Kali Esancy1,2, Logan Condon1, Jing Feng3, Corinna Kimball1, Andrew Curtright1, Ajay Dhaka1,2. 1. Department of Biological Structure, University of Washington, Seattle, United States. 2. Graduate Program in Neuroscience, University of Washington, Seattle, United States. 3. Center for the Study of Itch, Washington University, St. Louis, United States.
Abstract
Little is known about the capacity of lower vertebrates to experience itch. A screen of itch-inducing compounds (pruritogens) in zebrafish larvae yielded a single pruritogen, the TLR7 agonist imiquimod, that elicited a somatosensory neuron response. Imiquimod induced itch-like behaviors in zebrafish distinct from those induced by the noxious TRPA1 agonist, allyl isothiocyanate. In the zebrafish, imiquimod-evoked somatosensory neuronal responses and behaviors were entirely dependent upon TRPA1, while in the mouse TRPA1 was required for the direct activation of somatosensory neurons and partially responsible for behaviors elicited by this pruritogen. Imiquimod was found to be a direct but weak TRPA1 agonist that activated a subset of TRPA1 expressing neurons. Imiquimod-responsive TRPA1 expressing neurons were significantly more sensitive to noxious stimuli than other TRPA1 expressing neurons. Together, these results suggest a model for selective itch via activation of a specialized subpopulation of somatosensory neurons with a heightened sensitivity to noxious stimuli.
Little is known about the capacity of lower vertebrates to experience itch. A screen of itch-inducing compounds (pruritogens) in zebrafishlarvae yielded a single pruritogen, the TLR7 agonist imiquimod, that elicited a somatosensory neuron response. Imiquimod induced itch-like behaviors in zebrafish distinct from those induced by the noxious TRPA1 agonist, allyl isothiocyanate. In the zebrafish, imiquimod-evoked somatosensory neuronal responses and behaviors were entirely dependent upon TRPA1, while in the mouseTRPA1 was required for the direct activation of somatosensory neurons and partially responsible for behaviors elicited by this pruritogen. Imiquimod was found to be a direct but weak TRPA1 agonist that activated a subset of TRPA1 expressing neurons. Imiquimod-responsive TRPA1 expressing neurons were significantly more sensitive to noxious stimuli than other TRPA1 expressing neurons. Together, these results suggest a model for selective itch via activation of a specialized subpopulation of somatosensory neurons with a heightened sensitivity to noxious stimuli.
Itch is an unpleasant sensation that elicits a scratch behavior in terrestrial vertebrates. In mammals, chemically-induced itch is thought to be mediated by pruritic receptors on somatosensory neurons (Bautista et al., 2014; Hoon, 2015). These receptors are typically G-protein coupled receptors (GPCRs) that, upon activation, prompt the opening of downstream transient receptor potential (TRP) channels, facilitating activation of the neuron (Ross, 2011; Zhang, 2015). This coupling of pruritic receptors to TRPA1 or TRPV1 is especially intriguing in that these TRP channels also serve as nociceptors, mediating responses to algogenic (painful) stimuli (Laing and Dhaka, 2016; Ikoma et al., 2006).Zebrafish (Danio rerio) have proven to be a valuable tool in the study of nociception (Gau et al., 2013). The zebrafish ortholog of Trpa1, trpa1b, is required for nociceptive responses to aversive pungent chemicals (Prober et al., 2008). Orthologs of genes involved in mammalianitch transduction are also present in the zebrafish (Kaslin and Panula, 2001; Pei et al., 2016; Xu et al., 2011). Studying how these itch genes operate in the somatosensory system of zebrafish could reveal conserved itch transduction mechanisms, providing insight into the evolution of itch.
Results
Imiquimod evokes itch in zebrafish
In an effort to determine if pruritic stimuli are capable of eliciting somatosensory activity in zebrafish, we screened five compounds known to both induce acute pruritus in mammals and act on receptors expressed by zebrafish (Schön and Schön, 2007; Bell et al., 2004; Lieu et al., 2014; Yamaguchi et al., 1999; Tsujii et al., 2009), excluding pruritogens that act on receptors that do not have a zebrafish ortholog, such as MRGPR agonists. Allyl isothiocyanate (AITC), a known algogen and TRPA1 agonist (Prober et al., 2008; Jordt et al., 2004), was used as the positive control. We evaluated somatosensory neuronal responses to pruritic compounds using transgenic larvae that pan-neuronally express the neuronal activity indicator CaMPARI (elavl3:CaMPARI), a fluorescent protein that permanently photoconverts from green to red in the presence of calcium and 405 nm light (Fosque et al., 2015). Using this approach, we were able to view trigeminal neuronal activity in 3 day post fertilization (dpf) larval zebrafish following the application of each pruritogen (Figure 1A–H). Of the pruritogens screened, only imiquimod (IMQ) significantly (p<0.05) activated zebrafish trigeminal ganglia (TG) neurons (Figure 1I).
Figure 1.
Imiquimod produces behavioral and neuronal responses in the zebrafish.
(A–H) 3dpf live elavl3:CaMPARI TG imaging of larvae exposed to 405 nm light and control (A), 50 μM allyl isothiocyanate (AITC) (B), 100 μM imiquimod (IMQ) (C), 100 μM histamine (HIST) (D), 500 μM serotonin (5-HT) (E), 100 μM SLIGRL-NH2 (F), 100 μM deoxycholic acid (DCA) (G), and 100 μM loxoribine (LOX) solutions (H). (I), Counts of photoconverted cells from experiments (A-H). (J), 5dpf WT larval locomotor behavior screen. (K) Representative traces of adult behavior. (L) Adult lip-rubbing behavioral assay. (I, J, L) ***p<0.001, **p<0.01, one-way ANOVA. Bars represent mean ± s.e.m.
(A) Dose-response curve for IMQ in larval locomotion assay, n = 48 for all conditions. (B) Average velocity of adult zebrafish injected with AITC or known pruritogens. 10 μM AITC induced a significant decrease in swimming velocity, whereas 100 μM IMQ elicited increased velocity. (C) Quantification of freezing behavior in the adult behavioral assay. Of the stimuli tested, only 10 μM AITC elicited significant freezing behaviors in adult zebrafish, although fish injected with 200 μM IMQ displayed a trend towards elevated freezing behaviors. (D) A comparison of lip-rubbing behavior in adult zebrafish injected with 10 μM AITC, 100 μM IMQ, and 100 μM loxoribine. Only IMQ evoked significant lip-rubbing behavior. ***p<0.001, **p<0.01, one-way ANOVA.
Imiquimod produces behavioral and neuronal responses in the zebrafish.
(A–H) 3dpf live elavl3:CaMPARI TG imaging of larvae exposed to 405 nm light and control (A), 50 μM allyl isothiocyanate (AITC) (B), 100 μM imiquimod (IMQ) (C), 100 μM histamine (HIST) (D), 500 μM serotonin (5-HT) (E), 100 μM SLIGRL-NH2 (F), 100 μM deoxycholic acid (DCA) (G), and 100 μM loxoribine (LOX) solutions (H). (I), Counts of photoconverted cells from experiments (A-H). (J), 5dpf WT larval locomotor behavior screen. (K) Representative traces of adult behavior. (L) Adult lip-rubbing behavioral assay. (I, J, L) ***p<0.001, **p<0.01, one-way ANOVA. Bars represent mean ± s.e.m.
Behavioral effects of noxious pruritic and algogenic stimuli in the zebrafish.
(A) Dose-response curve for IMQ in larval locomotion assay, n = 48 for all conditions. (B) Average velocity of adult zebrafish injected with AITC or known pruritogens. 10 μM AITC induced a significant decrease in swimming velocity, whereas 100 μM IMQ elicited increased velocity. (C) Quantification of freezing behavior in the adult behavioral assay. Of the stimuli tested, only 10 μM AITC elicited significant freezing behaviors in adult zebrafish, although fish injected with 200 μM IMQ displayed a trend towards elevated freezing behaviors. (D) A comparison of lip-rubbing behavior in adult zebrafish injected with 10 μM AITC, 100 μM IMQ, and 100 μM loxoribine. Only IMQ evoked significant lip-rubbing behavior. ***p<0.001, **p<0.01, one-way ANOVA.
Normal adult zebrafish swimming behavior.
This video is an example of typical swimming behavior following a cutaneous injection of 1% DMSO into the upper lip of an adult zebrafish. Note that the zebrafish exhibits minimal interaction with the walls of the tank, and its swimming capacity is not compromised.
Adult zebrafish injected with AITC demonstrate nocifensive behaviors.
This video is an example of typical swimming behavior following a cutaneous injection of 10 µM AITC into the upper lip of an adult zebrafish. The zebrafish exhibits previously described nocifensive behaviors, such as dramatically reduced locomotion, bouts of freezing, and heightened respiration.
Adult zebrafish injected with IMQ demonstrate pruritic behaviors.
This video provides a typical example of swimming behavior observed in adult zebrafish following a cutaneous upper lip injection of 100 µM IMQ. The fish not only exhibits increased swimming velocity in response to this stimulus, but also frequently rubs its lips against the walls of its tank, engaging in a behavior that is potentially analogous to mammalian scratching.We have previously reported that noxious stimuli evoke locomotion in larval zebrafish (Gau et al., 2013). When 5dpf larval zebrafish were exposed to individual pruritogens, only IMQ elevated baseline locomotion (p<0.001), producing a dose dependent increase (Figure 1—figure supplement 1A). When coupled with our findings in CaMPARI transgenics, these results indicate that IMQ likely acts through somatosensory neurons to evoke behavioral responses. While 5-HT did produce a reduction in locomotion, it did not activate somatosensory neurons (Figure 1I,J). Given the limited sensitivity of the locomotor assay we were unable to differentiate nocifensive behavior elicited by AITC from potentially pruritic behavior elicited by IMQ. To address this issue, we employed an adult zebrafish behavioral assay (Correia et al., 2011; Maximino, 2011). Injection of IMQ into the lip elicited a lip-rubbing behavior that may constitute a form of itch-scratch response in zebrafish, a behavior that was absent in sham-injected control fish (p<0.001) (Figure 1K,L; Videos 1—3) and distinct from previously described zebrafish nocifensive, escape, or exploratory behaviors (Colwill and Creton, 2011; Egan et al., 2009; Levin et al., 2007). Consistent with studies of nocifensive behaviors, injection of AITC produced freezing behavior (p<0.01) (Figure 1—figure supplement 1C) as well as a significant decrease (p<0.05) in velocity not observed in control or IMQ injected fish (Figure 1—figure supplement 1B). Such distinct behavioral responses imply that zebrafish are capable of experiencing, and responding differentially to, discrete stimuli analogous to itch and pain in mammals.
Figure 1—figure supplement 1.
Behavioral effects of noxious pruritic and algogenic stimuli in the zebrafish.
(A) Dose-response curve for IMQ in larval locomotion assay, n = 48 for all conditions. (B) Average velocity of adult zebrafish injected with AITC or known pruritogens. 10 μM AITC induced a significant decrease in swimming velocity, whereas 100 μM IMQ elicited increased velocity. (C) Quantification of freezing behavior in the adult behavioral assay. Of the stimuli tested, only 10 μM AITC elicited significant freezing behaviors in adult zebrafish, although fish injected with 200 μM IMQ displayed a trend towards elevated freezing behaviors. (D) A comparison of lip-rubbing behavior in adult zebrafish injected with 10 μM AITC, 100 μM IMQ, and 100 μM loxoribine. Only IMQ evoked significant lip-rubbing behavior. ***p<0.001, **p<0.01, one-way ANOVA.
Video 1.
Normal adult zebrafish swimming behavior.
This video is an example of typical swimming behavior following a cutaneous injection of 1% DMSO into the upper lip of an adult zebrafish. Note that the zebrafish exhibits minimal interaction with the walls of the tank, and its swimming capacity is not compromised.
Trpa1b, but not tlr7, is required for both neuronal and behavioral responses to imiquimod
The mechanism by which IMQ elicits itch in mammals is unclear. IMQ, a treatment for various skin disorders, acts through TLR7 to stimulate an immune response, with intense itching and painful burning commonly reported as side effects (Chang et al., 2005; Lebwohl et al., 2004). In mice, however, IMQ is reported to be itch selective, and only elicits scratching, but not nociceptive, behaviors (Liu et al., 2010; Kim et al., 2011). Furthermore, there is dispute surrounding TLR7’s role in IMQ-induced itch. One study found that Tlr7mice showed deficits in IMQ evoked itch and proposed that Tlr7 expressed in dorsal root ganglion (DRG) neurons was mediating IMQ transduction (Liu et al., 2010). TLR7 has also been reported to couple with TRPA1 in DRG neurons to evoke nociception in response to other TLR7 agonists (Park et al., 2014). However, conflicting studies found that Tlr7mice exhibited no deficits in IMQ-evoked itch, and RNAseq analysis of DRG neurons found no evidence for Tlr7 expression (Kim et al., 2011; Usoskin et al., 2015; Li et al., 2016). We therefore investigated whether TLR7 and/or TRPA1 were involved in transducing the neural and behavioral responses to IMQ in zebrafish.In situ hybridization studies in zebrafishlarvae revealed that tlr7 mRNA expression is restricted to known hematopoietic regions in larval zebrafish (Bresciani, 2014; Du et al., 2011), and was notably absent in both TG and Rohon-Beard (RB) neurons (Figure 2A; Figure 2—figure supplement 1I). As expected, trpa1b expression was observed in both TG and RB neurons (Figure 2B; Figure 2—figure supplement 1C). Therefore, any role TLR7 could play in IMQ-evoked behavior would be via indirect mechanisms.
Figure 2.
Trpa1b, but not Tlr7, is required for both neuronal and behavioral responses to IMQ.
(A, B) In situ hybridization in 3dpf WT larvae probing for tlr7 and trpa1b mRNA respectively. (C, D) Larval locomotor assay of 5dpf tlr7 and tlr7 (C) or trpa1band trpa1b (D) larvae. (E, F) Adult lip-rubbing behavioral assay of tlr7 (E) and trpa1b(F) fish. (C), (D), (E), (F), 100 μM IMQ used. ***p<0.001, **p<0.01, Student’s t-test. Bars represent mean ± s.e.m. (G, H) Representative calcium imaging traces of 3dpf trpa1b (G) and trpa1b (H) larvae in a transgenic elavl3HuC:GCaMP5 background exposed to 100 μM IMQ, 50 μM AITC, and 1 mM 2-APB. B = blood, TG = trigeminal ganglion.
(A) The 7 bp deletion in the trpa1b coding sequence generated a premature stop codon at 1412 bp. (B) Amino acid sequences of the WT and mutant Trpa1b proteins. (C) In situ hybridization probing for trpa1b mRNA in WT 3dpf larval zebrafish, demonstrating expression in RB neurons. (D) Schematic of the Trpa1b protein structure, demonstrating that a truncated protein (in the unlikely event that it was translated) would lack a critical cysteine residue required for agonist binding (Macpherson et al., 2007). (E) Trpa1b nonsense mutants locomoted more in response to increasing temperatures at levels equivalent to their WT/heterozygous siblings. (F) Normal AITC behavioral responses (increased locomotion) are abolished in trpa1b nonsense mutants. (G) The 1 bp deletion in the tlr7 coding sequence generated a premature stop codon at bp 665. (H) Amino acid sequences of WT and mutant Tlr7 proteins. (I) Schematic of the Tlr7 protein, demonstrating that a truncated protein (in the unlikely event of translation) would lack critical functional domains. (J) In situ hybridization probing for tlr7 mRNA in WT 3dpf larval zebrafish. No tlr7 expression was observed in RB somatosensory neurons. Premature stops are denoted with red highlighting. EC = extracellular, IC = intracellular, TM = transmembrane domain, LRR = leucine rich repeat, TIR = Toll Interleukin-1 Resistance domain. C and N denote c- and n-termini. (E), Student’s t-test.
