained with a BCIP/NBT kit (Beyotime Institute of Biotechnology, Haimen, China) and then observed using an inverted microscope (magnification, ×200). Following culture for 3 weeks, cells were fixed with 4% polyoxymethylene for 30 min at the room temperature, stained using alizarin red was performed at 37°C (Cyagen Biosciences Guangzhou, Inc., Guangzhou, China) and observed by an inverted microscope (magnification, ×40) to characterize the osteoblasts.

Cell viability and apoptosis

Osteoblasts cultured in 96-well plates at 37°C with 5% CO2 at a density of 5×104 cells/ml were exposed to nicotine (Sigma-Aldrich; Merck KGaA) at various concentrations (0, 1×10−6, 1×10−5, 1×10−4 and 1×10−3 mol/l) for 1, 3, 5 and 7 days. Cell proliferation was evaluated using a Cell Counting kit-8 (CCK-8) kit (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) in accordance with the manufacturer's protocols. The optical absorbance of samples was measured using a microplate reader at a wavelength of 450 nm. Following the culturing of cells (5×104 cells/ml) with nicotine-containing medium in 25 cm2 flasks at 37°C with 5% CO2 for 7 days, apoptosis was evaluated using an Annexin V-Fluorescein Isothiocyanate (FITC)/Propidium Iodide (PI) Apoptosis Detection kit (Dojindo Molecular Technologies, Inc.), in accordance with the manufacturer's protocols, and detection was performed on a flow cytometer (Beckman Coulter, Inc., Brea, CA, USA). CytExpert software (version 1.0.135.1; Beckman Coulter, Inc.) was used for analysis. The results were interpreted as follows: Active cells [Annexin V-FITC(−)/PI(−)], early-phase apoptotic cells [Annexin V-FITC(+)/PI(−)], and necrotic and late-phase apoptotic cells [Annexin V-FITC(+)/PI(+)].

ALP activity assay

Osteoblasts were cultured in 12-well plates at a density of 5×104 cells/ml at 37°C with 5% CO2. When cells reached 70–80% confluence, nicotine-containing medium was added at 0, 1×10−6, 1×10−5, 1×10−4 and 1×10−3 mol/l concentrations. ALP activity was evaluated after days 4, 7 and 10 using an ALP test kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's protocol. The optical absorbance was measured by a microplate reader at a wavelength of 520 nm. The protein concentrations of samples were determined by a BCA kit (Beyotime Institute of Biotechnology) according to the manufacturer's protocol. ALP levels were normalized to the total protein content at the end of the experiment.

Alizarin red staining and quantitative analysis

Osteoblasts were plated in 6-well plates at a density of 5×104 cells/ml. Following incubation with nicotine-containing medium (0, 1×10−6, 1×10−5, 1×10−4 and 1×10−3 mol/l) at 37°C with 5% CO2 for 21 days, 4% paraformaldehyde (Shanghai Chemical Reagent Co., Ltd., Shanghai, China) and 0.1% alizarin red staining solution (Cyagen Biosciences Guangzhou, Inc.) were consecutively added with room temperature incubations of 30 and 5 min, respectively. A digital camera (D610; Nikon Corporation, Tokyo, Japan) was used to capture images. Subsequently, 1 ml PBS and 1 ml OF 10% cetylpyridinium chloride (Sigma-Aldrich; Merck KGaA) were successively added to each well and incubated at 37°C for 15 min. The optical absorbance of samples was measured using a microplate reader at a wavelength of 562 nm.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Osteoblasts were plated in 6-well plates at a density of 5×104 cells/ml. Following incubation with nicotine-containing medium (0, 1×10−6, 1×10−5, 1×10−4 and 1×10−3 mol/l) at 37°C with 5% CO2 for 7 days, the total RNA was extracted using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Following quality confirmation of the extracted RNAs, cDNAs were synthesized using a Revert Aid™ First Strand cDNA Synthesis kit (Fermentas; Thermo Fisher Scientific, Inc., Pittsburgh, PA, USA) for 10 min at 20°C, for 60 min at 42°C and 10 min at 70°C. The primers used for the amplification are given in Table I. qPCR was conducted with SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) kit (Takara Biotechnology Co., Ltd., Dalian, China). The reaction mixture (30 µl) contained 3 µl buffer (Mg2+ free, 10X), 3 µl MgCl2 (25 mM), 0.36 µl dNTP (25 mM), 1 µl each of 10 µM forward and reverse primers, 1 µl SYBR-Green I (10X), 0.3 µl Taq enzyme (5 U/µl), 5 µl cDNA and 15.34 µl ddH2O. Amplification was performed using a real-time PCR detection system (Funglyn Biotech, Inc., Richmond Hill, Canada) with temperature cycles set as follows: 94°C for 2 min, 45 cycles of 94°C for 20 sec and 56°C [for ALP, collagen type I α1 (Col1-α1), OCN and OPN], 52°C (for BSP) or 54°C (for β-actin) for 20 sec; and 72°C for 30 sec. Following normalizing the mean quantification cycle (Cq) values, the changes in the expression of ALP, Col1-α1, OCN, OPN and BSP genes were evaluated relative to the expression of β-actin as an internal control gene using the 2−∆∆Cq method, as previously described (16).
Table I.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Sequence

