Literature DB >> 29572943

Urogenital anomalies and urinary incontinence in an English Cocker Spaniel dog with XX sex reversal.

Hakyoung Yoon1,2, Sung-Hee Han3,4,5, Jaehwan Kim2, Kihoon Kim6, Kidong Eom2.   

Abstract

A 3-year-old dog weighing 8 kg was referred with a disorder of sexual development and persistent urinary incontinence before and after gonadohysterectomy performed at a local animal hospital. Histopathological examination disclosed hypoplasia of the testes, epididymis, pampiniform plexus, and uterus. On ultrasonography, an anomalous structure containing anechoic fluid was identified in the region dorsal to the urinary bladder. An anomalous communication between the proximal urethra and the remnant uterus and vagina was found on retrograde urethrography under fluoroscopy. Reflux of contrast medium into the anomalous structure, suspected to be the uterus and cranial vagina, from the urethra was detected. Computed tomography identified the anomalous structure between the rectum and urethra. The anomalous structure was removed via laparotomy and the urinary incontinence resolved. The diagnosis of XX sex reversal with a developmental anomaly of the genitourinary tract was made on the basis of laparotomy findings and cytogenetic and SRY gene analyses.
Copyright © 2018 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Entities:  

Keywords:  canine; clitoral bone; urethral anomaly; urethrovaginal fistula; urogenital anomaly; urogenital sinus

Mesh:

Year:  2018        PMID: 29572943      PMCID: PMC5980331          DOI: 10.1111/jvim.15119

Source DB:  PubMed          Journal:  J Vet Intern Med        ISSN: 0891-6640            Impact factor:   3.333


clitoral bone computed tomography disorder of sexual development sex‐determining region Y urinary bladder

INTRODUCTION

A 3‐year‐old English Cocker Spaniel dog weighing 8 kg was brought to a local animal hospital for evaluation of urinary incontinence, pollakiuria, and abnormal external genitalia indicating a disorder of sexual development (DSD). The dog had no history of estrous cycles. Physical examination of the external genitalia disclosed an enlarged vulva, a clitoral bone (CB), and no testes and scrotum. No abnormal findings were found on CBC and serum biochemistry panel. Escherichia coli was detected in bacterial and fungal cultures of urine samples collected using ultrasound‐guided cystocentesis. The dog underwent gonadohysterectomy at the local animal hospital. Gonads suspected to be testes were located at the cranial end of the uterine horns. The transformation zone between the uterine body and cervix was not identifiable on palpation. Therefore, the uterus was transected and ligated as caudally as possible. The uterus and 3 sections of the gonads and attendant structures were histologically evaluated at a laboratory (IDEXX Laboratories Inc, Seoul, South Korea). Hypoplasia of the testes, epididymis, and pampiniform plexus and absence of spermatozoa were identified in hematoxylin and eosin‐stained tissues (Figure 1). The uterus had normal morphology with uterine glands and columnar epithelium. After surgery, a single dose of cefovecin (4 mg/kg) was administered SC. Although the pollakiuria resolved, urinary incontinence persisted, and was particularly severe when pressure was placed on the dog's abdomen. Treatment with phenylpropanolamine (1 mg/kg PO q12h) for 1 week also was ineffective.
Figure 1

Histopathological findings after hematoxylin and eosin staining of the testes, epididymis, and pampiniform plexus identified at the end of the uterine body in an English Cocker spaniel with XX sex reversal with a developmental anomaly of the genitourinary tract associated with the urogenital sinus. Microscopic views of (A) the hypoplastic testis devoid of spermatozoa (×20), (B) the hypoplastic epididymis without spermatozoa (×100), and (C) the hypoplastic pampiniform plexus (×50)