Figure 2—figure supplement 1.
TRPA1b and TLR7 nonsense mutations in the zebrafish.
(A) The 7 bp deletion in the trpa1b coding sequence generated a premature stop codon at 1412 bp. (B) Amino acid sequences of the WT and mutant Trpa1b proteins. (C) In situ hybridization probing for trpa1b mRNA in WT 3dpf larval zebrafish, demonstrating expression in RB neurons. (D) Schematic of the Trpa1b protein structure, demonstrating that a truncated protein (in the unlikely event that it was translated) would lack a critical cysteine residue required for agonist binding (Macpherson et al., 2007). (E) Trpa1b nonsense mutants locomoted more in response to increasing temperatures at levels equivalent to their WT/heterozygous siblings. (F) Normal AITC behavioral responses (increased locomotion) are abolished in trpa1b nonsense mutants. (G) The 1 bp deletion in the tlr7 coding sequence generated a premature stop codon at bp 665. (H) Amino acid sequences of WT and mutant Tlr7 proteins. (I) Schematic of the Tlr7 protein, demonstrating that a truncated protein (in the unlikely event of translation) would lack critical functional domains. (J) In situ hybridization probing for tlr7 mRNA in WT 3dpf larval zebrafish. No tlr7 expression was observed in RB somatosensory neurons. Premature stops are denoted with red highlighting. EC = extracellular, IC = intracellular, TM = transmembrane domain, LRR = leucine rich repeat, TIR = Toll Interleukin-1 Resistance domain. C and N denote c- and n-termini. (E), Student’s t-test.
Trpa1b, but not Tlr7, is required for both neuronal and behavioral responses to IMQ.
(A, B) In situ hybridization in 3dpf WT larvae probing for tlr7 and trpa1b mRNA respectively. (C, D) Larval locomotor assay of 5dpf tlr7 and tlr7 (C) or trpa1band trpa1b (D) larvae. (E, F) Adult lip-rubbing behavioral assay of tlr7 (E) and trpa1b(F) fish. (C), (D), (E), (F), 100 μM IMQ used. ***p<0.001, **p<0.01, Student’s t-test. Bars represent mean ± s.e.m. (G, H) Representative calcium imaging traces of 3dpf trpa1b (G) and trpa1b (H) larvae in a transgenic elavl3HuC:GCaMP5 background exposed to 100 μM IMQ, 50 μM AITC, and 1 mM 2-APB. B = blood, TG = trigeminal ganglion.
TRPA1b and TLR7 nonsense mutations in the zebrafish.
(A) The 7 bp deletion in the trpa1b coding sequence generated a premature stop codon at 1412 bp. (B) Amino acid sequences of the WT and mutant Trpa1b proteins. (C) In situ hybridization probing for trpa1b mRNA in WT 3dpf larval zebrafish, demonstrating expression in RB neurons. (D) Schematic of the Trpa1b protein structure, demonstrating that a truncated protein (in the unlikely event that it was translated) would lack a critical cysteine residue required for agonist binding (Macpherson et al., 2007). (E) Trpa1b nonsense mutants locomoted more in response to increasing temperatures at levels equivalent to their WT/heterozygous siblings. (F) Normal AITC behavioral responses (increased locomotion) are abolished in trpa1b nonsense mutants. (G) The 1 bp deletion in the tlr7 coding sequence generated a premature stop codon at bp 665. (H) Amino acid sequences of WT and mutant Tlr7 proteins. (I) Schematic of the Tlr7 protein, demonstrating that a truncated protein (in the unlikely event of translation) would lack critical functional domains. (J) In situ hybridization probing for tlr7 mRNA in WT 3dpf larval zebrafish. No tlr7 expression was observed in RB somatosensory neurons. Premature stops are denoted with red highlighting. EC = extracellular, IC = intracellular, TM = transmembrane domain, LRR = leucine rich repeat, TIR = Toll Interleukin-1 Resistance domain. C and N denote c- and n-termini. (E), Student’s t-test.To determine if trpa1b and/or tlr7 are required for IMQ induced behaviors, we introduced early nonsense mutations in the coding sequences of both genes (Kimura et al., 2014). Tlr7zebrafishlarvae exhibited a significant (p<0.001) increase in total locomotion when exposed to IMQ (100 µM) that was indistinguishable from controls (Figure 2C). However, trpa1blarvae demonstrated no response to IMQ (100 µM), while their WT siblings displayed normal IMQ induced behaviors (p<0.01, Figure 2D). These data support a mechanism where trpa1b, but not tlr7, is necessary for mediating behavioral responses to IMQ in larval zebrafish. As expected based on previous reports, behavioral responses to AITC were absent in trpa1b fish (Figure 2—figure supplement 1F) (Prober et al., 2008). Notably, trpa1b fish demonstrated an equivalent increase in locomotor behavior as their WT siblings when exposed to increased temperatures (Figure 2—figure supplement 1E). This indicates that the trpa1b mutation specifically affects Trpa1b-mediated sensations, rather than causing generalized sensory impairment.To test whether the presence of Trpa1b was necessary to mediate neuronal responses in larval zebrafish TG, we conducted in vivo calcium imaging using elavl3:GCaMP5g larvae (Akerboom et al., 2012) (Figure 2G). In WT larvae, IMQ activation was seen exclusively in a subset of AITC responsive neurons (4/36, n = 5 larvae). Trpa1b fish, however, exhibited no response to either IMQ or AITC (0/89 total neurons, n = 5 larvae) (Figure 2H).Notably, the highly specific TLR7 agonist loxoribine did not evoke TG neuron activation, larval locomotion, or adult lip-rubbing behavior, further strengthening the finding that Tlr7 does not play a role in IMQ evoked behaviors in zebrafish (Figure 1I,J; Figure 1—figure supplement 1D). This finding is similar to reports in the mouse demonstrating that loxoribine does not elicit pruritic behavioral responses (Kim et al., 2011).
Imiquimod directly activates TRPA1
To determine if TRPA1 directly interacts with IMQ to produce itch, we utilized the TLR7-deficient cell line HEK293T (Hornung et al., 2005). HEK cells transfected with zebrafish, mouse, and humanTrpa1 showed a dose-dependent increase in intracellular calcium following application of IMQ and AITC that was not observed in HEK cells alone (Figure 3A–F; Figure 3—figure supplement 1A,C). Importantly, we found that loxoribine did not activate HEK cells transfected with zebrafish or mouseTrpa1 (Figure 3—figure supplement 2A–D), indicating that TRPA1 is responsive to IMQ, and not to TLR7 agonists in general.
Figure 3.
Imiquimod directly activates TRPA1.
(A–C) Calcium imaging of HEK cells transfected with zebrafish (A), mouse (B), and human (C) Trpa1 or Trpa1 + Tlr7. (D, E, F) Calcium imaging dose response curves of HEK cells transfected with zebrafish (D), mouse (E), and human (F) Trpa1, exposed to IMQ or AITC. (A–F) Numbers represent total cell counts per condition. (G) Patch clamp of HEK cell transfected with zebrafish trpa1b exposed to 100 μM IMQ. (H) Patch clamp dose response curve for HEK cells transfected with zebrafish trpa1b, mouse Trpa1, or mouse Trpa1 + mouse Tlr7. (I) Current density values of HEK cells exposed transfected with zebrafish trpa1b or mouse Trpa1 and exposed to 100 μM AITC or 100 μM IMQ. (G–I) n = 5 cells per condition. **p<0.01, Student’s t-test. Bars represent mean ± s.e.m.
(A–D) Average traces from calcium imaging experiments with HEK cells transiently transfected with zebrafish trpa1b (n = 85) (A), zebrafish trpa1b + zebrafish tlr7 (n = 80) (B), mouse Trpa1 (n = 134) (C), or mouse Trpa1+ mouse Tlr7 (n = 89) (D). n = 22, 23, 10, and 19 untransfected control HEK cells per experiment, respectively. No gross differences were observed between the two conditions for each species. (E) Quantification of peak fluorescence intensity achieved during stimulation with 100 μM IMQ across all HEK cell transfection conditions. In all species examined, no significant difference was observed between cells transfected with only Trpa1 and cells transfected with Trpa1 plus the corresponding Tlr7. (F–H), Immunohistochemistry performed on HEK cells transfected with pIRES-eGFP only (F), mouse Tlr7 (G), or human TLR7 (H). As shown, TLR7 labeling (red) was only observed HEK cells transfected with Tlr7 constructs. (I–J), I/V curves from voltage clamp experiments using cells transfected with mTRPA1 (I) and mouse Trpa1 + mouse Tlr7 (J). As shown in (I), 100 μM IMQ elicited greater current influx in transfected cells than under basal conditions, an effect that disappeared during washout. Cells transfected with both mouse Trpa1 and mouse Tlr7 also showed significant current flux during IMQ stimulus, but this was not different from cells transfected only with mTRPA1. n = 5 cells per condition. (K) a table of EC50 values for both IMQ and AITC stimuli in cells transfected with zebrafish trpa1b, mouse Trpa1, and human TRPA1 in Figure 3D–F. As shown, the EC50 values for IMQ are much greater than those of AITC for all species of TRPA1. ΔF/F (fluorescence intensity change) is expressed as a normalized 340 nm/380 nm intensity ratio. (*p<0.05, **p<0.01, ***p<0.001, Student’s t-test. Bars are expressed as means ± s.e.m.
(A) A comparison of average peak fluorescence values obtained from Trpa1 or Trpa1 + Tlr7 transfected HEK cells in calcium imaging experiments following stimulation by 100 μM IMQ or 100 μM loxoribine. (B, C) Average traces from calcium experiments in which HEK cells were transfected with zebrafish trpa1b + zebrafish tlr7 (n = 102) (B) or mouse Trpa1 + mouse Tlr7 (n = 45) (C) and treated with 100 μM loxoribine and 100 μM AITC. 15 and 21 untransfected control cells were present in each respective experiment. As shown, loxoribine did not elicit any calcium flux. (D) I/V curve from voltage clamp experiments in which HEK cells were transfected with mouse Trpa1 + mouse Tlr7 and stimulated with both loxoribine (100 μM) and AITC (100 μM). While AITC elicited remarkable current influx, current change associated with application of loxoribine did not change current flow above baseline levels. (E) A dual luciferase assay to verify the functionality of transfected TLR7 and loxoribine. Cells transfected with only the two luciferase constructs and pIRES-eGFP did not demonstrate any NF-kB induction following stimulation with 200 μM loxoribine, as expected. Notable NF-kB induction was observed in cells transfected with the two luciferase constructs and either mouse Tlr7 or human TLR7 following stimulation with loxoribine. Intriguingly, cells transfected with the zebrafish tlr7 did not exhibit any significant NF-kB induction following application of loxoribine. (F) A dual luciferase assay in which both pIRES-eGFP-transfected control HEK cells and zebrafish tlr7-transfected cells were treated with TLR7 agonists loxoribine (500 μM and 1 mM) and IMQ (100 μM and 500 μM). There was no difference in NF-kB induction between pIRES-eGFP-only and zebrafish tlr7-transfected cells, potentially indicating that zebrafish Tlr7 is unresponsive to typical mammalian TLR7 agonists. ΔF/F (fluorescence intensity change) is expressed as a normalized 340 nm/380 nm intensity ratio. Luminosity values are expressed as the firefly/renilla ratio of relative light units in counts per second (CPS) following background subtraction. *p<0.05, **p<0.01, ***p<0.001, Student’s t-test (A, E) or one-way ANOVA (F). Bars are expressed as means ± s.e.m.
Figure 3—figure supplement 1.
Transfected HEK cell gene expression and functionality.
(A–D) Average traces from calcium imaging experiments with HEK cells transiently transfected with zebrafish trpa1b (n = 85) (A), zebrafish trpa1b + zebrafish tlr7 (n = 80) (B), mouse Trpa1 (n = 134) (C), or mouse Trpa1+ mouse Tlr7 (n = 89) (D). n = 22, 23, 10, and 19 untransfected control HEK cells per experiment, respectively. No gross differences were observed between the two conditions for each species. (E) Quantification of peak fluorescence intensity achieved during stimulation with 100 μM IMQ across all HEK cell transfection conditions. In all species examined, no significant difference was observed between cells transfected with only Trpa1 and cells transfected with Trpa1 plus the corresponding Tlr7. (F–H), Immunohistochemistry performed on HEK cells transfected with pIRES-eGFP only (F), mouse Tlr7 (G), or human TLR7 (H). As shown, TLR7 labeling (red) was only observed HEK cells transfected with Tlr7 constructs. (I–J), I/V curves from voltage clamp experiments using cells transfected with mTRPA1 (I) and mouse Trpa1 + mouse Tlr7 (J). As shown in (I), 100 μM IMQ elicited greater current influx in transfected cells than under basal conditions, an effect that disappeared during washout. Cells transfected with both mouse Trpa1 and mouse Tlr7 also showed significant current flux during IMQ stimulus, but this was not different from cells transfected only with mTRPA1. n = 5 cells per condition. (K) a table of EC50 values for both IMQ and AITC stimuli in cells transfected with zebrafish trpa1b, mouse Trpa1, and human TRPA1 in Figure 3D–F. As shown, the EC50 values for IMQ are much greater than those of AITC for all species of TRPA1. ΔF/F (fluorescence intensity change) is expressed as a normalized 340 nm/380 nm intensity ratio. (*p<0.05, **p<0.01, ***p<0.001, Student’s t-test. Bars are expressed as means ± s.e.m.
Figure 3—figure supplement 2.
Loxoribine effectively stimulates Tlr7-transfected HEK cells but does not evoke intracellular calcium flux.
(A) A comparison of average peak fluorescence values obtained from Trpa1 or Trpa1 + Tlr7 transfected HEK cells in calcium imaging experiments following stimulation by 100 μM IMQ or 100 μM loxoribine. (B, C) Average traces from calcium experiments in which HEK cells were transfected with zebrafish trpa1b + zebrafish tlr7 (n = 102) (B) or mouse Trpa1 + mouse Tlr7 (n = 45) (C) and treated with 100 μM loxoribine and 100 μM AITC. 15 and 21 untransfected control cells were present in each respective experiment. As shown, loxoribine did not elicit any calcium flux. (D) I/V curve from voltage clamp experiments in which HEK cells were transfected with mouse Trpa1 + mouse Tlr7 and stimulated with both loxoribine (100 μM) and AITC (100 μM). While AITC elicited remarkable current influx, current change associated with application of loxoribine did not change current flow above baseline levels. (E) A dual luciferase assay to verify the functionality of transfected TLR7 and loxoribine. Cells transfected with only the two luciferase constructs and pIRES-eGFP did not demonstrate any NF-kB induction following stimulation with 200 μM loxoribine, as expected. Notable NF-kB induction was observed in cells transfected with the two luciferase constructs and either mouse Tlr7 or human TLR7 following stimulation with loxoribine. Intriguingly, cells transfected with the zebrafish tlr7 did not exhibit any significant NF-kB induction following application of loxoribine. (F) A dual luciferase assay in which both pIRES-eGFP-transfected control HEK cells and zebrafish tlr7-transfected cells were treated with TLR7 agonists loxoribine (500 μM and 1 mM) and IMQ (100 μM and 500 μM). There was no difference in NF-kB induction between pIRES-eGFP-only and zebrafish tlr7-transfected cells, potentially indicating that zebrafish Tlr7 is unresponsive to typical mammalian TLR7 agonists. ΔF/F (fluorescence intensity change) is expressed as a normalized 340 nm/380 nm intensity ratio. Luminosity values are expressed as the firefly/renilla ratio of relative light units in counts per second (CPS) following background subtraction. *p<0.05, **p<0.01, ***p<0.001, Student’s t-test (A, E) or one-way ANOVA (F). Bars are expressed as means ± s.e.m.