GeneForwardReverseProduct size (bp)
ALPCATCATGTTCCTGGGAGATGGGTGTTGTACGTCTTGGAGA148
Col1-α1GTGCTAAGGGTGAAGCTGGTCATCAGCACCAGGGTTTCCAG126
OCNCCTCTCTGACCTGGCAGGTGGCTCCAAGTCCATTGTTGA124
OPNCACTCAGATGCTGTAGCCACTTGTTGCTTGGAAGAGTTTCTTGCT126
BSPCTGAAGAAAACGGGGTCTTTAAGGAACTATCGCCATCTCCATT136
Notch1TCAGCGGGATCCACTGTGAGACACAGGCAGGTGAAGTTG175
Fgf21AGATCAGGGAGGATGGAACATCAAAGTGAGGCGATCCATA126
β-actinGAAGATCAAGATCATTGCTCCTTACTCCTGCTTGCTGATCCACA111

ALP, alkaline phosphatase; Col1-α1, collagen type I α1; OCN, osteocalcin; BSP, bone sialoprotein; OPN, osteopontin; Fgf21, fibroblast growth factor 21.

Western blot analysis

Cells were incubated with nicotine-containing medium (0, 1×10−6, 1×10−5, 1×10−4 and 1×10−3 mol/l) for 7 days and then lysed on ice for 30 min using 150 µl radioimmunoprecipitation buffer (Cell Signaling Technology, Inc., Danvers, MA, USA) to extract the protein. Protein concentrations were measured using a BCA kit. Protein samples (50 µg/lane) were subjected to SDS-PAGE on 12% polyacrylamide gels. Gels were run at 80 V for 20 min and 120 V for 50 min. Gel-separated proteins were transferred onto polyvinylidene difluoride membranes at 100 V for 90 min. The transfer membrane was blocked with PBS-0.1% Tween-20 containing 5% bovine serum albumin (Cell Signaling Technology, Inc.) at 4°C overnight. Following incubation at 4°C overnight with rabbit or mouse polyclonal IgG antibodies against ALP (cat. no. 11187-1-AP; 1:300), Col1-α1 (cat. no. 14695-1-AP; 1:300), OPN (cat. no. 25715-1-AP; 1:300), β-actin (cat. no. 66009-1-Ig; 1:5,000; all Wuhan Sanying Biotechnology, Wuhan, China), OCN (cat. no. ab13420; 1:300) or BSP (cat. no. ab52128; 1:300; both Abcam, Cambridge, MA, USA), the membranes were incubated at 37°C for 1 h with biotin-conjugated goat anti-rabbit IgG (cat. no. SA00004-2; 1:20,000; Wuhan Sanying Biotechnology) and biotin-conjugated goat anti-mouse IgG (cat. no. SA00004-1; 1:20,000; Wuhan Sanying Biotechnology). Immunoreactive proteins were visualized using a DAB color reagent kit (OriGene Technologies, Inc., Beijing, China) in the dark. Following image acquisition, the protein bands were quantitatively analyzed by Quantity One analysis software (version 4.6.6; Bio-Rad Laboratories, Inc., Hercules, CA, USA) and the relative expression levels of target proteins were calculated according to the ratio of gray value of target proteins to the gray value of the internal reference protein, β actin.

mRNA microarray analysis

To reveal the differentially expressed gene profiles following nicotine treatment, cells (5×104 cells/ml) were cultured with nicotine-containing medium (1×10−3 mol/l) and medium alone in 25 cm2 flasks at 37°C with an atmosphere of 5% CO2 for 7 days. Following this, osteoblast samples were subjected to whole genome microarray analysis using an Agilent Whole Rat Genome Oligonucleotide Microarray (Agilent Technologies, Inc., Santa Clara, CA, USA). The entire analysis procedure was performed by KangChen Bio-tech, Inc. (Shanghai, China). Using a 2.0-fold cutoff and P<0.05 for mRNA expression upregulation or downregulation, the key genes associated with nicotine treatment were identified. The results of microarray analysis were validated by RT-qPCR to detect the expression of Notch1 and Fgf21, which demonstrated significant down- and upregulation, respectively, by microarray analysis. The primers used for amplification are given in Table I. Amplification was performed with annealing and extension at 56°C for Notch1 and Fgf21 and 54°C for β-actin. Gene expression was calculated as described above for RT-qPCR. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway and Gene Ontology (GO) enrichment analysis. To further investigate the functions of the differentially expressed genes, GO terms were analyzed using the GO database (17) (http://www.geneontology.org/) and P-values for all genes were calculated in all GO categories, including Cellular Component, Molecular Function and Biological Process terms. The threshold of significance was defined as P<0.05. The data on signaling pathways were obtained from the KEGG pathway database (18) (http://www.kegg.jp/kegg/kegg2.html), and the threshold of significance was defined as P<0.05.