Histopathological findings after hematoxylin and eosin staining of the testes, epididymis, and pampiniform plexus identified at the end of the uterine body in an English Cocker spaniel with XX sex reversal with a developmental anomaly of the genitourinary tract associated with the urogenital sinus. Microscopic views of (A) the hypoplastic testis devoid of spermatozoa (×20), (B) the hypoplastic epididymis without spermatozoa (×100), and (C) the hypoplastic pampiniform plexus (×50) The dog was referred to Konkuk University Veterinary Medical Teaching Hospital, where physical examination disclosed an enlarged vulva, enlarged clitoris with hard bony material, a small external urogenital opening, and the absence of a vestibule. In the sitting position, the external genitalia were in contact with the ground. A suspected urethral opening was abnormally located along the dorsal surface of the enlarged clitoris (Figure 2A).
Figure 2

Gross appearance and radiographic images of the enlarged clitoris in a dog with urogenital anomalies. A, The enlarged clitoris (arrowhead) protruding from the vulva. The urethral catheter inserted into the urethral orifice dorsal to the enlarged clitoris is identified in the dorsal recumbent dog. B, A radiographic image showing a radiopaque enlarged clitoris with a CB (arrowhead) protruding from the vulva

Gross appearance and radiographic images of the enlarged clitoris in a dog with urogenital anomalies. A, The enlarged clitoris (arrowhead) protruding from the vulva. The urethral catheter inserted into the urethral orifice dorsal to the enlarged clitoris is identified in the dorsal recumbent dog. B, A radiographic image showing a radiopaque enlarged clitoris with a CB (arrowhead) protruding from the vulva Abdominal radiography (Titan 2000M, Comed Medical Systems Co, Ltd, Seoul, South Korea) identified the CB in the enlarged clitoris (Figure 2B). Abdominal ultrasonography (Prosound F75, Aloca Co, Ltd, Tokyo, Japan) using 3.6–13.3 MHz linear transducers and 3.75‐10 MHz microconvex transducers identified an anomalous structure containing anechoic fluid dorsal to the urinary bladder (UB) suspected to be a remnant uterus and cranial vagina after gonadohysterectomy performed at the local animal hospital (Figure 3A,B). On mild abdominal compression during scanning of the caudal abdomen, urine was observed to flow from the anomalous structure to the exterior of the body, after which the size of the structure decreased. A urine sample was collected using ultrasound‐guided cystocentesis. No infectious organisms grew in bacterial and fungal cultures of the urine sample. A urethral catheter was inserted through an opening dorsal to the enlarged clitoris. Interestingly, urine drained through the catheter when it was inadvertently introduced into the anomalous structure. However, on color Doppler examination, bilateral ureteral jets were identified only in the UB, which confirmed that the ureters did not drain into the anomalous structure. Hyperechoic material suspected to be suture material used for ligation during gonadohysterectomy was identified in the cranial region of the anomalous structure (Figure 3A). When the urethral catheter was removed and reintroduced, it correctly located the UB.
Figure 3

Ultrasonography and postcontrast CT images of an anomalous structure adjacent to the UB in a dog with urogenital anomalies. A, A sagittal ultrasonographic image shows the anomalous structure containing anechoic fluid (asterisk) with hyperechoic material (white circle) at the cranial aspect of the structure dorsal to the UB. B, A sagittal ultrasonographic image shows inadvertent insertion of the UC into the anomalous structure. The hyperechoic foci in the anomalous structure are air bubbles generated by normal saline injection for inflation of the collapsed structure after catheterization. Sagittal (C) and transverse (D) CT images show the anomalous structure with contrast medium pooling. Connectivity of the tissue between the anomalous structure and the urethra can be observed, although the connectivity of the lumen cannot be clearly detected. A suspected site of adhesion (white arrow) can be observed between the cranial aspect (white arrow) of the anomalous structure and the UB. The arrowhead indicates the CB. UC, urethral catheter; P, pubis; R, rectum