Imiquimod directly activates TRPA1.
(A–C) Calcium imaging of HEK cells transfected with zebrafish (A), mouse (B), and human (C) Trpa1 or Trpa1 + Tlr7. (D, E, F) Calcium imaging dose response curves of HEK cells transfected with zebrafish (D), mouse (E), and human (F) Trpa1, exposed to IMQ or AITC. (A–F) Numbers represent total cell counts per condition. (G) Patch clamp of HEK cell transfected with zebrafishtrpa1b exposed to 100 μM IMQ. (H) Patch clamp dose response curve for HEK cells transfected with zebrafishtrpa1b, mouseTrpa1, or mouseTrpa1 + mouseTlr7. (I) Current density values of HEK cells exposed transfected with zebrafishtrpa1b or mouseTrpa1 and exposed to 100 μM AITC or 100 μM IMQ. (G–I) n = 5 cells per condition. **p<0.01, Student’s t-test. Bars represent mean ± s.e.m.
Transfected HEK cell gene expression and functionality.
(A–D) Average traces from calcium imaging experiments with HEK cells transiently transfected with zebrafishtrpa1b (n = 85) (A), zebrafishtrpa1b + zebrafishtlr7 (n = 80) (B), mouseTrpa1 (n = 134) (C), or mouseTrpa1+ mouseTlr7 (n = 89) (D). n = 22, 23, 10, and 19 untransfected control HEK cells per experiment, respectively. No gross differences were observed between the two conditions for each species. (E) Quantification of peak fluorescence intensity achieved during stimulation with 100 μM IMQ across all HEK cell transfection conditions. In all species examined, no significant difference was observed between cells transfected with only Trpa1 and cells transfected with Trpa1 plus the corresponding Tlr7. (F–H), Immunohistochemistry performed on HEK cells transfected with pIRES-eGFP only (F), mouseTlr7 (G), or humanTLR7 (H). As shown, TLR7 labeling (red) was only observed HEK cells transfected with Tlr7 constructs. (I–J), I/V curves from voltage clamp experiments using cells transfected with mTRPA1 (I) and mouseTrpa1 + mouseTlr7 (J). As shown in (I), 100 μM IMQ elicited greater current influx in transfected cells than under basal conditions, an effect that disappeared during washout. Cells transfected with both mouseTrpa1 and mouseTlr7 also showed significant current flux during IMQ stimulus, but this was not different from cells transfected only with mTRPA1. n = 5 cells per condition. (K) a table of EC50 values for both IMQ and AITC stimuli in cells transfected with zebrafishtrpa1b, mouseTrpa1, and humanTRPA1 in Figure 3D–F. As shown, the EC50 values for IMQ are much greater than those of AITC for all species of TRPA1. ΔF/F (fluorescence intensity change) is expressed as a normalized 340 nm/380 nm intensity ratio. (*p<0.05, **p<0.01, ***p<0.001, Student’s t-test. Bars are expressed as means ± s.e.m.
Loxoribine effectively stimulates Tlr7-transfected HEK cells but does not evoke intracellular calcium flux.
(A) A comparison of average peak fluorescence values obtained from Trpa1 or Trpa1 + Tlr7 transfected HEK cells in calcium imaging experiments following stimulation by 100 μM IMQ or 100 μM loxoribine. (B, C) Average traces from calcium experiments in which HEK cells were transfected with zebrafishtrpa1b + zebrafishtlr7 (n = 102) (B) or mouseTrpa1 + mouseTlr7 (n = 45) (C) and treated with 100 μM loxoribine and 100 μM AITC. 15 and 21 untransfected control cells were present in each respective experiment. As shown, loxoribine did not elicit any calcium flux. (D) I/V curve from voltage clamp experiments in which HEK cells were transfected with mouseTrpa1 + mouseTlr7 and stimulated with both loxoribine (100 μM) and AITC (100 μM). While AITC elicited remarkable current influx, current change associated with application of loxoribine did not change current flow above baseline levels. (E) A dual luciferase assay to verify the functionality of transfected TLR7 and loxoribine. Cells transfected with only the two luciferase constructs and pIRES-eGFP did not demonstrate any NF-kB induction following stimulation with 200 μM loxoribine, as expected. Notable NF-kB induction was observed in cells transfected with the two luciferase constructs and either mouseTlr7 or humanTLR7 following stimulation with loxoribine. Intriguingly, cells transfected with the zebrafishtlr7 did not exhibit any significant NF-kB induction following application of loxoribine. (F) A dual luciferase assay in which both pIRES-eGFP-transfected control HEK cells and zebrafishtlr7-transfected cells were treated with TLR7 agonists loxoribine (500 μM and 1 mM) and IMQ (100 μM and 500 μM). There was no difference in NF-kB induction between pIRES-eGFP-only and zebrafishtlr7-transfected cells, potentially indicating that zebrafishTlr7 is unresponsive to typical mammalianTLR7 agonists. ΔF/F (fluorescence intensity change) is expressed as a normalized 340 nm/380 nm intensity ratio. Luminosity values are expressed as the firefly/renilla ratio of relative light units in counts per second (CPS) following background subtraction. *p<0.05, **p<0.01, ***p<0.001, Student’s t-test (A, E) or one-way ANOVA (F). Bars are expressed as means ± s.e.m.While we observed no expression of tlr7 in the zebrafish TG (Figure 2A), given the lack of consensus over its functional role we sought to determine whether TLR7 might serve as a pruritic co-receptor that potentiates the TRPA1 response. We co-transfected HEK cells with Trpa1 and Tlr7 and examined the calcium responses following treatment with IMQ and observed no discernible differences in the average peak responses to IMQ between Trpa1 and Trpa1 + Tlr7 conditions (Figure 3A–C, Figure 3—figure supplement 1C). Whole cell electrophysiological experiments corroborated these findings. When stimulated with IMQ, voltage-clamped HEK cells transfected with mouse or zebrafishTrpa1 demonstrated a significant increase in current (Figure 3G; Figure 3—figure supplement 1G). Co-transfecting mouseTlr7 with mouseTrpa1 in HEK cells had no demonstrable effect on current influx (Figure 3—figure supplement 1H). Additionally, no difference was found in the IMQ current density dose-response curves for cells transfected with zebrafishtrpa1b, mouseTrpa1, or mouseTrpa1 + mouseTlr7 (Figure 3H). In contrast to previous reports, we found no evidence that TLR7 coupled with TRPA1 in the presence of loxoribine as measured by ratiometric calcium imaging and whole cell electrophysiology in mouse and zebrafish (Figure 3—figure supplement 2A–D) (Liu et al., 2010). Together, our data suggest that TLR7 plays no role in the direct activation of somatosensory neurons, and does not appear to potentiate the response of TRPA1 to IMQ.Following these results, we confirmed that mouse and humanTLR7 were present and functional in our assays (Figure 3—figure supplement 1I–K) (Mitchell and Sugden, 1995). Intriguingly, zebrafishTlr7 did not respond to either IMQ or loxoribine in a dual-luciferase assay, suggesting that zebrafishTlr7 is not activated by mammalianTLR7 agonists (Figure 3—figure supplement 2E). However, due to a lack of a Tlr7 positive control, we were unable to confirm that Tlr7 was functional in our heterologous expression system. With this caveat in mind, the lack of zebrafishTlr7 response to these TLR7 agonists lends further credence to the conclusion that Tlr7 is not involved in somatosensory neuronal activation or behavior in this species.If TRPA1 does not couple with TLR7, but is instead directly activated by both IMQ and AITC, how could IMQ be itch-selective in the mouse? To address this question we assessed the EC50 and peak responses to IMQ and AITC in HEK cells transfected with Trpa1 from different species. The EC50 of IMQ for zebrafish, mouse and humanTRPA1 was consistently higher than the AITC EC50, demonstrating that IMQ is a weaker agonist than AITC (Figure 3—figure supplement 1K). Notably, while the IMQ EC50 of zebrafishTrpa1 and humanTRPA1 were only 2–3 fold greater than that of the EC50 of AITC, mouseTRPA1 demonstrated a ~40 fold difference between the EC50 of AITC and IMQ. Furthermore, only mouseTRPA1 elicited significantly lower maximum responses to IMQ than AITC (Figure 3D–F). In similar electrophysiology experiments, HEK cells transfected with zebrafishtrpa1b exhibited identical current density responses upon stimulation with the maximum dose of either AITC or IMQ, but cells transfected with mouseTrpa1 exhibited significantly higher current density responses following stimulation with AITC, relative to IMQ (Figure 3I). Such physiological differences in TRPA1 function between species could provide a potential mechanism for the itch selectivity of IMQ in mice, implying that IMQ is not a strong enough mouseTRPA1 agonist to elicit nociception in this species. Conversely, the ability of both zebrafish and humanTRPA1 to respond equally to AITC and IMQ at maximal doses potentially explains how IMQ can elicit both itch and pain sensations in humans, and suggests that the same may be observable in fish.
Imiquimod responsive neurons are a primed subpopulation of TRPA1-expressing neurons
In the preceding in vivo calcium imaging experiments, we observed that only a small proportion of zebrafishTrpa1+ neurons, identified by their responsiveness to AITC, were also responsive to the IMQ stimulus. To further explore this result, we used elval3:H2BGCaMP6 (Chen et al., 2013) transgenic zebrafish to record the response properties of larval TG neurons to IMQ and AITC. No IMQ+/AITC- neurons were found across 13 larvae. Among AITC+ neurons, 28% (31/111) were responsive to IMQ (Figure 4A–C).
Figure 4.
Imiquimod responsive cells are a primed subpopulation of TRPA1 positive cells and stimulus intensity affects behavioral and neuronal responses.
(A, B) Representative traces from calcium imaging experiments in 3dpf elavl3:H2BGCaMP6 zebrafish exposed to 100 μM IMQ and 50 μM AITC. An IMQ+/AITC+ TG neuron is shown in (A), while an AITC+ only neuron is shown in (B). (C) Quantification of neuronal subtypes within AITC+ neurons. n = 31 IMQ+/AITC+ neurons, n = 80 AITC+ only neurons. (D) Comparison of the maximum ΔF/F during the 50 μM AITC stimulus between neuronal subtypes. (E) Number of photoconverted neurons in 3dpf elavl3:CaMPARI zebrafish TG following stimulation with TRPA1 agonists. (F) Quantification of lip-rubbing behavior in adult zebrafish following exposure to TRPA1 agonists. Bars represent means ± s.e.m. *p<0.05, **p<0.01, ***p<0.001, Student’s t-test (D), one-way ANOVA (E, F).
(A) IMQ is a lower intensity stimulus than AITC. Application of 100 μM IMQ elicited a lower maximal ΔF/F response than application of 50 μM AITC in IMQ+/AITC+ TG neurons in 3dpf larval zebrafish. (B) In an effort to ensure that our analyses in Figure 4D were accurate reflections of neuronal activity, we also examined the average ΔF/F across the stimulus period. We found that IMQ+/AITC+ cells exhibited a significantly higher average fluorescence change across the entire 50 μM AITC stimulus period than AITC + only responding neurons. (C) Sequential application of 100 μM IMQ, 10 μM AITC, and 50 μM AITC revealed that IMQ+ neurons (n = 4) were only found in a subset of neurons that responded to 10 μM AITC (n = 11), which themselves were included in a larger population of 50 μM AITC+ neurons (n = 42). 50 μM AITC results were consistent with previous experiments. (D) Swimming velocity in adult zebrafish also varied as a function of stimulus intensity. Fish that were injected with 100 μM IMQ (n = 13) exhibited a significant increase in swimming velocity as compared to fish injected with 1% DMSO vehicle (n = 11). Fish injected with 10 μM AITC (n = 15) and 200 μM IMQ (n = 6) exhibited significant reductions in swimming velocity as compared to vehicle-injected controls, suggesting that these stimuli at these particular concentrations are effectually algogenic. 5 μM AITC evoked no significant change in swimming velocity (n = 12). ΔF/F (fluorescence intensity change) is calculated as the percent change over baseline fluorescence. Bars are expressed as means ± s.e.m. *p<0.05, **p<0.01, ***p<0.001, Student’s t-test (A, B), one-way ANOVA (D). (E) Representative traces of adult behavior.
(A) Proportions of neurons responding to two sequential pulses of 100 µM IMQ, only the first pulse, or only the second pulse in 3dpf larval zebrafish. (B) Representative trace of a TG neuron that responded to both pulses of 100 µM IMQ. (C) Representative trace of a TG neuron that responded to only the second pulse of 100 µM IMQ.
Imiquimod responsive cells are a primed subpopulation of TRPA1 positive cells and stimulus intensity affects behavioral and neuronal responses.
(A, B) Representative traces from calcium imaging experiments in 3dpf elavl3:H2BGCaMP6 zebrafish exposed to 100 μM IMQ and 50 μM AITC. An IMQ+/AITC+ TG neuron is shown in (A), while an AITC+ only neuron is shown in (B). (C) Quantification of neuronal subtypes within AITC+ neurons. n = 31 IMQ+/AITC+ neurons, n = 80 AITC+ only neurons. (D) Comparison of the maximum ΔF/F during the 50 μM AITC stimulus between neuronal subtypes. (E) Number of photoconverted neurons in 3dpf elavl3:CaMPARIzebrafish TG following stimulation with TRPA1 agonists. (F) Quantification of lip-rubbing behavior in adult zebrafish following exposure to TRPA1 agonists. Bars represent means ± s.e.m. *p<0.05, **p<0.01, ***p<0.001, Student’s t-test (D), one-way ANOVA (E, F).
Further effects of stimulus intensity on zebrafish neuronal activity and behavior.
(A) IMQ is a lower intensity stimulus than AITC. Application of 100 μM IMQ elicited a lower maximal ΔF/F response than application of 50 μM AITC in IMQ+/AITC+ TG neurons in 3dpf larval zebrafish. (B) In an effort to ensure that our analyses in Figure 4D were accurate reflections of neuronal activity, we also examined the average ΔF/F across the stimulus period. We found that IMQ+/AITC+ cells exhibited a significantly higher average fluorescence change across the entire 50 μM AITC stimulus period than AITC + only responding neurons. (C) Sequential application of 100 μM IMQ, 10 μM AITC, and 50 μM AITC revealed that IMQ+ neurons (n = 4) were only found in a subset of neurons that responded to 10 μM AITC (n = 11), which themselves were included in a larger population of 50 μM AITC+ neurons (n = 42). 50 μM AITC results were consistent with previous experiments. (D) Swimming velocity in adult zebrafish also varied as a function of stimulus intensity. Fish that were injected with 100 μM IMQ (n = 13) exhibited a significant increase in swimming velocity as compared to fish injected with 1% DMSO vehicle (n = 11). Fish injected with 10 μM AITC (n = 15) and 200 μM IMQ (n = 6) exhibited significant reductions in swimming velocity as compared to vehicle-injected controls, suggesting that these stimuli at these particular concentrations are effectually algogenic. 5 μM AITC evoked no significant change in swimming velocity (n = 12). ΔF/F (fluorescence intensity change) is calculated as the percent change over baseline fluorescence. Bars are expressed as means ± s.e.m. *p<0.05, **p<0.01, ***p<0.001, Student’s t-test (A, B), one-way ANOVA (D). (E) Representative traces of adult behavior.