Statistical analysis

All experiments were performed at least in triplicate (n=3 independent experiments). Data are presented as the mean ± standard deviation. The data were analyzed by SPSS software version 16.0 (SPSS, Inc., Chicago, IL, USA). The differences between groups were analyzed by one-way analysis of variance and Student-Newman-Keuls tests. P<0.05 was considered to indicate a statistically significant difference.

Results

Cultured osteoblasts were stained using the BCIP/NBT ALP staining kit and observed on an inverted microscope. A large number of positively stained cells with blue-violet cell membranes and cytoplasmic granules were observed (Fig. 1A). Alizarin red-stained calcified nodules appeared red (Fig. 1B). This result confirmed that the cultured cells were in fact osteoblasts.
Figure 1.

Characterization of Sprague-Dawley rat osteoblasts. (A) Alkaline phosphatase staining demonstrated positive cells with blue-violet cell membranes and cytoplasmic granules (magnification, ×200). (B) Alizarin red-stained calcified nodules were stained red (magnification, ×40).

Effects of nicotine on early apoptosis

The results of Annexin V-FITC/PI double staining was performed to investigate the early apoptosis of osteoblasts. Quadrant 1 was considered to indicate early apoptotic cells and thus was used for the quantification of apoptosis rates. The results indicated that the early apoptosis of osteoblasts was only significantly promoted by treatment with nicotine concentrations of 1×10−4 and 1×10−3 mol/l, compared with the control group (Fig. 2). These results suggested that nicotine promoted the early apoptosis of osteoblasts in a dose-dependent manner.
Figure 2.

Effects of nicotine on Sprague-Dawley rat osteoblast apoptosis. (A) Representative scatter plots for the apoptosis of control and nicotine-treated osteoblasts following flow cytometry. (B) Quantified results for apoptosis (quadrant 1) demonstrated that, compared with the control group, the early apoptosis of cells was significantly promoted by nicotine at concentrations of 1×10−4 and 1×10−3 mol/l after 7 days. Each bar represents the mean ± standard deviation (n=3) *P<0.05 vs. control group. FITC, fluorescein isothiocyanate; PI, propidium iodide.

Effects of nicotine on osteoblast proliferation and ALP activity

As demonstrated in Fig. 3A, compared with the control group, the proliferation of osteoblasts was significantly decreased in all nicotine groups (P<0.05) after 1 and 5 days, whereas proliferation was decreased only in the 1×10−3−mol/l group after 3 and 7 days (P<0.05). The inhibition of osteoblast proliferation was enhanced by increased nicotine concentrations. Compared with the control group, the ALP activity of all groups was significantly higher compared with the control group on the 4th day (P<0.05; Fig. 3B). On the 7th day, the ALP activity of the cells in all experimental groups was significantly lower compared with the control group (P<0.05; Fig. 3B). However, on the 10th day, only the ALP activity of the 1×10−4 and 1× 10−3 mol/l groups was significantly lower compared with the control group (P<0.05; Fig. 3B). This suggested demonstrated that nicotine inhibited the proliferation of osteoblasts and ALP activity in a dose-dependent manner.
Figure 3.

Effects of nicotine on cell proliferation, ALP activity and calcified nodule formation of Sprague-Dawley rat osteoblasts. (A) CCK-8 detection demonstrated that the proliferation of osteoblasts was significantly decreased in all nicotine groups at days 1 and 5, while proliferation was only inhibited at 1×10−3 mol/l nicotine at days 3 and 7, compared with the control group. (B) ALP activity in nicotine groups was significantly higher at day 4 compared with the control group, while ALP activity was reduced in nicotine-treated groups compared with the control group at days 7 and 10. (C) The alizarin red staining of the mineralized nodules was captured using a digital camera. (D) The formation of mineralized nodules decreased significantly at all nicotine concentrations after 21 days of culture compared with the control group. Each bar represents the mean ± standard deviation (n=) *P<0.05 vs. control group. ALP, alkaline phosphatase; CCK-8, Cell Counting kit-8; OD, optical density.

Effects of nicotine on the mineralized nodule formation of osteoblasts

The results of alizarin red staining revealed decreased numbers of mineralized nodules following treatment with nicotine in a dose-dependent manner (Fig. 3C). Quantification of alizarin red staining demonstrated that the number of mineralized nodules stained in the experimental groups decreased significantly compared with the control group as the nicotine concentration increased (Fig. 3D). These results demonstrated that nicotine suppressed the bone formation of osteoblasts in a dose-dependent manner.