Ultrasonography and postcontrast CT images of an anomalous structure adjacent to the UB in a dog with urogenital anomalies. A, A sagittal ultrasonographic image shows the anomalous structure containing anechoic fluid (asterisk) with hyperechoic material (white circle) at the cranial aspect of the structure dorsal to the UB. B, A sagittal ultrasonographic image shows inadvertent insertion of the UC into the anomalous structure. The hyperechoic foci in the anomalous structure are air bubbles generated by normal saline injection for inflation of the collapsed structure after catheterization. Sagittal (C) and transverse (D) CT images show the anomalous structure with contrast medium pooling. Connectivity of the tissue between the anomalous structure and the urethra can be observed, although the connectivity of the lumen cannot be clearly detected. A suspected site of adhesion (white arrow) can be observed between the cranial aspect (white arrow) of the anomalous structure and the UB. The arrowhead indicates the CB. UC, urethral catheter; P, pubis; R, rectum Retrograde urethrography was performed under fluoroscopic guidance using 1 mL/kg iohexol (Omnihexol 300, Korea United Pharm Inc, Seoul, South Korea), as shown in Figure 4A and Supporting Information Video S1. The dog was awake during the procedure. The urethral catheter was positioned in the distal urethra and contrast medium was injected. The study showed reflux of contrast media into the remnant uterus and vagina from the proximal urethra.
Figure 4

Retrograde urethrographic images (A, B) obtained in the awake condition and the gross appearance (C, D) of the urogenital anomalies in a dog. A, Before surgery, contrast medium reflux into the UB and anomalous structure through the suspected anomalous communication between the proximal urethra and uterus and vagina (white arrow) can be observed. B, One day after surgery, minimal reflux of contrast medium into the anomalous structure can be seen. C, Before removal of the anomalous structure, it (asterisk) is connected to the proximal urethra (black arrow), with a suspected anomalous communication between the urethra and uterus and vagina (white arrow). The cranial aspect (white long arrow) of the structure is adherent to the dorsal position of the UB. D, Ligation and transection of the structure (asterisk) immediately cranial to the suspected anomalous communication between the urethra and uterus and vagina (white arrow) is performed. The black linear structures in (C and D) are stay sutures. E, Histopathological examination of the resected structure has stratified columnar epithelium (black arrow head), connective tissues (white arrow head), and smooth muscle layers (black long arrow). UB, urinary bladder; U, urethra