Imiquimod activates a specific subset of neurons in a non-stochastic manner in the zebrafish.
(A) Proportions of neurons responding to two sequential pulses of 100 µM IMQ, only the first pulse, or only the second pulse in 3dpf larval zebrafish. (B) Representative trace of a TG neuron that responded to both pulses of 100 µM IMQ. (C) Representative trace of a TG neuron that responded to only the second pulse of 100 µM IMQ.The above data affirms that IMQ+ neurons are a subset within a larger population of Trpa1+ TG neurons, implying that a population coding strategy for pruritus might be at play. This does not itself answer the question of how such an itch-selective Trpa1+ subpopulation might be activated by a TRPA1 agonist without recruiting other Trpa1+ neurons that may code for nociceptive behaviors. Based on our finding that IMQ is a weaker TRPA1 agonist than AITC, one potential explanation is that such an itch-selective Trpa1+ population is more sensitive to TRPA1 agonists, and can be activated by weaker (pruritic) stimuli. In IMQ+/AITC+ neurons, we determined that the average maximum fluorescence intensity response to the IMQ stimulus was significantly lower than that of the AITC stimulus (p<0.001), implying that at the concentrations used, IMQ is indeed a weaker TRPA1 stimulus than AITC in vivo (Figure 3—figure supplement 2A). Furthermore, we found that the maximum AITC response of IMQ+/AITC+ neurons was significantly greater than that of AITC+ only neurons (Figure 4D). Likewise, IMQ+/AITC+ neurons displayed a significantly greater average AITC response than AITC+ only neurons (p<0.05, Figure 4—figure supplement 1B).
Figure 4—figure supplement 1.
Further effects of stimulus intensity on zebrafish neuronal activity and behavior.
(A) IMQ is a lower intensity stimulus than AITC. Application of 100 μM IMQ elicited a lower maximal ΔF/F response than application of 50 μM AITC in IMQ+/AITC+ TG neurons in 3dpf larval zebrafish. (B) In an effort to ensure that our analyses in Figure 4D were accurate reflections of neuronal activity, we also examined the average ΔF/F across the stimulus period. We found that IMQ+/AITC+ cells exhibited a significantly higher average fluorescence change across the entire 50 μM AITC stimulus period than AITC + only responding neurons. (C) Sequential application of 100 μM IMQ, 10 μM AITC, and 50 μM AITC revealed that IMQ+ neurons (n = 4) were only found in a subset of neurons that responded to 10 μM AITC (n = 11), which themselves were included in a larger population of 50 μM AITC+ neurons (n = 42). 50 μM AITC results were consistent with previous experiments. (D) Swimming velocity in adult zebrafish also varied as a function of stimulus intensity. Fish that were injected with 100 μM IMQ (n = 13) exhibited a significant increase in swimming velocity as compared to fish injected with 1% DMSO vehicle (n = 11). Fish injected with 10 μM AITC (n = 15) and 200 μM IMQ (n = 6) exhibited significant reductions in swimming velocity as compared to vehicle-injected controls, suggesting that these stimuli at these particular concentrations are effectually algogenic. 5 μM AITC evoked no significant change in swimming velocity (n = 12). ΔF/F (fluorescence intensity change) is calculated as the percent change over baseline fluorescence. Bars are expressed as means ± s.e.m. *p<0.05, **p<0.01, ***p<0.001, Student’s t-test (A, B), one-way ANOVA (D). (E) Representative traces of adult behavior.
These data suggest that IMQ+ TG neurons are primed to respond to TRPA1 agonists and support a model where relatively weak TRPA1 stimuli, such as IMQ at the concentration used, could selectively recruit a potential itch-coding subpopulation of Trpa1+ neurons. Higher intensity stimuli like AITC at the concentrations used, however, would activate the majority of Trpa1+ neurons to evoke nocifensive behaviors, positively correlating with findings that nociception takes precedence over itch sensation (Roberson et al., 2013; Ross et al., 2010; Liu et al., 2011).To verify that IMQ activates a selective subset of Trpa1+ neurons as opposed to activating Trpa1+ neurons stochastically, we performed calcium imaging experiments in which 3dpf elavl3:H2BGCaMP6 were exposed to successive pulses of 100 μM IMQ. Of the IMQ+ neurons we identified across five fish, 92.3% (12/13) responded to both pulses of IMQ, whereas only 7.7% (1/13) responded only to the second pulse of IMQ (Figure 4—figure supplement 2A–C). Additionally, it is possible the single neuron that responded only to the second pulse of IMQ may also be a dual-responder. While the GCaMP fluorescence change only crossed our response threshold during the second pulse, it is possible that the sloping baseline may have obscured a minimal response to the first pulse, especially considering the low amplitude of the second response. However, for purposes of completion we decided to include this trace in our final counts. Given the finding that only ~30% of AITC responsive neurons responded to one pulse of IMQ (100 μM), if one assumes that this is the probability that any given AITC responsive neuron would respond to IMQ (100 μM), and that responses to IMQ are stochastic in nature, one would expect only a small fraction of neurons to be double responders (~9%) (Figure 4D). The finding that nearly all IMQ-responsive neurons were dual responders argues that these neurons comprise a distinct population of Trpa1 expressing neurons, primed to respond to low intensity TRPA1 dependent stimuli.
Figure 4—figure supplement 2.
Imiquimod activates a specific subset of neurons in a non-stochastic manner in the zebrafish.
(A) Proportions of neurons responding to two sequential pulses of 100 µM IMQ, only the first pulse, or only the second pulse in 3dpf larval zebrafish. (B) Representative trace of a TG neuron that responded to both pulses of 100 µM IMQ. (C) Representative trace of a TG neuron that responded to only the second pulse of 100 µM IMQ.
Stimulus intensity affects behavioral and neuronal responses
Although the IMQ dose-response curve in zebrafishtrpa1b-transfected HEK cells was rightward shifted, it was eventually able to elicit the same amount of intracellular calcium flux that AITC evoked. This implies that at a sufficiently high concentration, IMQ might be able to recruit neurons outside of the IMQ+ subpopulation observed in the above larval calcium imaging experiments, thus eliciting neuronal and behavioral responses characteristic of AITC at nociceptive concentrations. Likewise, it is also possible that at low enough concentrations, AITC is capable of eliciting the pruritic neuronal and behavioral responses we observed following application of IMQ.In CaMPARI fish we observed that decreasing the concentration of applied AITC correlated with a reduction in the number of photoconverted neurons (Figure 4E). Additionally, administering higher IMQ concentrations converts an equivalent number of neurons as high concentrations of AITC (Figure 4E), suggesting that for TRPA1 agonists, eliciting pruritus or nociception is dependent more on stimulus intensity than identity.In vivo GCaMP imaging bolstered our CaMPARI findings that stimulus intensity affects which subpopulations of Trpa1+ neurons are activated. In these experiments, we observed that increasing the stimulus intensity activated more neurons. Only a subset of neurons that responded to a high concentration (50 μM) of AITC responded to a lower concentration (10 μM) of AITC (11/42), and of those even fewer neurons responded to 100 μM IMQ (4/11) (Figure 4—figure supplement 1C). Furthermore, increasing the IMQ concentration to 200 µM in adult behavioral experiments evoked nocifensive behaviors such as elevated freezing and significantly reduced velocity, and the itch-like lip rubbing behavior seen at 100 µM was notably absent (Maximino, 2011; Sneddon, 2009) (Figure 4F; Figure 1—figure supplement 1C, Figure 4—figure supplement 1D). Conversely, low concentrations of AITC (5 μM) elicited both itch-like lip rubbing behavior and increased velocity (Figure 4F; Figure 4—figure supplement 1C). These data indicate that the subpopulation of Trpa1+ neurons that drive itch behavior in the zebrafish are distinct in their sensitivity to TRPA1 agonists, but can be activated by either AITC or IMQ at the appropriate concentration to produce equivalent behaviors.
TRPA1 mediates itch behavior and neuronal responses in in the mouse
We found that IMQ elicited responses in 9.6% (83/864) of cultured AITC+ DRG neurons (Figure 5A) from WT animals. To determine if TRPA1 mediates IMQ responses in mice, we examined IMQ-evoked responses in DRG neurons from both WT and Trpa1 animals using ratiometric calcium imaging. We found that both IMQ and AITC responses were completely abolished in DRG neurons obtained from Trpa1 animals, while neurons from WT siblings exhibited normal responsivity to both stimuli (Figure 5B,C). Furthermore, application of loxoribine did not elicit calcium responses in mouse DRG neurons, providing evidence that TLR7 stimulation does not result in activation of somatosensory neurons (Figure 5—figure supplement 1H). We next explored whether IMQ-evoked scratching behavior was also dependent on TRPA1. High-dose IMQ (125 μg) paw injections did not evoke nocifensive behaviors in WT mice (n = 0/10 IMQ-injected), consistent with previous reports (Kim et al., 2011). However, scratching bouts at a low concentration of IMQ (10 μg, nape injected) were significantly attenuated in Trpa1mice, demonstrating that TRPA1 is required for normal IMQ-induced scratching behavior (Figure 5D). Interestingly, a higher dose of IMQ (50 μg) evoked equivalent scratching behavior in both WT and Trpa1mice (Figure 5—figure supplement 1G). This result, taken together with our finding that isolated mouse DRG neuron responses to IMQ are TRPA1-dependent, suggests that IMQ can also evoke itch via indirect activation of somatosensory neurons, perhaps downstream of an immune response (Bautista et al., 2014; Hoon, 2015).
Figure 5.
Imiquimod’s effects in the mouse.
(A) Proportions of IMQ+/AITC+ and AITC+ only DRG neurons observed in calcium imaging experiments (n = 83 IMQ+/AITC+ neurons, n = 781 AITC+ only DRG neurons). (B, C) Representative traces from calcium imaging experiments on dissociated mouse DRG neurons from WT (B) (n = 15 neurons) and Trpa1 (C) (n = 23 neurons) mice. (A–C), 100 μM IMQ and 100 μM AITC used. (D) Quantification of scratching bouts in WT and Trpa1 mice following IMQ (10 μg) injections. (E, F) Representative traces from calcium imaging experiments in which 100 μM IMQ, 100 μM CQ, 100 μM DC, and 100 μM AITC were applied. IMQ+/CQ+DCA+/AITC+ (e) and AITC+ only (f) neurons are shown. (G) Quantification of the IMQ+ neuronal populations from the experiments shown in (E, F) (n = 27 IMQ+/CQ+DCA+/AITC+ neurons, 7 IMQ+/AITC+ neurons). (H) Comparison of maximum ΔF/F between IMQ+/AITC+ and AITC+ only. 100 μM IMQ, 10 μM AITC used. All calcium imaging experiments performed on dissociated mouse DRG neurons. (I) Quantification of scratching bouts in WT mice following injections of varying AITC concentrations. *p<0.05, **p<0.01, ***p<0.001, Student’s t-test. Bars are expressed as mean + s.e.m.
(A, B) Representative traces from calcium imaging experiments featuring dissociated mouse DRG neurons sequentially bathed in 100 μM IMQ and 10 μM AITC. IMQ+/AITC+ (A) and AITC+ only (B) neurons were both identified. As shown in (B), many of the AITC+ only neurons peaked at lower ΔF/F values than the IMQ+/AITC+ neurons. (C) Within the IMQ+/AITC+ population (n = 37 neurons), 100 μM IMQ was demonstrated to be a weaker stimulus than 10 μM AITC. (D, E) Representative traces of calcium imaging experiments where DRG neurons were stimulated with 100 μM IMQ and 100 nM CAPS. Two main functional subpopulations were identified--one that responded to both IMQ and CAPS (D), and another that responded only to 100 nM CAPS (E). Interestingly, many of the CAPS+ only cells peaked at lower ΔF/F values during the CAPS stimulus than the neurons that responded to both IMQ and CAPS. (F) Comparison of maximum ΔF/F between IMQ+/CAPS+ and CAPS+ only neurons. (G) Quantification of scratching bouts in WT and Trpa1 mice following IMQ injections. (H) Representative traces from from one calcium imaging experiment in which 100 μM loxoribine was applied to dissociated DRG neurons. As shown, loxoribine did not elicit any fluorescence changes in DRG neurons (n = 51), whereas 100 μM IMQ and 100 μM AITC elicited robust intracellular calcium flux. (I) Increasing the concentration of AITC activates greater proportions of DRG neurons (71/752, 379/1107, and 864/1671 neurons for the 5 μM, 10 μM, and μM AITC experiments). (J) IMQ+ neuron populations are enriched within populations that respond to lower concentrations of AITC (26/71 5 μM AITC+ neurons, 37/220 10 μM AITC+ neurons, 83/864 100 μM AITC+ neurons). Fluorescence intensity is expressed as ΔF/F using the 340/380 ratio values. Bars represented as means + s.e.m., Student’s t-test. *p<0.05, **p<0.01, ***p<0.001.
Figure 5—figure supplement 1.
Calcium imaging of discrete neuronal subpopulations in the mouse.
(A, B) Representative traces from calcium imaging experiments featuring dissociated mouse DRG neurons sequentially bathed in 100 μM IMQ and 10 μM AITC. IMQ+/AITC+ (A) and AITC+ only (B) neurons were both identified. As shown in (B), many of the AITC+ only neurons peaked at lower ΔF/F values than the IMQ+/AITC+ neurons. (C) Within the IMQ+/AITC+ population (n = 37 neurons), 100 μM IMQ was demonstrated to be a weaker stimulus than 10 μM AITC. (D, E) Representative traces of calcium imaging experiments where DRG neurons were stimulated with 100 μM IMQ and 100 nM CAPS. Two main functional subpopulations were identified--one that responded to both IMQ and CAPS (D), and another that responded only to 100 nM CAPS (E). Interestingly, many of the CAPS+ only cells peaked at lower ΔF/F values during the CAPS stimulus than the neurons that responded to both IMQ and CAPS. (F) Comparison of maximum ΔF/F between IMQ+/CAPS+ and CAPS+ only neurons. (G) Quantification of scratching bouts in WT and Trpa1 mice following IMQ injections. (H) Representative traces from from one calcium imaging experiment in which 100 μM loxoribine was applied to dissociated DRG neurons. As shown, loxoribine did not elicit any fluorescence changes in DRG neurons (n = 51), whereas 100 μM IMQ and 100 μM AITC elicited robust intracellular calcium flux. (I) Increasing the concentration of AITC activates greater proportions of DRG neurons (71/752, 379/1107, and 864/1671 neurons for the 5 μM, 10 μM, and μM AITC experiments). (J) IMQ+ neuron populations are enriched within populations that respond to lower concentrations of AITC (26/71 5 μM AITC+ neurons, 37/220 10 μM AITC+ neurons, 83/864 100 μM AITC+ neurons). Fluorescence intensity is expressed as ΔF/F using the 340/380 ratio values. Bars represented as means + s.e.m., Student’s t-test. *p<0.05, **p<0.01, ***p<0.001.