Effects of nicotine on osteoblast metabolism-associated mRNA expression

The effect of nicotine on the mRNA expression of genes associated with osteoblast metabolism was investigated by RT-qPCR (Fig. 4). As demonstrated in Fig. 4A, nicotine exhibited no significant effect on the gene expression of ALP in the osteoblasts of SD rats. In addition, there were no significant differences in the expression of Col1-α1 and OCN genes among the control group and the 1×10−6, 1×10−5 and 1×10−4 mol/l groups; however, in the 1×10−3 mol/l group, the expression level of Col1-α1 and OCN were significantly lower compared with the control group (P<0.05; Fig. 4B and C). The expression of the BSP gene in each experimental group was significantly lower compared with the control group (P<0.05; Fig. 4D). Furthermore, although no significant differences in OPN expression were observed between the control and the 1×10−6, 1×10−5 and 1×10−4 mol/l groups, OPN expression was significantly higher compared with the control group in the 1×10−3 mol/l group (Fig. 4E). The results suggested that the inhibitory effect of nicotine on bone formation was regulated by the upregulation of OPN mRNA as well as the downregulation of Col1-α1, BSP and OCN mRNA in osteoblasts.
Figure 4.

Effects of nicotine on the expression of Sprague-Dawley rat osteoblast metabolism-associated genes at day 7 of culture. (A) Nicotine exhibited no significant effects on the expression of ALP mRNA. The expression levels of (B) Col1-α1 and (C) OCN mRNA were significantly lower in the 1×10−3 mol/l nicotine group compared with the control group. (D) BSP mRNA expression was significantly lower in all nicotine groups compared with the control group. (E) OPN mRNA expression was significantly increased in the 1×10−3 mol/l nicotine group compared with the control group. Each bar represents the mean ± standard deviation (n=3) *P<0.05 vs. control group. ALP, alkaline phosphatase; Col1-α1, collagen type I α1; OCN, osteocalcin; BSP, bone sialoprotein; OPN, osteopontin.

Effects of nicotine on osteoblast metabolism-associated protein expression

As demonstrated in Fig. 5, the ALP and BSP protein levels were significantly decreased in the 1×10−5, 1×10−4 and 1×10−3 mol/l groups compared with the control group (P<0.05), the expression levels of Col1-α1 and OCN protein in the 1×10−4 and 1×10−3 mol/l groups were significantly lower compared with the control group (P<0.05) and the OPN protein level was significantly higher compared with the control group at 1×10−4 and 1×10−3 mol/l nicotine (P<0.05). The results indicated that the inhibitory effect of nicotine on bone formation was regulated by the upregulation of OPN protein levels as well as the downregulation of ALP, BSP, Col1-α1 and OCN protein levels in osteoblasts.
Figure 5.

Effects of nicotine on the expression of Sprague-Dawley rat osteoblast metabolism-associated proteins at day 7 of culture. (A) Nicotine significantly decreased ALP protein expression in the 1×10−5, 1×10−4 and 1×10−3 mol/l nicotine groups compared with the control group. The protein levels of (B) Col1-α1 and (C) OCN were significantly decreased by nicotine in the 1×10−4 and 1×10−3 mol/l groups compared with the control group. (D) BSP proteins levels were significantly decreased by all concentrations of nicotine, excluding 1×10−6 mol/l, compared with the control group. (E) OPN protein was significantly increased by 1×10−3 and 1×10−4 mol/l nicotine compared with the control group. (F) Representative western blot bands for the protein expression of ALP, Col1-α1, OCN, BSP and OPN in Sprague-Dawley rat osteoblasts. Each bar represents the mean ± standard deviation (n=3) *P<0.05 vs. control group. ALP, alkaline phosphatase; Col1-α1, collagen type I α1; OCN, osteocalcin; BSP, bone sialoprotein; OPN, osteopontin.

Effects of nicotine on the whole genome expression profile of SD rat osteoblasts

Microarray analysis revealed 277 genes with at least 2-fold altered expression and P<0.05 following nicotine treatment, including 121 upregulated genes and 156 downregulated genes. The top 10 upregulated and downregulated genes are presented in Tables II and III, respectively. As demonstrated in Table IV, the expression of genes associated with bone metabolism, including matrix metallopeptidase 3, SMAD family member 3 and latent transforming growth factor b-binding protein 2, were significantly altered. In order to further verify the microarray results, the upregulated and downregulated genes with greatest fold changes were chosen and further analyzed using RT-qPCR. The results demonstrated that the expression of Notch1 was downregulated 5.67-fold and that Fgf21 expression was upregulated 5.94-fold in the osteoblasts of SD rats treated with 1×10−3 mol/l nicotine compared with the control group, which was consistent with the microarray results (Fig. 6A). Gene Ontology analysis indicated that 1×10−3 mol/l nicotine altered several functions of the osteoblasts of SD rats in the three main aspects of Cellular Component, Molecular Function and Biological Process. The differentially expressed genes associated with various functions are presented in Fig. 6B. Pathway analysis indicated that differentially expressed genes were primarily associated with signal transduction pathways. The top 10 up and downregulated pathways are presented in Tables V and VI. Among the pathways identified, the Hedgehog and Notch pathways have been previously revealed to directly regulate osteoblast differentiation (19–21). The upregulated and downregulated genes associated with the Hedgehog and Notch pathways are presented in Table VII. These results revealed the potential underlying mechanisms associated with the effect induced by nicotine on the osteogenic activity of osteoblasts.
Table II.