Retrograde urethrographic images (A, B) obtained in the awake condition and the gross appearance (C, D) of the urogenital anomalies in a dog. A, Before surgery, contrast medium reflux into the UB and anomalous structure through the suspected anomalous communication between the proximal urethra and uterus and vagina (white arrow) can be observed. B, One day after surgery, minimal reflux of contrast medium into the anomalous structure can be seen. C, Before removal of the anomalous structure, it (asterisk) is connected to the proximal urethra (black arrow), with a suspected anomalous communication between the urethra and uterus and vagina (white arrow). The cranial aspect (white long arrow) of the structure is adherent to the dorsal position of the UB. D, Ligation and transection of the structure (asterisk) immediately cranial to the suspected anomalous communication between the urethra and uterus and vagina (white arrow) is performed. The black linear structures in (C and D) are stay sutures. E, Histopathological examination of the resected structure has stratified columnar epithelium (black arrow head), connective tissues (white arrow head), and smooth muscle layers (black long arrow). UB, urinary bladder; U, urethra Computed tomography (CT) was performed using a 4‐multidetector‐row system (LightSpeed, GE Medical Systems, Milwaukee, Wisconsin). The imaging parameters were as follows: 120 kVp; 200 mAs; matrix size, 512 × 512; rotation time, 0.6 seconds; and, slice thickness, 1.25 mm. Plain CT images were obtained first, after which iohexol (800 mg iodine/kg) was manually injected into the cephalic vein. Then, postcontrast images were acquired with a 60‐seconds delay. Images were acquired without elimination of the contrast medium from the lower urinary tract to confirm its structure (Figure 3C,D). All acquired images were uploaded to the GE workstation and reviewed by 2 radiologists (H. Yoon and J. Kim). The CT images showed a tubular structure with pooling of iohexol between the rectum and urethra. The tubular structure was interpreted to be the anomalous structure suspected to be the remnant uterus and cranial vagina visualized on ultrasonography and fluoroscopy. A parenchymal connection between this structure and the urethra was suspected. The CB in the enlarged clitoris was identified. Blood samples were collected from the cephalic vein for karyotyping and SRY gene sequencing. Twenty metaphase cells were obtained from peripheral blood lymphocyte cultures using Giemsa staining, as described in a previous study.1 A normal female karyotype (2n = 78, XX) was identified in the metaphase of all of these cells. The canine SRY coding region (GenBank AF107021)2 was amplified using forward (5′‐3′: ATCACAGCACCAGAGTCTAG) and reverse (5′‐3′: GCGTTGGAAACTTGCTTAACA) primers. The polymerase chain reaction products then were compared with those from normal male and female Beagle dogs. The SRY gene with approximately 900 base pairs was identified in a normal male dog, but was not detected in the female Beagle or the subject of this report. The genetic disorder in this dog was determined to be XX sex reversal based on the presence of XX sex chromosomes without the SRY gene, hypoplastic testes without spermatozoa, a uterus, and ambiguous external genitalia. Although both clitoridectomy and removal of the anomalous structure to prevent urine reflux were required, the dog's owner only wished to resolve the problem of the external genitalia that made contact with the ground when the dog sat down. Accordingly, clitoridectomy was performed and the CB was excised. However, the urinary incontinence persisted, and eventually, laparotomy for removal of the anomalous structure was performed at 3 weeks after gonadohysterectomy. Anesthesia was induced and maintained with IV propofol (Anepol, Hana Pharma, Hwasung, South Korea; 6 mg/kg) and inhaled 1.5% isoflurane (Foran solution, Choongwae Pharma, Seoul, South Korea), respectively. A urethral catheter (All Silicone Foley Catheter, Yushin Medical Co, Ltd, Bucheon, South Korea) was placed in the UB and urethra just before surgery. Laparotomy was performed, and the anomalous structure suspected to a remnant uterus and cranial vagina was identified in the region dorsal to the proximal urethra. It was carefully retracted in the cranial and lateral direction without pubic osteotomy (Figure 4C). The cranial part of the anomalous structure was adhered to the dorsal part of the bladder, whereas the caudal part was connected to the proximal urethra. The structure was ligated and cut at the level immediately cranial to the anomalous communication between the urethra and uterus and vagina, located dorsal to the proximal urethra (Figure 4D). Some of the tissue from the structure adherent to the UB was not completely removed, because complete removal could have resulted in a UB tear or injury. Minimal reflux of contrast medium into the anomalous structure was observed on retrograde urethrography performed 1 day after surgery (Figure 4B). The urethral catheter was replaced, and continuous drainage was maintained for 7 days. Histopathological examination of the anomalous structure showed stratified columnar epithelium, connective tissue, and smooth muscle (Figure 4E), which would be consistent with a cervix. The dog was closely monitored for remnant pyometra or persistent urinary incontinence and infection, but no such abnormalities were identified. No infectious organisms were identified in bacterial and fungal cultures of a urine sample obtained using ultrasound‐guided cystocentesis 2 months after surgery. The dog has had no episodes of urinary incontinence in the 7 months since treatment. The final diagnosis was XX sex reversal with developmental anomalies of the genitourinary tract.