Imiquimod’s effects in the mouse.
(A) Proportions of IMQ+/AITC+ and AITC+ only DRG neurons observed in calcium imaging experiments (n = 83 IMQ+/AITC+ neurons, n = 781 AITC+ only DRG neurons). (B, C) Representative traces from calcium imaging experiments on dissociated mouse DRG neurons from WT (B) (n = 15 neurons) and Trpa1 (C) (n = 23 neurons) mice. (A–C), 100 μM IMQ and 100 μM AITC used. (D) Quantification of scratching bouts in WT and Trpa1mice following IMQ (10 μg) injections. (E, F) Representative traces from calcium imaging experiments in which 100 μM IMQ, 100 μM CQ, 100 μM DC, and 100 μM AITC were applied. IMQ+/CQ+DCA+/AITC+ (e) and AITC+ only (f) neurons are shown. (G) Quantification of the IMQ+ neuronal populations from the experiments shown in (E, F) (n = 27 IMQ+/CQ+DCA+/AITC+ neurons, 7 IMQ+/AITC+ neurons). (H) Comparison of maximum ΔF/F between IMQ+/AITC+ and AITC+ only. 100 μM IMQ, 10 μM AITC used. All calcium imaging experiments performed on dissociated mouse DRG neurons. (I) Quantification of scratching bouts in WT mice following injections of varying AITC concentrations. *p<0.05, **p<0.01, ***p<0.001, Student’s t-test. Bars are expressed as mean + s.e.m.
Calcium imaging of discrete neuronal subpopulations in the mouse.
(A, B) Representative traces from calcium imaging experiments featuring dissociated mouse DRG neurons sequentially bathed in 100 μM IMQ and 10 μM AITC. IMQ+/AITC+ (A) and AITC+ only (B) neurons were both identified. As shown in (B), many of the AITC+ only neurons peaked at lower ΔF/F values than the IMQ+/AITC+ neurons. (C) Within the IMQ+/AITC+ population (n = 37 neurons), 100 μM IMQ was demonstrated to be a weaker stimulus than 10 μM AITC. (D, E) Representative traces of calcium imaging experiments where DRG neurons were stimulated with 100 μM IMQ and 100 nM CAPS. Two main functional subpopulations were identified--one that responded to both IMQ and CAPS (D), and another that responded only to 100 nM CAPS (E). Interestingly, many of the CAPS+ only cells peaked at lower ΔF/F values during the CAPS stimulus than the neurons that responded to both IMQ and CAPS. (F) Comparison of maximum ΔF/F between IMQ+/CAPS+ and CAPS+ only neurons. (G) Quantification of scratching bouts in WT and Trpa1mice following IMQ injections. (H) Representative traces from from one calcium imaging experiment in which 100 μM loxoribine was applied to dissociated DRG neurons. As shown, loxoribine did not elicit any fluorescence changes in DRG neurons (n = 51), whereas 100 μM IMQ and 100 μM AITC elicited robust intracellular calcium flux. (I) Increasing the concentration of AITC activates greater proportions of DRG neurons (71/752, 379/1107, and 864/1671 neurons for the 5 μM, 10 μM, and μM AITC experiments). (J) IMQ+ neuron populations are enriched within populations that respond to lower concentrations of AITC (26/71 5 μM AITC+ neurons, 37/220 10 μM AITC+ neurons, 83/864 100 μM AITC+ neurons). Fluorescence intensity is expressed as ΔF/F using the 340/380 ratio values. Bars represented as means + s.e.m., Student’s t-test. *p<0.05, **p<0.01, ***p<0.001.Given the itch selectivity of IMQ in the mouse, we sought to determine whether IMQ+ neurons were part of a population of DRG neurons that encode TRPA1-dependent pruritus. We therefore measured the overlap of IMQ+ neurons with DRG neurons that responded to a mixture of the TRPA1-dependent pruritogens deoxycholic acid (DC) and chloroquine (CQ) (Figure 5E–F) (Tsujii et al., 2009; Wilson et al., 2011; Liu et al., 2009). We found that the vast majority of IMQ+ neurons (73%, 23/30) also responded to these pruritic stimuli (Figure 5G), indicating that in the mouse, IMQ+ neurons belong to a subpopulation of itch-encoding neurons.Due to the parallels noted between zebrafish and mouseIMQ responses, we proceeded to investigate whether the correlation between stimulus intensity and neuronal activation that we observed in the zebrafish was conserved in the mouse. In the mouse, increasing the concentration of AITC activated more DRG neurons in a dose-dependent manner (Figure 5—figure supplement 1I). Furthermore, within the population of neurons that responded to lower concentrations of AITC, the IMQ+ subpopulation was enriched (Figure 5—figure supplement 1J). We also found that IMQ+ neurons in the mouse had a smaller peak responses to IMQ than AITC (Figure 5—figure supplement 1A–C). Additionally, AITC peak responses within the IMQ+ population were significantly greater than in the AITC+ only population (p<0.01), demonstrating that the heightened sensitivity of IMQ+ neurons to TRPA1 agonists is conserved in the mouse (Figure 5H). Subsequent experiments revealed that IMQ+ DRG neurons exhibited a significantly higher maximum response to the TRPV1 agonist capsaicin (CAPS) than CAPS+ only neurons (Figure 5—figure supplement 1D–F), implying that the IMQ+ neurons may be intrinsically more sensitive to noxious stimuli, not exclusively TRPA1 agonists. Finally, in accordance with our zebrafish data, we observed that AITC stimulus intensity dictates whether mice exhibit pruritic or nocifensive behaviors. In order to discriminate between nocifensive and pruritic behaviors, we employed a ‘cheek model of itch’ assay in which compounds injected into the cheek may elicit scratching (a pruritic response) or wiping (a nocifensive response) (Shimada and LaMotte, 2008; Akiyama et al., 2010). We observed that AITC (50 mM) produces significant scratching behavior with no appreciable wiping behavior (p<0.001 and N.S. respectively), while a higher dose of AITC (100 mM) results in a significant attenuation of the observed scratching behavior, as well as a significant wiping behavior (p<0.05 and p<0.001 respectively) (Figure 5I).
Discussion
The sense of itch in mammals has been thoroughly explored, but there is a dearth of knowledge on the presence of itch, and the neural mechanisms which transduce it, in lower vertebrates such as fish. Here, we use a popular model organism, the zebrafish, to demonstrate that fish are potentially capable of experiencing a form of rudimentary itch in response to the pruritogen IMQ, and suggest that this sensation is conveyed by the direct activation of TRPA1 on a specialized subset of somatosensory neurons highly sensitive to TRPA1 agonists.Through a combination of experimental procedures, we show that the pruritogen IMQ can elicit behavior and neuronal responses in zebrafish. In larvae, IMQ elicits an increase in locomotion and activation of somatosensory TG neurons, suggesting that the observed locomotor effects likely originate in the periphery, and are not due to the direct action of IMQ upon more central structures. Furthermore, in adult zebrafish, peripherally applied IMQ produces a scratching-analogous lip-rubbing behavioral response that is distinct from the nocifensive behaviors evoked by the algogen AITC as well as previously described escape behaviors (Correia et al., 2011; Maximino, 2011; Colwill and Creton, 2011; Egan et al., 2009; Levin et al., 2007). The fact that IMQ-evoked behavioral responses manifest as lip-rubbing, as opposed to nocifensive or escape behaviors, further suggests that these fish are indeed experiencing an itch-like sensation. For animals whose anatomy prohibits scratching behavior with claws, the use of another body part or an external object is perhaps the only recourse to address a pruritic stimulus. Such scratching behaviors have previously been documented in animals from a variety of taxa (Chevalier-Skolnikoff and Liska, 1993; Huber et al., 2008; Deecke, 2012; Green and Mattson, 2003; Delius, 1988).There is currently a lack of consensus in the literature as to how IMQ induces itch in mammals, although all studies show that TRPV1-expressing neurons are required (Liu et al., 2010; Kim et al., 2011). A major point of contention surrounds the involvement of the immune receptor TLR7, the therapeutic target of IMQ. Our work provides additional evidence that TLR7 is not involved in the direct activation of somatosensory neurons by IMQ (Kim et al., 2011; Usoskin et al., 2015; Li et al., 2016). Instead, the TRPA1 ion channel appears to play a key role in transducing IMQ-evoked neuronal effects and the behaviors that result from such neuronal activity. Unlike trpa1b, tlr7 is not expressed in zebrafish somatosensory tissue, as demonstrated by in situ hybridization. Moreover, zebrafish that lacked functional TLR7 behaved equivalently to wildtype animals in response to IMQ application. By contrast, behavioral and neuronal responses to IMQ in both fish and mice were largely dependent upon TRPA1. Utilizing both electrophysiology and calcium imaging, we showed that IMQ was able to directly activate TRPA1, and that co-transfection of Tlr7 did not potentiate IMQ-evoked responses. However, greater concentrations of IMQ were required to elicit the same levels of calcium flux that were evoked by lower concentrations of AITC, implying that IMQ is a weaker agonist than AITC in all species we examined. With zebrafish and humanTRPA1, IMQ eventually reached the same maximal calcium response levels as AITC, while IMQ responses with mouseTRPA1 plateaued at lower maximal levels than AITC. This suggests that in the mouse, IMQ is incapable of evoking the same intensity of neuronal responses as AITC can, even at high concentrations. Our findings may provide a molecular explanation for previously-documented observations that in the mouse, IMQ appears to be itch-selective, while in humans, IMQ has been reported to elicit sensations of both itch and pain (Chang et al., 2005; Lebwohl et al., 2004; Liu et al., 2010; Kim et al., 2011). Findings from these in vitro experiments may also underlie our own observations in both mice and adult zebrafish behavioral experiments. In the context of TRPA1 activation, stronger stimuli elicited nocifensive behaviors, whereas weaker stimuli evoked pruritic behaviors. Furthermore, the effects of stimulus intensity upon neuronal activation and behavior were largely but not entirely independent of stimulus identity. In adult zebrafish low concentrations of IMQ evoked pruritic behaviors while higher concentrations of IMQ were capable of eliciting nocifensive freezing behaviors. In line with previous reports, we were unable to elicit murine nocifensive behaviors with high concentrations of IMQ, which we hypothesize was due to the inability of IMQ to maximally activate mouseTRPA1 (Liu et al., 2010; Kim et al., 2011). In contrast, AITC evoked behaviors were not species dependent as predicted by the dose response curves of zebrafishTrpa1 and mouseTRPA1 to this agonist. Low concentrations of AITC produced scratching behaviors, while higher concentrations of AITC evoked nocifensive behaviors in both species. While the direct activation of a TRP channel to evoke itch by a pruritogen or algogen is somewhat surprising, as it deviates from canonical pathways requiring both pruritic GPCRs and TRP ion channels, such a mechanism supports observations of itch in both human and mouse studies following application of typically noxious TRP channel agonists (Akiyama et al., 2010; Højland et al., 2015; Sikand et al., 2009).Intriguingly, our observation that behaviors transitioned from a pruritic to a nocifensive phenotype as stimulus intensity increased was mirrored by our observations in calcium imaging studies. Experiments with two different calcium indicators of neuronal activity, GCaMP and CaMPARI, revealed a correlation between TRPA1 agonist stimulus intensity and neuronal recruitment. Specifically, stronger stimuli (high concentrations of TRPA1 agonists) activated more neurons than weaker stimuli (lower concentrations of TRPA1 agonists).Based on these findings we hypothesized that a population coding strategy was being employed. In our model, low intensity stimuli would selectively activate a subset of TRPA1-expressing neurons that encode pruriception, whereas higher intensity stimuli would activate another population of TRPA1-expressing neurons that encode nociception. This hypothesis would be in line with recent findings that pruriception is encoded by different populations of somatosensory neurons than those that encode nociception (Hoon, 2015; Roberson et al., 2013; Goswami et al., 2014). Calcium imaging of zebrafish and mouse somatosensory neurons revealed the existence of at least two functionally distinct neuronal subpopulations. In both species, we observed a population of neurons that responded to both low and high intensity TRPA1 agonists and another that only responded to high intensity TRPA1 agonists. Our observation that sequential pulses of IMQ (100 μM) activate the low intensity TRPA1 agonist responsive population in zebrafish demonstrates that this population is likely genetically defined, and not determined stochastically. Furthermore, in the mouse, we observed that the vast majority of IMQ (100 μM) responsive neurons also responded to the TRPA1-dependent pruritogens chloroquine and deoxycholic acid, supporting the conclusion that these neurons constitute a pruritic subpopulation. Unfortunately, equivalent experiments could not be performed in the zebrafish, as we were unable to identify other pruritogens for this species.In alignment with these results, in both species, neurons that responded to low intensity TRPA1 agonists also exhibited a greater response to high intensity AITC stimulation than neurons that only responded to high intensity AITC stimulation. This implies that putative itch-encoding neurons comprise a more sensitive subset of somatosensory neurons than nociceptive neurons. Additionally, in both species, IMQ (100 μM) responsive neurons were enriched within populations of neurons that responded to low concentrations of AITC; in other words, we observed a high degree of overlap in the populations of neurons that responded to low intensity TRPA1 agonists irrespective of stimulus identity. Together, this provides further evidence of the greater sensitivity of a population of itch-encoding neurons to TRPA1 agonists.Itch is a complex physiological phenomenon, and several models have been proposed to explain its transduction in the periphery and beyond (Bautista et al., 2014; Hoon, 2015; Ross, 2011; Ma, 2010; Schmelz, 2010; McMahon and Koltzenburg, 1992). Here, we describe a mechanism through which acute IMQ-evoked itch is mediated by the peripheral somatosensory neurons of two species. Weak stimuli such as lower concentrations of the TRPA1 agonists IMQ and AITC activate only a subset of highly sensitive pruriceptive TRPA1-expressing neurons, while the remaining nociceptive TRPA1-expressing neurons are only recruited by higher intensity TRPA1 stimuli. Our proposed model clearly is not the sole mechanism by which itch is coded as a distinct sensation from pain (Bautista et al., 2014; Hoon, 2015; Ross, 2011). However, in the context of pruritogens and algogens that are direct TPRA1 agonists, our findings overwhelmingly support a population-coding model for the discrimination of itch and pain.Our data implicates a mechanism for the direct activation of TRPA1 by IMQ to elicit sensations of itch in both zebrafish and mice. Our findings that IMQ-induced itch was attenuated, but not abolished, in Trpa1mice supports additional mechanisms for IMQ-evoked itch in this species. One may speculate that the activation of an immune response by IMQ in other cell types could result in a cascade of downstream signaling that could ultimately lead to a release of endogenous pruritic stimuli (e.g. histamine and serotonin from mast cells). In the zebrafish, TLR7 is unlikely to contribute even indirectly to IMQ-induced itch sensation, as we observed no behavioral phenotype in tlr7 animals. However, this does not rule out the possibility that pathogen exposure could stimulate the immune system via TLR activation or other pathways, leading to an indirect activation of pruritic somatosensory neurons and triggering both itch sensations and scratching behaviors. Several studies have implicated that Tlrs in several species of fish play a role in immunity (Meijer et al., 2004; Kanwal et al., 2014; Zhou and Sun, 2015; Tanekhy et al., 2010; Kileng et al., 2008; Yang et al., 2012). However, no study has explicitly queried potential connections between such immune responses and downstream neuronal activation or behavior in any fish species. While our results demonstrate that TLR7 is not involved in transducing IMQ-evoked itch in the zebrafish, investigating the role of immune responses in mediating somatosensations (both in zebrafish and other species) would be an interesting route for future exploration.It is plausible that an unknown receptor is activated by IMQ and couples with TRPA1 in vivo to evoke a somatosensory neuron response. Our TRPA1 mutant experiments would be unable to detect the existence of such a receptor, which would presumably not function to elicit neuronal activity in the absence of TRPA1. However, our in vitro experiments suggest that the existence of such an unknown receptor is unlikely, as it would also have to be endogenously expressed in HEK cells. Furthermore, the dose-dependent overlap we observed in the number of neurons that were responsive to IMQ and AITC, as well as similarities in the dose dependent itch and nociceptive behaviors elicited by these compounds in both zebrafish and mice, implies that these compounds are acting via the direct activation of TRPA1.We observed that out of several mammalian pruritogens, only IMQ elicited behavioral and neuronal responses in zebrafish. While we tested pruritogens that targeted mammalianpruritic receptors with a known zebrafish ortholog, it is possible that other stimuli we did not test may also evoke sensations of itch in these animals. It is likewise possible that histamine, serotonin, TGR5, and PAR-2 receptors do not function in the itch pathway as pruritic receptors on primary sensory neurons in zebrafish, as they do in mammals. For example, zebrafish have an extensive histaminergic system with multiple histamine receptors, but histamine receptor expression appears to be restricted to the central nervous system (Peitsaro et al., 2007). Furthermore, while zebrafish do possess mast cells (which in mammals release histamine and serotonin that act upon peripheral sensory neurons to elicit itch), studies indicate that these mast cells do not contain histamine or serotonin (Prykhozhij and Berman, 2014; Mulero et al., 2007). It is therefore plausible that in the zebrafish, histamine and serotonin do not play a functional role in pruritic sensation or immune responses, but are restricted to more central processes such as mediating sleep-wakefulness cycles, mood, and anxiety (Pei et al., 2016; Sackerman et al., 2010).The direct activation of a TRP channel to elicit itch or pain through the recruitment of distinct populations of somatosensory neurons via stimulus sensitivity is mechanistically simple. That such a mechanism is present in both zebrafish and mouse may imply that this particular form of itch transduction appeared before the emergence of terrestrial vertebrates, and may have been conserved throughout evolutionary history to persist in mammals. One could therefore postulate that this rudimentary form of itch potentially evolved from existing pain-transducing molecular and neural machinery as a means to differentiate high- and low-intensity noxious stimuli for which an alternative behavioral response was more appropriate. While data from only two species is not sufficient to declare that our proposed mechanism is evolutionarily conserved, we hope that our findings provide a springboard for future research into pruritus across multiple taxa, which would help elucidate the evolutionary development of this important sense.