The top 10 upregulated genes that were differentially expressed in nicotine-treated osteoblasts compared with control cells.

Gene nameFold changeP-value
Fgf216.2120.0442
RGD15626676.0670.0289
RGD15594826.0570.0127
Fam25a5.9480.0021
Cd385.2140.0035
Pla2g104.3150.0074
Akr1c34.2850.0043
Serpinb104.1930.0005
Ccr14.1250.0083
Ebi34.0130.0011
Table III.

The top 10 downregulated genes that were differentially expressed in nicotine-treated osteoblasts compared with control cells.

Gene nameFold changeP-value
Notch15.4660.0001
Hey24.7270.0448
Ccdc404.0000.0019
Cdhr43.8930.0015
Adora2a3.8620.0001
Scin3.7540.0015
Smad33.7150.0006
Slc25a473.6460.0009
Sema3g3.5400.0205
Filip13.4830.0001
Table IV.

Osteogenesis-associated genes that were differentially expressed in nicotine-treated osteoblasts compared with control cells.

Gene nameFold changeP-valueRegulation
Smad33.7160.0007Down
MMP-32.6450.0001Down
Ltbp22.110.0006Down

Smad3, SMAD family member 3; MMP-3, matrix metallopeptidase 3; Ltbp2, latent transforming growth factor β-binding protein 2.

Figure 6.

Effect of 1×10−3 mol/l nicotine on the whole genome expression profile of Sprague-Dawley rat osteoblasts. (A) Reverse transcription-quantitative polymerase chain reaction analyses of Fgf21 and Notch1 genes demonstrated that the expression of Notch1 was downregulated 5.67-fold and that Fgf21 expression was upregulated 5.94-fold in the osteoblasts of Sprague-Dawley rats treated with 1×10−3 mol/l nicotine compared with the control group, which was consistent with the microarray results. (B) Gene Ontology analysis indicated that 1×10−3 mol/l nicotine altered functions in cellular component, molecular function and biological process categories. Each bar represents the mean ± standard deviation (n=3) *P<0.05 vs. control group. Fgf21, fibroblast growth factor 21.

Table V.

Kyoto Encyclopedia of Genes and Genomes pathway analysis of the top 10 significantly upregulated genes following nicotine treatment.

Pathway IDDefinitionCountP-valueGenes
rno04640Hematopoietic cell lineage (rat)40.0005CD34, CD38, IL2RA, ITGA2
rno04921Oxytocin signaling pathway (rat)50.0008CCND1, CD38, FOS, JUN, MYLK3
rno04510Focal adhesion (rat)50.0028ACTN3, CCND1, ITGA2, JUN, MYLK3
rno04380Osteoclast differentiation (rat)40.0029FCGR2B, FOS, JUN, LILRA5
rno05210Colorectal cancer (rat)30.0033CCND1, FOS, JUN
rno04630Jak-STAT signaling pathway (rat)40.0044BCL2L1, CCND1, IL2RA, TSLP
rno04662B cell receptor signaling pathway (rat)30.0046FCGR2B, FOS, JUN
rno05133Pertussis (rat)30.0046C1QC, FOS, JUN
rno05412Arrhythmogenic right ventricular cardiomyopathy (ARVC) (rat)30.0050ACTN3, ITGA2, SGCG
rno05222Small cell lung cancer (rat)30.0080BCL2L1, CCND1, ITGA2
Table VI.

Kyoto Encyclopedia of Genes and Genomes pathway analysis of the top 10 significantly downregulated genes following nicotine treatment.

Pathway IDDefinitionCountP-valueGenes
rno05150Staphylococcus aureus infection (rat)40.0002C3, C4A, CFB, SELP
rno05133Pertussis (rat)40.0007C3, C4A, C4BPA, IL23A
rno04610Complement and coagulation cascades (rat)40.0007C3, C4A, C4BPA, CFB
rno05322Systemic lupus erythematosus (rat)40.0058C3, C4A, HIST1H2AN, HIST1H3A
rno05323Rheumatoid arthritis (rat)30.0128IL23A, MMP3, TNFSF11
rno04514CAMs (rat)40.0156CLDN4, NEGR1, NTNG1, SELP
rno05033Nicotine addiction (rat)20.0212CACNA1B, GABRA1
rno04668TNF signaling pathway (rat)30.0227BIRC3, CX3CL1, MMP3
rno04340Hedgehog signaling pathway (rat)20.0298IHH, LRP2
rno04330Notch signaling pathway (rat)20.0345DLL3, NOTCH1
Table VII.

Differentially expressed genes associated with Hedgehog and Notch signaling pathways following nicotine treatment.

Gene nameFold changeP-valueRegulationPathway
IHH2.6190.0016DownHedgehog
LRP22.4060.0058DownHedgehog
DLL32.0560.0087UpNotch
NOTCH15.4660.0001DownNotch

IHH, Indian hedgehog; LRP2, low density lipoprotein receptor-related protein 2; DLL3, delta-like 3.