DISCUSSION

XX sex reversal is a DSD with discordance between the XX karyotype, the gonad, and genital phenotypes.3 Six dogs with DSD, urogenital anomalies and urinary incontinence have reported previously.4, 5, 6, 7, 8 One dog had bilateral uterine horn insertion directly into the bladder,6 2 exhibited a vestibule and an abnormal communication between the vagina and urethra,4, 8 and 3 exhibited a narrow distal vestibule with abnormal communication between the vestibule and perineal region.5, 7 Five cases5, 6, 7, 8 were identified as female with ovaries and 1 case4 was a neutered female. All 6 cases had an ambiguous phenotype. Urinary incontinence has been associated with DSD9 and congenital adrenal hyperplasia in children,10 primarily in those with ambiguous female external genitalia.11 Various urinary tract anomalies, including agenesis of the urethra and unilateral kidney12 or bladder and vagina,13 rectovaginal communication,4 and hydrocolpos,14 ectopic ureters,15 and urethral ectopia with anomalous cervix16 also can accompany anomalies of the urogenital sinus, regardless of karyotype, gonadal type, or phenotype of internal or external genitalia. However, to our knowledge, ours is the first report to describe physical, imaging, surgical, histopathological, and genotypic findings in a dog with XX sex reversal and urinary incontinence caused by anomalous communication between the proximal urethra and the uterus and cranial vagina. In the normal female embryo, the cranial portion of the paramesonephric (Müllerian) ducts gives rise to the uterine tubes, whereas the caudal portion forms the horns and body of the uterus.17 The metanephric duct, which is derived from a ureteric bud of the distal mesonephric duct, forms the ureter.18 The mesonephric duct undergoes degeneration, and the cranial portion of the urogenital sinus gives rise to the primordium of the bladder and vesicourethral canal, whereas the caudal portion forms the urethra and vestibule. The vaginal plate develops from the Müllerian tubercle of the urogenital sinus, and fuses with the ends of the paramesonephric ducts to give rise to the vagina (Figure 5A).17
Figure 5

Schematic representation of urogenital development in a normal female dog and a dog with urogenital anomalies. A, A normal female dog. These schematic images have been recreated from the chapter on female reproductive system development in Veterinary Embryology.17 B, A dog with urogenital anomalies in this study. Abnormal fusion between the proximal urethra and uterus and vagina can be observed

Schematic representation of urogenital development in a normal female dog and a dog with urogenital anomalies. A, A normal female dog. These schematic images have been recreated from the chapter on female reproductive system development in Veterinary Embryology.17 B, A dog with urogenital anomalies in this study. Abnormal fusion between the proximal urethra and uterus and vagina can be observed XX sex reversal associated with the SXR gene has been reported most frequently in American Cocker Spaniels.19 In this case, XX sex reversal resulted in formation of the testes from the urogenital ridge. Androgen secretion by the abnormal testes presumably resulted in masculinization of the external genitalia, with development of an enlarged (phallic) clitoris, a CB, and a long penile urethra with an external urethral orifice in the clitoris. Insulin‐like peptide 3 and its receptor, and calcitonin‐gene‐related peptide regulate intra‐abdominal testicular descent.20 Although the regulatory pathways were not evaluated in this case, defects might exist in the pathways. In addition, because of androgen secretion and deficiency of Müllerian inhibiting substance (MIS), the dog's anomalous internal genitalia arose from both the mesonephric (epididymis, deferent duct) and paramesonephric (uterus, cranial vagina) ducts.20, 21 A urethrovaginal communication also can occur as a sequela of surgery, trauma, or the presence of a foreign body.22 Differentiation between congenital and acquired urethrovaginal communications requires careful history taking and identification of chronic inflammation, foreign bodies, and the location and morphology of the fistula via imaging modalities such as ultrasonography, retrograde urethrography, CT, vaginoscopy, and urethrocystoscopy.22 In particular, urethrocystoscopy and vaginoscopy provide excellent visualization for identification of lower urinary tract disease.15, 23 Although urethrocystoscopy and vaginoscopy were not performed in this dog, the studies performed provided adequate information about urinary incontinence and the congenital anomalies present. The exposed clitoris, which contained the external urethral orifice and urine pooling in the anomalous structure, presumably, contributed to urinary tract infection and urinary incontinence. Pollakiuria was resolved after antibiotic treatment and clitoridectomy. Urinary incontinence was resolved after the remnant uterus and vagina was excised.

CONFLICT OF INTEREST DECLARATION

The authors declare that they have no conflict of interest with the contents of article.

OFF‐LABEL ANTIMICROBIAL DECLARATION

Authors declare no off‐label use of antimicrobials.