Conclusion
Our work demonstrates that IMQ can directly activate TRPA1 to elicit pruritic behavioral responses in both the zebrafish and mouse. Furthermore, we have shown that the immune receptor TLR7 does not mediate somatosensory neuronal responses to IMQ. Our results imply that in both species a subset of highly sensitive TRPA1-expressing itch-encoding neurons can respond to weaker TRPA1 agonists to encode sensations of itch and elicit discrete itch behaviors. More intense stimuli, such as those that evoke nocifensive behaviors, appear to recruit this highly-sensitive subset as well as less-sensitive TRPA1-expressing neurons. Our finding that IMQ responsive neurons in the mouse are part of a TRPA1-expressing subpopulation that is activated by other TRPA1 dependent pruritogens provides further evidence that these more sensitive neurons indeed signal itch. Parallel observations between the zebrafish and mouse suggest that this relatively simple mechanism for conveying, and distinguishing between, pruritic and algogenic stimuli originated early in vertebrate evolution and appears to be preserved in mammals. In sum, our results support the existence of a population-coding based strategy through which differential activation of TRPA1-expressing somatosensory neurons with high or low sensitivities to TRPA1 agonists can relay the discrete sensations of itch and pain respectively.
Materials and methods
Zebrafish husbandry
Adult Zebrafish (Danio rerio) were raised with constant filtration, temperature control (28.5 ± 2°C), illumination (14 hr:10 hr light-dark cycle, lights on at 9:00 AM), and feeding. All animals were maintained in these standard conditions and the Institutional Animal Care and Use Committee approved all experiments. Adult zebrafish not used in behavioral experiments were bred in spawning traps (Thoren Caging Systems, Hazelton, PA) from which embryos were collected. Embryonic and larval zebrafish were raised in petri dishes (Fisher Scientific, Hampton, NH) of E2 medium with no more than 50 embryos per dish at 28.5 ± 1°C in an incubator (Sanyo). Embryos were staged essentially as described (Kimmel et al., 1995) and kept until 5dpf.
Mouse husbandry
Trpa1 and congenic Trpa1mice on the C57BL/6J background were described previously (Cruz-Orengo et al., 2008). All mice were housed under a 12 hr light/dark cycle with food and water provided ad libitum. All behavioral tests were videotaped from a side angle, and behavioral assessments were done by observers blind to the treatments or genotypes of animals. All mice used for behavior tests were age, sex and body weight matched. All experiments were performed in accordance with the guidelines of the National Institutes of Health and the International Association for the Study of Pain, and were approved by the Animal Studies Committee at Washington University School of Medicine.
Cell lines
HEK 293T cell stocks were initially purchased from ATCC, which authenticated their identity via STR profiling. Cells tested negative for mycoplasma contamination. Cells were cultured in DMEM (Life Technologies, Carlsbad, CA) supplemented with fetal bovine serum and antibiotics (penicillin/streptomycin), and passaged every 2–3 days.
Genomic DNA extraction
Individual larvae were processed as previously described (Meeker et al., 2007). Larvae were anesthetized with tricaine, and placed in individual PCR tubes with a small quantity of E2 media. An equivalent amount of a 2X base solution made from a 50x stock (1.25 M NaOH, 10 mM EDTA pH 12) was then added to each tube, and all tubes were incubated at 95°C for 30 min. Following this, 1x neutralization solution (again made from from a 50x solution, 2M Tris-HCl pH 5) was added, and the resulting DNA solutions were stored at −20°C. Adult genomic DNA was extracted using similar methods, but with a few minor modifications. Individual fish were anesthetized with tricaine, and a small portion of the tail fin was removed with a scalpel and placed into an individual PCR tube. 1X base solution was then applied to the piece of tissue, which was incubated for 30 min at 95°C until an equivalent amount of 1X neutralization solution was added.
Nonsense mutant generation
Nonsense mutants for both trpa1b and tlr7 were generated essentially as previously described (Shah et al., 2016). To synthesize the template DNA required for the in vitro transcription we employed a two oligo PCR method, one oligo contained the RNA loop structure required for recognition by the Cas9 enzyme and had the sequence 5'[gatccgcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaac]3'. The second, gene specific, oligo had the sequence 5'[aattaatacgactcactata(N20)gttttagagctagaaatagc]3’, where (N20) refers to the 20 nucleotide oligo that binds the genome. In the case of the trpa1b nonsense mutants the N20 oligo was 5’[GGCGTATAAATACATGCCAC]3’. In the case of the tlr7 nonsense mutant the N20 oligo was 5’[GGGGATGTAGGACAAGTTGT]3’. A mixture of 400 μL of Cas9-encoding mRNA and 200 ng/μL of the proper sgRNA was injected into zebrafish embryos of the AB background at the one cell stage.Fish were then screened for mutations using the following primers, tlr7 5’ GGATGCGTTTATGCTGCTTGACAA, tlr7 3’ AATGTTGTTGTTGTACAGGTAGAGCTC, trpa1b 5’-CTCATACATTCATAAACCTGCCTGATAT, and trpa1b 3’ – TGGAGGGGCGTCAGACCCTTT, and Sanger Sequencing.We identified two nonsense mutants for trpa1b, one that possessed a 4 bp insertion and one that possessed a 7 bp deletion. We then outcrossed these founders (F0) to WT fish of the same genetic background (AB line) and screened for germline transmission in the F1 generation. Members of the F1 generation were additionally backcrossed to WT fish to establish an F2 generation. Heterozygous F2 zebrafish were then crossed to each other to produce an F3 generation that was used for experiments; additionally F2 zebrafish were crossed to transgenics expressing calcium indicator proteins (CaMPARI, GCaMP) under neuronal promoters in order to perform functional imaging studies. In some instances, F3 zebrafish were backcrossed a fourth time to establish younger generations of fish. Animals that were homozygous for either the 4 bp insertion or 7 bp deletion possessed identical phenotypes (i.e., lack of behavioral response to AITC). Likewise, zebrafish with a 4 bp/7 bp phenotype possessed an identical phenotype as 4 bp/4 bp and 7 bp/7 bp homozygotes.We identified one nonsense mutant for tlr7 that possessed a 1 bp deletion. As with the generation of the trpa1b mutant line, this founder was outcrossed to a WT fish and the offspring were screened for germline transmission. Subsequent generations were backcrossed in the manner described above.In the trpa1b experiments, WT siblings of trpa1b fish were used as the controls. In the tlr7 experiments, a pure tlr7 line was established and compared to age-matched WT fish, since we were unable to genotype the 1 bp mutation via conventional methods (gel electrophoresis, HRMA) and could only identify the mutation via sequencing.
Larval zebrafish behavior
At 5dpf, larval zebrafish (AB background) were placed into individual wells on a 96-well mesh bottom plate (Millipore, Burlington, MA) resting in a bath of E2 medium. The 96-well plate was then transferred to a hot plate that was maintained at a constant temperature of 28.5°C. Then the 96-well plate was moved from the E2 medium bath to the experimental bath for four minutes, during which the behavioral response of the larval zebrafish was recorded with a HD camcorder (Canon, Japan). Experiments were performed blindly and each larva’s total locomotive behavioral response was tracked using Ethovision (Noldus, Netherlands). Statistical analysis was done using an analysis of variance (Graphpad Prism 6) or Student’s t-test. All experimental compounds were purchased from Sigma Aldrich unless otherwise noted and were made up in 1% dimethyl sulfoxide (DMSO, Sigma Aldrich, St. Louis, MO) and E2 medium.In experiments involving nonsense mutants and their WT siblings, all larvae were genotyped following video capture of the behavioral response. Briefly, each larva was removed from its well and placed into a PCR tube in 25 μL of E2 media. gDNA was extracted using the base extraction technique described above. For experiments involving trpa1b-/- fish, all larvae were genotyped by HRMA (CFX Connect, BioRad, Hercules, CA) using the primers 5’-CTCATACATTCATAAACCTGCCTGATAT and 3’-TGGAGGGGCGTCAGACCCTTT. As mentioned previously, due to difficulties in genotyping the 1 bp deletion in tlr7 nonsense mutants, animals were identified by genomic sequencing, and a pure tlr7 was created for use in behavioral experiments and were compared to AB fish.
Examining neuronal activation with CaMPARI transgenic zebrafish
elavl3:CaMPARIzebrafish in the Casper background were simultaneously exposed to chemical stimuli and a 405 nm light in order to permanently photoconvert active neurons (Fosque et al., 2015). Briefly, 3dpf larval zebrafish were paralysed by injecting α-bungarotoxin protein (Sigma) into the chest cavity using microinjection needles pulled on a Flaming-Brown Micropipette Puller (model P-87, Sutter Instrument Co., Novato, CA) and a Picrosprizter II microinjection apparatus (General Valve Corporation, Fairfield, NJ). Paralysed fish were then placed in small glass-bottomed dishes (Wilco Wells, Netherlands) filled with an individual chemical from the pruritic screen and allowed to incubate for 2 min. Following this incubation period, glass-bottomed dishes were placed on the stage of an inverted fluorescent microscope (Olympus, Japan, model Ix81S1F-3) and the larvae were exposed to a 405 nm light for 40 s using MetaMorph software (Molecular Devices, San Jose, CA). Post-exposure fish were removed from the chemical and placed in a petri dish filled with embryo media and tricaine to prevent any future activation of sensory neurons. Immediately prior to imaging, larvae were mounted on coverslips in 1.5% agarose +tricaine in EM. TG and surrounding neural tissue were imaged using a 20x lens on an LSM 880 confocal microscope (Zeiss, Germany). Zen Black software was used to scan through the entire TG, acquiring a 1024 × 1024 pixel image slice at every ~5 µm that could then be stacked in the Z plane until the entire ganglion was imaged. Images were examined for photoconverted (red-labeled) neurons, and totals were established for each TG in each condition. When used, ANOVA statistical tests were done against control.
Adult zebrafish behavior
Adult zebrafish were placed in traps (Thoren Caging Systems) and were transported to the experimental area, which was maintained at 28.5 ± 2°C, where they were left to acclimate for one hour. After completing acclimation fish were transported one at a time to the injection area. Each fish was anaesthetized by exposure to 12.0 ± 0.3°C system water. They were then immobilized and injected in the upper lip using a 33 gauge Hamilton needle and 20 μL Hamilton syringe. Fish were injected with 10 μL of experimental or control solution, all of which were made up in 1% DMSO, 1x PBS, and distilled water. After injection, fish were placed into a trap and transferred to the recording area. The behavioral response was recorded for five minutes using an HD camcorder (Cannon). The velocity of the fish was then analyzed using Ethovision (Noldus) and all facial interactions were manually scored to prevent any bias in the data. All analysis was blinded. All statistical analysis were done with an analysis of variance (Graphpad Prism 6) or Student’s t-test.In the case of nonsense mutant experiments, after the behavioral responses were captured, each fish was euthanized by tricaineoverdose and fin clipped, and the fin section was placed in a PCR tube. Then, gDNA was extracted from the excised tissue using the previously described base extraction technique. Trpa1b genotype was determined using the same HRMA strategy as employed in the larval behavioral experiments. Since a homozygous tlr line was employed for adult behavioral experiments, genotyping post-experiment was unnecessary. When used, ANOVA statistical tests were done against control.
Larval in situ hybridization experiments (zebrafish)
Whole-mount colorimetric in situ hybridization to determine trpa1b and tlr7 expression was performed on 3dpf larvae as described previously (Gau et al., 2013). Pigment formation was inhibited by exposing larvae to 1-phenyl 2-thiourea (PTU) at 24hpf. Larvae were hybridized with DIG-labeled riboprobes for trpa1b or tlr7 overnight at 65°C. They then underwent a series of stringent washes, followed by incubation in α-DIG conjugated Fab fragments (Roche, Switzerland, 1:10,000) and staining in NBT/BCIP solution. Larvae were washed with PBTw and stored in glycerol until imaging, whereupon they were mounted in 100% glycerol and photographed using an upright Axioplan2 microscope (Zeiss).
Calcium imaging with elavl3:GCaMP transgenic zebrafish
3dpf zebrafishlarvae from either elavl3:GCaMP5 (Akerboom et al., 2012) or elavl3:H2BGCaMP6 (Chen et al., 2013) transgenic line were paralysed as described above. After paralysis, larvae were mounted in 2% agarose in EM on coverslips, which were then placed into a perfusion chamber (Warner Instruments). Once solidified, the agarose immediately surrounding the head was cut away with a scalpel to ensure maximal exposure to chemical stimuli. The perfusion chamber was placed onto the stage of an Olympus Fluoview FV-1000 multiphoton microscope equipped with an infrared laser controlled by Mai Tai software (Spectra-Physics, Thermo Electron Corporation, Walthom, MA). Larvae were imaged under the following parameters: laser wavelength of 880 nm, resolution of 4.0 µs/pixel, frame rate of 1–3 s per frame, frame size of 512 × 512 pixels. Laser intensity, HV, and zoom were optimized for individual larva. For experiments comparing multiple stimuli, each stimulus was separated by an equivalent period of E2 media washout. All solutions were made in E2 media containing 2% DMSO.For calcium imaging experiments involving trpa1b animals and their WT/trpa1b siblings, elavl3:GCaMP5:trpa1blarvae were employed. One day prior to imaging, larvae were anesthetized with tricaine, tail-clipped, genotyped via HRMA, and housed in individual wells within a 24-well plate until ready for use in experiments. 2-APB was used a positive control.