Discussion

A substantial amount of clinical and experimental research has demonstrated that tobacco smoking has deleterious effects on numerous biological systems, including an association with oral diseases (1). As the major toxic component, nicotine appears to serve a major role in the negative effects of tobacco smoke on bone metabolism, primarily by causing the absorption of alveolar bone. Various studies have investigated the effects of nicotine on the osteogenic activity by analyzing proliferation, differentiation, and specific protein and gene expression. However, the results remain controversial. Fang et al (22) reported that nicotine suppressed cellular proliferation and stimulated ALP activity in a dose-dependent fashion in UMR 106-01 rat osteoblastic osteosarcoma cells. Furthermore, nicotine was reported to inhibit the proliferation of osteoblasts as well as the expression of certain important osteogenic mediators in rabbit osteoblasts (23). Yuhara et al (11) further identified that in ROB-C26 cells, nicotine increased ALP activity in a dose-dependent manner and increased the deposition of Ca2+ similarly. However, nicotine was reported to reduce these two activities in MC3T3-E1 cells. A previous study has also indicated that nicotine may affect bone metabolism in a biphasic manner, stimulating proliferation and gene expression at low doses analogous to concentrations acquired by light smokers, and suppressing proliferation at high doses analogous to concentrations acquired by heavy smokers (13). Although these studies used nicotine in similar concentrations to treat osteoblasts, the results differed from each other. These differences may have occurred as a result of differences in cell culture conditions, species differences, the type of osteoblast model selected, including differentiation stage, and differences in experimental designs. In previous studies, cell lines such as MC3T3-E1 and MG-63 were often used, whereas few studies have been performed on primary osteoblasts. After several passages of cell lines, apparent phenotypic heterogeneity can develop and cells may arrest at a certain stage of differentiation, therefore no longer fully reflecting the normal phenotype of osteoblasts (13,24). Compared with cell lines, primary osteoblast cells are more similar to human osteoblasts. In 1995, the U.S. Food and Drug Administration approved the use of the primary rat osteoblasts as osteoporosis and other bone metabolic disease models to evaluate preclinical and clinical drug efficacy (25). Consequently, in the present study, experiments were conducted on SD rat primary osteoblasts using nicotine at concentrations of 1×10−6, 1×10−5, 1×10−4 and 1×10−3 mol/l. These concentrations were selected based on nicotine levels of 0.06–1.2 mM/l detected in the blood of smokers of varying regularity; these concentrations were significantly lower compared with the 0.6–9.6 mM/l identified in the saliva (26). In a previous study, 10−6 and 10−4 mol/l nicotine were reported to promote cell cycle progression during proliferation by downregulating p53 expression and upregulating cyclin D1 in the mouse pre-osteoblastic cell line MC3T3-E1 (27). However, the results of the present study revealed an inhibitory effect of nicotine on the proliferation of primary osteoblasts. The difference in the results may be due to the use of different cell models. Apoptosis is an active programmed cell death process that, together with cell proliferation and differentiation, maintains the homeostasis of the organism (28). To the best of our knowledge, the effects of nicotine on osteoblast apoptosis have rarely been reported. In the present study, the early apoptosis of cells was significantly promoted by nicotine concentrations of 10−4 and 10−3 mol/l. However, the mechanism underlying this effect requires further investigation. Previous studies have demonstrated that members of the Bcl-2 family, including Bcl-2, Bcl-2-like 2 and Bcl-2-associated X, members of the caspase family, including caspase 1 and caspase 3, and the oncogene c-Myc may be involved in osteoblast apoptosis (29,30). As an indicator of the differentiation potential of osteoblasts in the initial stage, ALP is able to hydrolyze the phosphate ester bonds on substrate molecules to generate phosphate ions, which have a strong affinity for Ca2+ (31). The quality and quantity of ALP is important in affecting the viability of osteoblasts. In previous studies, the effect of nicotine on the ALP activity of osteoblasts has been controversial. Yuhara et al (11) reported that nicotine reduced ALP activity in a dose-dependent manner in MC3T3-E1 cells and increased ALP activity in ROB-C26 cells during days 3–12. By contrast, Gullihorn et al (32) demonstrated that nicotine promoted ALP activity on day 3 in MC3T3-E1 cells. Sato et al (27) reported that following a transient increase in ALP activity at day 3, nicotine led to a marked reduction in the activity of ALP at day 7 in MC3T3-E1 cells, which is similar to the results of the present study. The results of the present study demonstrated that ALP activity was significantly higher in nicotine-treated groups compared with the control group at day 4, which may occur due to the stress response of the cells following nicotine stimulation and subsequent activation of the regulatory mechanism of ALP, potentially through the bone morphogenetic protein/Smads signaling pathway (33). In addition, studies have also demonstrated that nitric oxide affected the differentiation of osteoblast-like