INSTITUTIONAL ANIMAL CARE AND USE COMMITTEE (IACUC) OR OTHER APPROVAL DECLARATION

Authors declare no IACUC or other approval was needed. Additional Supporting Information may be found online in the supporting information tab for this article. Supporting Information Click here for additional data file.
  19 in total

1.  Vestibular, vaginal, and urethral relations in spayed dogs with and without lower urinary tract signs.

Authors:  Kelly Y Wang; Valerie F Samii; Dennis J Chew; Mary A McLoughlin; Stephen P DiBartola; Jerome Masty; Amy M Lehman
Journal:  J Vet Intern Med       Date:  2006 Sep-Oct       Impact factor: 3.333

2.  Urinary incontinence due to multiple urogenital anomalies in a mature dog.

Authors:  A Schwartz; A J Lipowitz; J Burt
Journal:  J Am Vet Med Assoc       Date:  1974-05-15       Impact factor: 1.936

3.  Surgical treatment of urinary incontinence resulting from a complex congenital abnormality in two dogs.

Authors:  S P Gregory; N D Trower
Journal:  J Small Anim Pract       Date:  1997-01       Impact factor: 1.522

4.  Successful bladder management for a pure urogenital sinus anomaly.

Authors:  Takeya Kitta; Hidehiro Kakizaki; Daiki Iwami; Katutoshi Tanda
Journal:  Int J Urol       Date:  2004-05       Impact factor: 3.369

5.  Inherited XX sex reversal in the cocker spaniel dog.

Authors:  J R Selden; P S Moorhead; G C Koo; S S Wachtel; M E Haskins; D F Patterson
Journal:  Hum Genet       Date:  1984       Impact factor: 4.132

6.  Digital fluoroscopic excretory urography, digital fluoroscopic urethrography, helical computed tomography, and cystoscopy in 24 dogs with suspected ureteral ectopia.

Authors:  Valerie F Samii; Mary A McLoughlin; John S Mattoon; Wm Tod Drost; Dennis J Chew; Stephen P DiBartola; Stacy Hoshaw-Woodard
Journal:  J Vet Intern Med       Date:  2004 May-Jun       Impact factor: 3.333

7.  Nonneurogenic urinary incontinence in a canine female pseudohermaphrodite.

Authors:  D A Jackson; C A Osborne; T H Brasmer; C R Jessen
Journal:  J Am Vet Med Assoc       Date:  1978-04-15       Impact factor: 1.936

8.  An unusual case of urinary incontinence in an intersex West Highland white terrier.

Authors:  Neil A Connery; Tim Spotswood
Journal:  Can Vet J       Date:  2012-11       Impact factor: 1.008

9.  Sry-negative XX sex reversal in purebred dogs.

Authors:  V N Meyers-Wallen; D Schlafer; I Barr; R Lovell-Badge; A Keyzner
Journal:  Mol Reprod Dev       Date:  1999-07       Impact factor: 2.609

10.  Sox9 duplications are a relevant cause of Sry-negative XX sex reversal dogs.

Authors:  Elena Rossi; Orietta Radi; Lisa De Lorenzi; Annalisa Vetro; Debora Groppetti; Enrico Bigliardi; Gaia Cecilia Luvoni; Ada Rota; Giovanna Camerino; Orsetta Zuffardi; Pietro Parma
Journal:  PLoS One       Date:  2014-07-10       Impact factor: 3.240

View more
  3 in total

1.  Urogenital anomalies and urinary incontinence in an English Cocker Spaniel dog with XX sex reversal.

Authors:  Hakyoung Yoon; Sung-Hee Han; Jaehwan Kim; Kihoon Kim; Kidong Eom
Journal:  J Vet Intern Med       Date:  2018-03-23       Impact factor: 3.333

2.  Urinary incontinence secondary to a suspected congenital urethral deformity in a kitten.

Authors:  Perrine Henry; Luca Schiavo; Laura Owen; Katie E McCallum
Journal:  JFMS Open Rep       Date:  2021-09-29

3.  Clitoral cyst in a bitch.

Authors:  Canny Fung; Jennifer M Ortolani; Marc J Greenberg
Journal:  Clin Case Rep       Date:  2019-10-23
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.