Ratiometric calcium imaging
DRGs were isolated from 6- to 12-week-old C57Bl/6J mice. All experiments were performed in compliance with institutional animal care and use committee standards and experiments were performed essentially as described (Kimball et al., 2015). Dissociation and culturing of mouse DRG neurons were performed as described with the following modifications (Story et al., 2003). Dissected DRGs were dissociated by incubation for 1 hr at 37°C in a solution of culture medium [Ham’s F12/Dulbecco’s modified Eagle’s medium (DMEM) with 10% horse serum, 1% penicillin-streptomycin (Life Technologies, Carlsbad, CA)] containing 0.125% collagenase (Worthington Biochemicals, Lakewood, NJ), followed by a 30 min incubation in 10 ml of culture media plus 1.25 units of papain. Calcium imaging was performed essentially as described previously (Story et al., 2003). Growth media was supplemented with 100 ng/ml nerve growth factor. For experiments involving heterologous expression, humanembryonic kidney (HEK) 293T cells were transiently transfected with one or two of the following plasmid constructs: zebrafishtrpa1b, zebrafishtlr7, mouseTrpa1, mouseTlr7, humanTRPA1, and/or humanTLR7. All constructs except for the one encoding zebrafishtlr7 were also co-transfected with pIRES-eGFP plasmid in order to estimate transfection efficiency. (For zebrafishtlr7, this step was unnecessary because the construct was already in the pIRES-eGFP vector.) The buffer solution for all experiments was 10 mM HEPES in 1X Hanks’ balanced salt solution (HBSS) (Invitrogen, Carlsbad, CA).The threshold for activation was defined as 30% above baseline for both DRG and heterologous expression experiments. Student’s t-test was used for all statistical calculations. All averaged traces represent mean ± s.e.m. All reported fluorescence values of each cell were normalized to the fluorescence of that cell during the initial baseline wash period. Maximum response values of each cell were calculated as the difference between the maximum and minimum fluorescence values of the cell during a stimulus application period.
Dual luciferase assay
To verify the functionality of our transfected Tlr7 constructs, we determined levels of NF-kB induction following stimulation with the TLR7 agonist loxoribine using a Dual-Luciferase Reporter Assay System (Promega, Madison, WI). Briefly, HEK 293T cells were seeded at ~80% confluency in individual wells of a 24-well plate (N ≈ 4 × 105 cells per well) and transiently transfected with the same zebrafish, mouse, or humanTlr7 constructs as employed in calcium imaging following a standard lipofectamine protocol. All cells were also co-transfected with a nF-kB Firefly luciferase reporter plasmid (p1242 3x-KB-L, Addgene [Mitchell and Sugden, 1995]), a Renilla luciferase control plasmid (p207-CMV-Renilla, gift from Tom Reh), and pIRES-eGFP (if necessary) for estimating transfection efficiency. As a negative control, another set of HEK 293T cells were transfected only with pIRES-eGFP. Twenty-four hours following transfection, the culture media was removed from all cells and replaced with normal serum-free media or with serum-free media containing 200 μM loxoribine. Following a 24 hr treatment period, culture media was removed, plated cells were rinsed briefly with DPBS, then lysed with passive lysis buffer (Promega) and gentle agitation on a multi-purpose rotator (Barnstead, Hampton, NH). Lysates were analyzed on a Viktor3 1420 Multilabel Counter (PerkinElmer, Waltham, MA), which generated luminescence values in CPS (counts per second) for both Firefly and Renilla luciferase activity. Assays were also performed on 1X PLB samples to estimate background luminescence. Background luminescence was subtracted from each measurement, and the Firefly/Renilla CPS ratio was calculated for each condition.
Immunohistochemistry on HEK 293T cells
To verify that TLR7 was being expressed by HEK 293T cells used in our experiments, we transfected cells on coverslips with either mouse or humanTlr7 constructs and pIRES-eGFP; some cells were only transfected with pIRES-eGFP to serve as a negative control. 48 hr following transfection, cell culture media was removed, and coverslips were washed briefly with 1X DPBS and fixed for 10 min at room temperature in 4% paraformaldehyde in 1X PBS (Electron Microscopy Sciences, Hatfield, PA). Coverslips were again rinsed briefly in DBPS and then blocked in 10% goat serum in 1X PBST (PBS with 0.1% Tween-20) for 1 hr at room temperature. Primary antibodies against TLR7 (rabbit anti-TLR7, Boster, Pleasanton, CA, 1:250) and GFP (chick anti-GFP, 1:1000, Invitrogen) were made in PBST with 10% goat serum and applied to the coverslips, which were incubated overnight at 4°C. Coverslips were then rinsed 3X in PBST to remove primary antibodies, treated with secondary antibodies (AlexaFluor goat anti-chicken 488 and AlexaFluor goat anti-rabbit 568, both at 1:1000, Life Technologies and Invitrogen, respectively) for approximately 2 hr at room temperature, washed in PBST, and mounted on slides with DAPI-containing Vectashield medium (Vector Laboratories, Inc., Burlingame, CA). Confocal imaging of mounted cells was performed using a Zeiss microscope and Zen Black acquisition software.
Electrophysiology
Whole-cell patch-clamp recordings were performed at room temperature (22–24°C) using an Axon 700B amplifier (Molecular Devices, Sunnyvale, CA) on the stage of an inverted phase-contrast microscope equipped with a filter set for GFP visualization (Nikon Instruments Inc., Melville, NY, USA) (Feng et al., 2017). Pipettes pulled from borosilicate glass (BF 150-86-10; Sutter Instrument, Novato, CA) with a Sutter P-1000 pipette puller had resistances of 2–4 for whole-cell patch-clamp recordings when filled with pipette solution containing 140 mM CsCl, 2 mM EGTA, and 10 mM HEPES with pH 7.3 and 315 mOsm/l osmolarity. Cells were perfused with extracellular solution containing 140 mM NaCl, 5 mM KCl, 0.5 mM EGTA, 1 mM MgCl2, 2 mM CaCl2, 10 mM glucose, and 10 mM HEPES (pH was adjusted to 7.4 with NaOH, and the osmolarity was adjusted to ≈ 340 mOsm/l with sucrose). The whole-cell membrane currents were recorded using voltage ramps from −100 to +100 mV for 500 ms at holding potential of 0 mV. Data were acquired using Clampex 10.4 software (Molecular Devices, Novato, CA). Currents were filtered at 2 kHz and digitized at 10 kHz. Data were analyzed and plotted using Clampfit 10 (Molecular Devices, Novato, CA). The concentration-response curve was fitted with the logistic equation: Y = Ymin + (Ymax − Ymin)/(1 + 10^[(logEC50 − X)×Hill slope]), where Y is the response at a given concentration, Ymax and Ymin are the maximum and minimum responses, X is the logarithmic value of the concentration and Hill slope is the slope factor of the curve. EC50 is the concentration that gives a response halfway between Ymax and Ymin. All data are presented as mean ± s.e.m.
Mouse behavior
Mice were shaved on the nape of the neck or on the face two days before the assay. On the day of experiment, mice were acclimated for 1 hr by placing each of them individually in the recording chamber followed by intradermal injection of 10 μg of IMQ to the nape of the neck. Immediately after the injection, mice were videotaped for 30 min without any person in the recording room. After the recording, the videotapes were played back and the number of scratching bouts towards the injection site was counted by an investigator blinded to the treatment.Cheek injection of AITC was performed as described (Shimada and LaMotte, 2008). Briefly, during anesthesia with isoflurane (2% in 100% oxygen), the right cheek (approx. 5 × 8 mm area) was shaved. Mice were acclimated in the recording chambers at least two days before experiments began. AITC was dissolved in DMSO to make a 5 M stock solution and diluted in saline to make the working solution. Every mouse received an injection of 10 ul volume at the shaved area. Immediately after the injection, mice were videotaped for 30 min without any person in the recording room. After the recording, the videotapes were played back and the number of scratching and wiping bouts towards the injection site was counted by an investigator blinded to the treatment.Footpad injections were performed as described previously (Liu et al., 2016). Briefly, either a saline control or IMQ (125 μg) was injected into the footpad of the hindpaw. Animals were filmed, and nocifensive behaviors (licking, biting) in the recorded videos were scored by an investigator blind to the treatment.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "An evolutionarily conserved model for selective pruritus via direct activation of TRPA1" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by Gary Westbrook as the Senior Editor and a Reviewing Editor. The following individual involved in review of your submission has agreed to reveal her identity: Diana Bautista (Reviewer #1). The reviewers have discussed the reviews with one another and the Editor has drafted this decision. The reviewers were interested in the topic, but had a number of concerns, some more serious than others, and some of which will require additional experiments.Summary:This is an interesting and thoughtful study examining itch in zebrafish. The authors first performed a screen to identify pruritogens that activate the zebrafish trigeminal ganglia and show that imiquimod triggers calcium influx in these neurons. They also show that imiquimod injection into the lip triggers a novel behavioral response, namely lip rubbing. TRPA1, but not TLR7, mediated the cellular and behavioral responses to imiquimod, and zebrafish, mouse and humanTRPA1 channels were directly activated by imiquimod. However, Trpa1 is expressed in a large number of nociceptive neurons and produces pain as well as itch responses. The authors propose that imiquimod and AITC differentially activate subsets of Trpa1-expressing neurons such that at low concentrations it produces itch occurs with low concentrations and nociception at high concentrations.Essential revisions:1) It is not clear how many pruritogens were tested in the CaMPARI screen. The authors state "a variety" and the figure shows some data. Please clarify. In general the screen could be explained better. Most readers will not have heard of CaMPARI, so a brief explanation of how it works would improve access for the reader.2) Some additional information about the lip rubbing behavior is needed. How long does the behavior persist? Figure 1K shows representative responses to 10uM AITC and 10uM imiquimod. The responses to 100 and 200uM imiquimod and also low dose AITC should be displayed as this data best captures the differences between the behaviors.3) The authors state that the lack of effect of loxoribine on neuronal activation and behavior is similar to "reports in the mouse that loxoribine does not elicit pruritic behavioral responses (Liu et al., 2010)". Liu et al. state that loxoribine does induce a dose-dependent, TLR7-dependent itch in mice. But their actual data show that scratching is very transient and only statistically significant for a first few minutes following injection. Were loxorobine-evoked behavioral and calcium imaging experiments performed such that a rapid response would be detected? If so, please report the response, or lack of response, during the first few minutes following injection.4) It is interesting that mouse and humanTLR7 is activated by both imiquimod and loxoribine but that fish TLR7 is only sensitive to imiquimod. Are there other differences in the zebrafish response to TLR7 agonists, such as the natural ligand ssRNA? This is worthy of discussion given that the mechanisms are unknown by which parasite infection of fish triggers natural behaviors to remove the parasite (e.g., visiting cleaning stations, rubbing against coral). TLRs are proposed to be one mechanism by which fish respond to parasite infection, but few studies have addressed this topic in detail. A short discussion of previous work on infection, natural fish behaviors and TLRs would expand the scope of the study.5) A general mechanism for discrimination of itch from pain is proposed. Although the evidence is mostly consistent for the proposed (see, my major reservations below), it was not convincing that this is the principle mechanism by which most itch agents are discriminated from nociceptive stimuli. Experiments showing that other pruritogens are discriminated via the same proposed mechanism would be needed. At the least, discussion of alternative mechanisms is necessary.6) Assuming zebrafish have mast cells, the authors should discuss why histamine and serotonin do not elicit itch-behavior in fish. Also, data from two species does not seem to be enough to claim that the mechanism is evolutionary conserved. This claim should be toned down.7) The behavioral experiments performed in fish, with different doses of AITC need to be performed in mice, i.e. the proposed mechanism would predict that low doses of AITC should elicit scratching in mice, while higher doses would provoke nociferous responses. This is not a difficult experiment and is a test of the authors' proposed mechanism.8) The data that the zebrafishTrpa1 is the imiquimod receptor in vivo and in vitro is strong, however the behavioral results for mouseTrpa1 is weak. First, at the doses of IMQ used in mice, only small numbers of scratch-responses are elicited. Second, Trpa1-null mice, compared to wild-type mice, only showed a 50% reduction in responses (not the same as the almost complete loss seen in fish). What is the result at higher doses of IMQ in mice? The presented results suggest that there are additional IMQ receptors in mice that contribute to scratching responses.9) The authors suggest that selective subsets of Trpa1-neurons are activated, but provide little direct evidence for this proposal. The authors should investigate if other known mouseitch-inducing agents activate the same neurons as IMQ. This experiment could be performed relatively quickly.10) More information about the CRISPR mutants and additional validation would be appreciated. How many times were the mutants backcrossed? Were multiple alleles identified, and did they have the same phenotype? Can the mutant phenotype be rescued by expressing wild type TrpA1b? In most experiments wt was used as the control; why weren't heterozygous siblings used?11) Is the IMQ-responsive subset of neurons in larvae genetically specified or determined stochastically? This could be addressed by imaging responses to IMQ at different times and determining if the same neurons are activated each time.12) These experiments show that IMQ responses require TrpA1b, but not TLR7. They also show that in heterologous cells, expression of TrpA1b, but not TLR7, confers a response to IMQ, albeit more weakly than AITC. These results lead the authors to propose that TrpA1b is the direct sensor of IMQ, rather than a channel downstream of a GPCR. The fact that TrpA1b can be directly activated is compelling, but the results do not exclude the possibility that there is another receptor in vivo. This issue should be discussed.13) The fact that low concentrations of AITC activate a similar fraction of TrpA1b-expressing neurons in zebrafishlarvae as IMQ is a nice finding supporting the authors' hypothesis that IMQ-expressing neurons are primed for TrpA1 activation. This idea was strengthened by an experiment showing that IMQ-responsive DRG neurons are enriched in the population of neurons activated by low AITC concentrations. This finding could be strengthened further by addressing the same question with calcium imaging in zebrafishlarvae- i.e. are the same trigeminal neurons that respond to IMQ also those responsive to low TrpA1 concentrations?Essential revisions:1) It is not clear how many pruritogens were tested in the CaMPARI screen. The authors state "a variety" and the figure shows some data. Please clarify. In general the screen could be explained better. Most readers will not have heard of CaMPARI, so a brief explanation of how it works would improve access for the reader.We agree that our previous description of the screen was vague and have updated that particular section in the main text. We screened five drugs that were selected based on their site of action. We exclusively screened drugs known to act on mammalian receptors with zebrafish orthologs, which limited the number of compounds we could test. For example, we did not test pruritogens known to act upon Mrgprs, which are not present in the zebrafish. Additionally, to increase reader accessibility we added a description of the CaMPARI protein.