cells (34,35). Therefore, differences in the effects of nicotine on osteoblasts may be associated with differences in nitric oxide-associated pathways. Thus, it is noted that the regulatory effect of nicotine on the ALP activity of osteoblasts requires further confirmation and the regulatory mechanism, particularly the molecular pathways involved, also requires investigation. During in vitro osteogenesis, Col1 functions as the scaffold for the nucleation of hydroxyapatite crystals and acts on osteoblast cells in an autocrine manner to promote the expression of ALP, OCN, OPN and osteonectin by activating the protein kinase C signal transduction pathway (36). OCN is usually expressed in the early stage of calcification and regulates the speed and direction of bone matrix mineral formation (37). OPN is a phosphorylated sialoprotein with a highly conserved RGD motif that interacts with various receptors, including αvβ3, αvβ1 and αvβ5, on the surface of some cell types, such as osteoclast and endothelial cells (38). A previous study has reported that the phosphorylation of OPN may inhibit the formation of hydroxyapatite crystals in vitro in a dose-dependent manner. The mechanism of this inhibition may involve OPN interacting with osteoclast surface integrins (primarily αvβ3) through the RGD motif to mediate osteoclast adhesion in bone tissue and promote bone resorption (39). OPN has also been reported to inhibit osteoblast differentiation (40). BSP is a highly sulfated and phosphorylated glycoprotein that nucleates hydroxyapatite crystal formation. Nakayama et al (41) identified that nicotine suppressed the transcription of BSP mediated through CRE, FRE and HOX elements within the proximal promoter of the BSP gene in rats. According to the results of the present study, it may be concluded that the inhibition of mineralized nodule formation may depend on the effect of nicotine on ALP activity at 1×10−6 mol/l, on the decrease of ALP and BSP protein at1×10−5 mol/l and on the decrease of Col1-α1 and OCN protein, and the increase of OPN protein, at 1×10−4 and 1×10−3 mol/l nicotine. The inhibitory effect of nicotine on the expression levels of osteoblast metabolism associated mRNA and proteins was dose-dependent. Notably, in the presents study, the gene expression of each osteogenesis-associated factor was not completely consistent with the protein expression, which may be due to multiple regulatory steps that occur between transcription and translation. The effects of nicotine on osteoblasts involve complex intracellular signal transduction pathways; however, the specific molecular mechanism of regulation remains to be elucidated. The whole genome expression microarray is a high-throughput gene detection method that can provide a reliable basis for investigating the molecular regulatory mechanism of biological effects by utilizing bioinformatics analysis to evaluate the expression of genes in cells rapidly and comprehensively. GO analysis indicated that nicotine altered several functions of the SD rat osteoblasts, including organic metabolism, intercellular biological process regulation, cytokine receptor activity, inflammatory response, ion transport, calcium ion adhesion and transcription factor adhesion. KEGG pathway analysis demonstrated that these differentially expressed genes were primarily involved in pathways concerning proliferation, differentiation, apoptosis, adhesion and carcinogenesis. Among the pathways identified, the Hedgehog and Notch pathways have been reported to directly regulate osteoblast differentiation (42,43). In the Hedgehog pathway, Sonic hedgehog protein acts as an important signal molecule in the early stage of osteoblast differentiation, while Indian hedgehog protein (Ihh) is involved in the later stage to promote the differentiation and maturation of osteoblasts (44). The results of the present study demonstrated that the expression of Ihh was significantly decreased following nicotine treatment, indicating that nicotine may inhibit the proliferation, differentiation and function of SD rat osteoblasts by disturbing the Hedgehog signaling pathway. Concerning the role of the Notch pathway in the regulation of osteoblast differentiation, in vitro studies have reported contrasting results. Certain studies demonstrated that the overexpression of Notch1, one of the notch receptors, inhibited osteoblastic differentiation (45,46). Conversely, Tezuka et al (47) demonstrated that osteoblastic cell differentiation was regulated positively by Notch1. In the present study, the results demonstrated that the expression of Notch1 was significantly decreased following nicotine treatment, indicating that nicotine may inhibit the activation of the Notch signaling pathway and thereby decrease osteoblastic proliferation. However, this hypothesis requires confirmation. In conclusion, the present study demonstrated that nicotine exhibited an inhibitory effect on SD rat osteoblast metabolism. Microarray analysis revealed that the Notch and Hedgehog signaling pathways were enriched with differentially expressed genes in osteoblasts following nicotine treatment and that these pathways were strongly associated with osteoblast differentiation, which may result in improved future understanding of nicotine-induced bone diseases. These results may provide a theoretical basis for the prevention and treatment of smoking-related diseases in the future.
  46 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  The Gene Ontology (GO) database and informatics resource.

Authors:  M A Harris; J Clark; A Ireland; J Lomax; M Ashburner; R Foulger; K Eilbeck; S Lewis; B Marshall; C Mungall; J Richter; G M Rubin; J A Blake; C Bult; M Dolan; H Drabkin; J T Eppig; D P Hill; L Ni; M Ringwald; R Balakrishnan; J M Cherry; K R Christie; M C Costanzo; S S Dwight; S Engel; D G Fisk; J E Hirschman; E L Hong; R S Nash; A Sethuraman; C L Theesfeld; D Botstein; K Dolinski; B Feierbach; T Berardini; S Mundodi; S Y Rhee; R Apweiler; D Barrell; E Camon; E Dimmer; V Lee; R Chisholm; P Gaudet; W Kibbe; R Kishore; E M Schwarz; P Sternberg; M Gwinn; L Hannick; J Wortman; M Berriman; V Wood; N de la Cruz; P Tonellato; P Jaiswal; T Seigfried; R White
Journal:  Nucleic Acids Res       Date:  2004-01-01       Impact factor: 16.971

3.  Programmed cell death: Apoptosis meets necrosis.

Authors:  Marcus E Peter
Journal:  Nature       Date:  2011-03-17       Impact factor: 49.962

4.  Cell-matrix interaction in bone: type I collagen modulates signal transduction in osteoblast-like cells.

Authors:  J Green; S Schotland; D J Stauber; C R Kleeman; T L Clemens
Journal:  Am J Physiol       Date:  1995-05

5.  Expression and functional role of nitric oxide synthase isoforms in human osteoblast-like cells.

Authors:  H MacPherson; B S Noble; S H Ralston
Journal:  Bone       Date:  1999-03       Impact factor: 4.398

6.  Notch 1 overexpression inhibits osteoblastogenesis by suppressing Wnt/beta-catenin but not bone morphogenetic protein signaling.

Authors:  Valerie Deregowski; Elisabetta Gazzerro; Leah Priest; Sheila Rydziel; Ernesto Canalis
Journal:  J Biol Chem       Date:  2006-01-06       Impact factor: 5.157

Review 7.  History of treated periodontitis and smoking as risks for implant therapy.

Authors:  Lisa J A Heitz-Mayfield; Guy Huynh-Ba
Journal:  Int J Oral Maxillofac Implants       Date:  2009       Impact factor: 2.804

8.  Effects of nicotine on cellular function in UMR 106-01 osteoblast-like cells.

Authors:  M A Fang; P J Frost; A Iida-Klein; T J Hahn
Journal:  Bone       Date:  1991       Impact factor: 4.398

9.  Nicotine induces cell proliferation in association with cyclin D1 up-regulation and inhibits cell differentiation in association with p53 regulation in a murine pre-osteoblastic cell line.

Authors:  Tsuyoshi Sato; Takahiro Abe; Norimichi Nakamoto; Yasuhisa Tomaru; Noboru Koshikiya; Junya Nojima; Shoichiro Kokabu; Yasuaki Sakata; Akio Kobayashi; Tetsuya Yoda
Journal:  Biochem Biophys Res Commun       Date:  2008-10-01       Impact factor: 3.575

View more
  6 in total

Review 1.  Contextual Regulation of Skeletal Physiology by Notch Signaling.

Authors:  Daniel W Youngstrom; Kurt D Hankenson
Journal:  Curr Osteoporos Rep       Date:  2019-08       Impact factor: 5.096

2.  Sex-related differences in bone metabolism in osteoporosis observational study.

Authors:  Kyu Hwan Choi; Jong Ho Lee; Dong Gyu Lee
Journal:  Medicine (Baltimore)       Date:  2021-05-28       Impact factor: 1.817

3.  Flaxseed oil ameliorated high-fat-diet-induced bone loss in rats by promoting osteoblastic function in rat primary osteoblasts.

Authors:  Fulian Chen; Yan Wang; Hongwei Wang; Zhenhua Dong; Yan Wang; Mengqi Zhang; Jiaxuan Li; Shanshan Shao; Chunxiao Yu; Zhikun Huan; Jin Xu
Journal:  Nutr Metab (Lond)       Date:  2019-10-17       Impact factor: 4.169

4.  Nrf2 signaling activation by a small molecule activator compound 16 inhibits hydrogen peroxide-induced oxidative injury and death in osteoblasts.

Authors:  Jing-Wei Zhao; Pei-Jun Tang; Zhen-Tao Zhou; Gang Xu; Quan Li; Ke-Ran Li; Yue-Huan Zheng
Journal:  Cell Death Discov       Date:  2022-08-08

5.  A novel Keap1 inhibitor iKeap1 activates Nrf2 signaling and ameliorates hydrogen peroxide-induced oxidative injury and apoptosis in osteoblasts.

Authors:  Yue-Huan Zheng; Jian-Jun Yang; Pei-Jun Tang; Yuan Zhu; Zhe Chen; Chang She; Gang Chen; Peng Cao; Xiang-Yang Xu
Journal:  Cell Death Dis       Date:  2021-07-05       Impact factor: 9.685

6.  Sex-specific nicotine sensitization and imprinting of self-administration in rats inform GWAS findings on human addiction phenotypes.

Authors:  Alena Kozlova; Robert R Butler; Siwei Zhang; Thomas Ujas; Hanwen Zhang; Stephan Steidl; Alan R Sanders; Zhiping P Pang; Paul Vezina; Jubao Duan
Journal:  Neuropsychopharmacology       Date:  2021-05-18       Impact factor: 7.853

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.