“In an effort to determine if pruritic stimuli are capable of eliciting somatosensory activity in zebrafish, we screened five compounds known to both induce acute pruritus in mammals and act on receptors expressed by zebrafish (Schön and Schön, 2007; Bell, McQueen and Rees, 2004; Lieu et al., 2014; Yaaguchi et al., 1999; Tsujii et al., 2009), excluding pruritogens that act on receptors that do not have a zebrafish ortholog, such as MRGPR agonists. […] Using this approach, we were able to view trigeminal neuronal activity in 3 day post fertilization (dpf) larval zebrafish following the application of each pruritogen (Figure 1A-H).”2) Some additional information about the lip rubbing behavior is needed. How long does the behavior persist? Figure 1K shows representative responses to 10uM AITC and 10uM imiquimod. The responses to 100 and 200uM imiquimod and also low dose AITC should be displayed as this data best captures the differences between the behaviors.When initially developing the adult behavior assay we determined that the vast majority of lip rubbing behavior occurred during the first five minutes post injection. As a result, this time was utilized for all further behavioral quantifications with adult zebrafish. We would also like to note that Figure 1K was mislabeled. The displayed responses are from Control, 10uM AITC, and 100uM IMQ respectively. We have also added Control, 5 µM AITC, 10 µM AITC, 100 µM IMQ, and 200 µM IMQ behavioral traces to Figure 4—figure supplement 1.3) The authors state that the lack of effect of loxoribine on neuronal activation and behavior is similar to "reports in the mouse that loxoribine does not elicit pruritic behavioral responses (Liu et al., 2010)". Liu et al. state that loxoribine does induce a dose-dependent, TLR7-dependent itch in mice. But their actual data show that scratching is very transient and only statistically significant for a first few minutes following injection. Were loxorobine-evoked behavioral and calcium imaging experiments performed such that a rapid response would be detected? If so, please report the response, or lack of response, during the first few minutes following injection.We thank the reviewers for identifying our mislabeled citation. The sentence in the text was intended to cite Kim et al., 2011 (not Liu et al., 2010), and has since been corrected. Kim et al. (Kim et al., 2011) performed similar experiments as Liu et al., but did not find any increase in scratching behavior when mice were injected with loxoribine, in line with what we observed in the zebrafish. However, the reviewer addresses an important issue regarding the time course of behavioral experiments. According to Liu et al., loxoribine only evokes a statistically significant increase in mouse scratching behavior within the first five minutes following injection. In all of our behavioral experiments with adult zebrafish, fish were filmed immediately after injection for 5 minutes. Therefore, we would assume that our behavioral assay was temporally sensitive enough to capture even transient, rapid responses to loxoribine. That we did not observe any immediate responses to loxoribine indicates that it likely has no effect on zebrafish. Larval zebrafish behavior was conducted on similar timescale, as recording began immediately after the mesh-bottomed plate containing zebrafishlarvae was lowered into the chemical to be tested. We would therefore expect that our larval behavioral screen has the capacity to capture brief, transient responses to loxoribine. While we did not performin vivo GCaMP calcium imaging on larval zebrafish with loxoribine, our CaMPARI experiments would be able to capture immediate neuronal responses. In these experiments, photoconversion was performed while the larvae were still in the stimulus bath; as such, there was no temporal “gap” between stimulus exposure and photoconversion of active neurons. Given a lack of response to loxoribine under all of these experimental conditions, especially when coupled with our data from the dual luciferase assay indicating that loxoribine did not activate zebrafishTLR7, we concluded that loxoribine has no behavioral or neuronal effects on the zebrafish.While we intended for our reference to the Kim et al. paper (Kim et al., 2011) to highlight the similarities of our results in the zebrafish with previous findings in the mouse, and not to necessarily compare our results in mice to these previous findings, it is of note that our calcium imaging experiments with dissociated mouse DRGs would also be sufficient to capture a transient loxoribine response. All of our DRG calcium imaging experiments were performed in real time – i.e., neurons were imaged while chemicals were being perfused across them – and thus we would expect that any immediate responses could be captured. We did not perform any loxoribine behavioral experiments in mice, and so cannot comment on the response/lack thereof following injection.It should also be noted that the experiments performed by Kim et al. were binned in 5 minute increments, like the experiments performed by Liu et al. Therefore, we would expect that their assay had identical temporal sensitivity, and would have been able to capture the transient loxoribine responses Liu et al. observed.4) It is interesting that mouse and humanTLR7 is activated by both imiquimod and loxoribine but that fish TLR7 is only sensitive to imiquimod. Are there other differences in the zebrafish response to TLR7 agonists, such as the natural ligand ssRNA? This is worthy of discussion given that the mechanisms are unknown by which parasite infection of fish triggers natural behaviors to remove the parasite (e.g., visiting cleaning stations, rubbing against coral). TLRs are proposed to be one mechanism by which fish respond to parasite infection, but few studies have addressed this topic in detail. A short discussion of previous work on infection, natural fish behaviors and TLRs would expand the scope of the study.We thank the reviewer for the suggestion that we more thoroughly probe this topic, and as requested, we have expanded upon our discussion of what is known about TLRs and immune responses to infection in teleost fish. Examining the indirect role of TLR7 at promoting endogenous itch in fish would be a very interesting basis for future studies, but was outside the scope of ours. While we found several studies that examined that implicated TLRs in innate immune responses in several fish species (for example, TLRs are upregulated following infection, and TLR activation is associated with proliferation of peripheral blood leukocytes, inhibition of viral replication, and the induction of interferon genes), we were unable to find studies that focused specifically on the link between natural fish behaviors and immune stimulation. We hope that our modifications (Discussion, ninth paragraph) adequately address the reviewer’s concerns. Additionally, this suggestion has brought to light that we could have been more clear in explaining the results of the dual luciferase assay, as we found that zebrafishTLR7 did not respond to either imiquimod or loxoribine, while both human and mouseTLR7 did. We have since rephrased our text to emphasize that zebrafishTLR7 does not respond to these TLR7 agonists. However, we recognize that due to a lack of a positive control, we cannot verify that zebrafishTLR7 was indeed functional or expressed properly in our assay, and have elaborated upon this caveat in the third paragraph of the subsection “Imiquimod directly activates TRPA1”.“In the zebrafish, however, TLR7 is unlikely to contribute even indirectly to IMQ-induced itch sensation, as we observed no behavioral phenotype in TLR7-/- animals, and found no evidence that TLR7 is even responsive to typical mammalianTLR7 agonists, like loxoribine and IMQ. […] While our results suggest that TLR7 is not involved in transducing IMQ-evoked itch in the zebrafish, investigating the role of immune responses in mediating somatosensations (both in zebrafish and other species) would be an interesting route for future exploration.”“However, due to a lack of a TLR7 positive control, we were unable to confirm that TLR7 was functional in our heterologous expression system. With this caveat in mind, the lack of zTLR7 response to these TLR7 agonists lends further credence to the conclusion that TLR7 is not involved in somatosensory neuronal activation or behavior in this species.”5) A general mechanism for discrimination of itch from pain is proposed. Although the evidence is mostly consistent for the proposed (see, my major reservations below), it was not convincing that this is the principle mechanism by which most itch agents are discriminated from nociceptive stimuli. Experiments showing that other pruritogens are discriminated via the same proposed mechanism would be needed. At the least, discussion of alternative mechanisms is necessary.We thank the reviewer for their comment. To recap, the mechanism we posit for the discrimination of itch from pain is a population coding model in which low intensity TRPA1 agonists activate a selective subset of highly sensitive TRPA1-expressing neurons and high intensity TRPA1 agonists activates both this selective subset as well as another population of less-sensitive neurons. This bears some similarity to “labeled line” coding mechanisms proposed by others, in which a subset of neurons that express pruritic GPCRs and itch-specific neuropeptides convey itch (Bautista, Wilson and Hoon, 2014; Hoon, 2015; Ross, 2011; Goswami et al., 2014; Ma, 2010). In the context of somatosensations provoked by direct TRPA1 channel agonists, we feel that our evidence largely supports such a model, as opposed to other mechanisms (i.e., an intensity coding strategy). As we did not investigate other compounds known to elicit both itch and pain depending upon factors such as stimulus concentration and method of application (Hoon, 2015), however, we cannot claim that this is the universal mechanism through which itch and pain are distinguished. We did not mean to imply that our proposed mechanism was the only method for itch and pain discrimination, and we hope that our modifications to the text have clarified this point. We have amended our Discussion section to emphasize the point that our mechanism may not be applicable to every scenario, and have made efforts throughout the paper to specify that our mechanism refers to TRPA1-expressing neurons being activated by TRPA1 agonists.“We however do not mean to imply that other pruritogens selectively evoke itch or pain by activating pruriceptors and/or nociceptors in a dose-dependent manner. Our proposed model clearly is not the sole mechanism by which itch is coded as a distinct sensation from pain (Bautista, Wilson and Hoon, 2014; Hoon, 2015; Ross, 2011; Goswami et al., 2014; Ma, 2010).”6) Assuming zebrafish have mast cells, the authors should discuss why histamine and serotonin do not elicit itch-behavior in fish. Also, data from two species does not seem to be enough to claim that the mechanism is evolutionary conserved. This claim should be toned down.We thank the reviewer for their thought-provoking question, and have followed through upon the reviewer’s suggestion to discuss this topic more thoroughly. We have expanded our previous few sentences in the Discussion to include a more detailed explanation of zebrafish mast cell physiology (e.g., describing that zebrafish mast cells do not appear to contain histamine or serotonin) and the implications that this may have on itch behavior. Additionally, we have also emphasized the possibility that while zebrafish possess serotonin and histamine receptors, these receptors may not be expressed on somatosensory neurons, precluding their involvement in pruritic sensation (Discussion, eleventh paragraph). The reviewer also points out that data from two species is insufficient to declare that a mechanism is “evolutionarily conserved”. We agree, and have toned down our claims accordingly (Discussion, last paragraph).Mast Cells: “We observed that out of the several mammalian pruritogens, only IMQ elicited behavioral and neuronal responses in zebrafish. […] It is therefore plausible that in the zebrafish, histamine and serotonin do not play a functional role in pruritic sensation or immune responses, but are restricted to more central processes such as mediating sleep-wakefulness cycles, mood, and anxiety (Pei et al., 2016; Sackerman, 2010).”Conclusion: “The direct activation of a TRP channel to elicit itch or pain through the recruitment of distinct populations of somatosensory neurons via stimulus sensitivity is mechanistically simple. […] While data from only two species is not sufficient to declare that our proposed mechanism is evolutionarily conserved, we hope that our findings provide a springboard for future research into pruritus across multiple taxa, which would help elucidate the evolutionary development of this important sense.”7) The behavioral experiments performed in fish, with different doses of AITC need to be performed in mice, i.e. the proposed mechanism would predict that low doses of AITC should elicit scratching in mice, while higher doses would provoke nociferous responses. This is not a difficult experiment and is a test of the authors' proposed mechanism.We agree that the experiments proposed by the reviewer (i.e. administering different doses of AITC to mice, with the prediction that lower doses should elicit scratching, while higher doses should elicit nocifensive wiping behaviors) are a necessary test of our proposed mechanism. We have since performed these experiments, and our findings demonstrate that low dose AITC (50 mM) produces significant scratching behavior with no appreciable wiping behavior (p < 0.001 and N.S. respectively), while a stronger AITC stimulus (100 mM) results in a significant attenuation of the observed scratching behavior, as well as a significant wiping behavior (p < 0.05 and p < 0.001 respectively). These results have been included in Figure 5..It is not clear why we observed scratch-specific behaviors at AITC concentrations higher than those reported by others to predominantly elicit nocifensive wiping behaviors (Robertson et al., 2013; Akiyama, Carstens and Carstens, 2010).“Finally, in accordance with our zebrafish data, we observed that AITC stimulus intensity dictates whether mice exhibit pruritic or nocifensive behaviors. […] We observed that AITC (50 mM) produces significant scratching behavior with no appreciable wiping behavior (p < 0.001 and N.S. respectively), while a higher dose of AITC (100 mM) results in a significant attenuation of the observed scratching behavior, as well as a significant wiping behavior (p < 0.05 and p < 0.001 respectively) (Figure 5I).”8) The data that the zebrafishTrpa1 is the imiquimod receptor in vivo and in vitro is strong, however the behavioral results for mouseTrpa1 is weak. First, at the doses of IMQ used in mice, only small numbers of scratch-responses are elicited. Second, Trpa1-null mice, compared to wild-type mice, only showed a 50% reduction in responses (not the same as the almost complete loss seen in fish). What is the result at higher doses of IMQ in mice? The presented results suggest that there are additional IMQ receptors in mice that contribute to scratching responses.We agree with the reviewer that the possibility of additional IMQ receptors, and a non-TRPA1 dependent mechanism for mediating IMQ-induced itch, is present in the mouse. To explore this possibility further, we performed experiments in which a higher dose of IMQ (50 μg) was applied to both WT and TRPA1-/- mice. At this concentration we observed increased scratching behavior in wild type animals that did not differ from TRPA1 -/- mice. These data have been included in Figure 5—figure supplement 1. Higher concentrations of IMQ likely produce this result via an indirect mechanism, potentially through a TLR7 mediated pathway, a possibility that is addressed in our reply to Essential revision #12. We find it unlikely that an alternate pruritic GPCR exists given the overlap we observed between neurons activated by IMQ and low concentrations of AITC, which is also discussed further in our reply to Essential revision #12. Additionally, we would like to clarify that we observed an ~8-fold increase in scratch behavior with IMQ (10 μg) compared to controls, and would argue that this is not a small response.9) The authors suggest that selective subsets of Trpa1-neurons are activated, but provide little direct evidence for this proposal. The authors should investigate if other known mouseitch-inducing agents activate the same neurons as IMQ. This experiment could be performed relatively quickly.Although it might not have been clear, we performed calcium imaging experiments that showed that the vast majority of IMQ responsive mouse DRG neurons also responded to the TRPA1 dependent pruritogens chloroquine and deoxycholic acid, implying that these neurons likely comprise a pruritic subset of TRPA1-expressing neurons (Figure 5E, F). We have expanded our explanation of these experiments in the Discussion section, and have likewise clarified how equivalent experiments are impossible in the zebrafish due to a lack of responses to other pruritogens. Our findings that subsequent pulses of IMQ activate the same neurons in a non-stochastic manner (Figure 4—figure supplement 2, see also our response to Essential revision #11), further support our claim that this is a defined subpopulation of TRPA1 neurons.“Furthermore, in the mouse, we observed that the vast majority of IMQ (100 μM) responsive neurons also responded to the TRPA1-dependent pruritogens chloroquine and deoxycholic acid, supporting the conclusion that these neurons constitute a pruritic subpopulation. Unfortunately, equivalent experiments could not be performed in the zebrafish, as we were unable to identify other pruritogens for this species (Zhang, 2014).”10) More information about the CRISPR mutants and additional validation would be appreciated. How many times were the mutants backcrossed? Were multiple alleles identified, and did they have the same phenotype? Can the mutant phenotype be rescued by expressing wild type TrpA1b? In most experiments wt was used as the control; why weren't heterozygous siblings used?We appreciate the reviewer’s concern about the generation and validation of our CRISPR mutants, and have provided more information in the Materials and methods section of our paper. It should be noted that in all behavioral experiments, fish were genotyped after completion of the experiment. While we did not find any evidence of gene dosage effects – i.e., we found no significant difference in AITC response between WT and heterozygous siblings – we restricted our comparisons to wildtype siblings because that seemed to be the most stringent approach. These results are comparable to those obtained by Prober et al. (Prober et al., 2008), who used the TILLING approach to generate mutants. In their study, they observed normal AITC responses in both TRPA1b homozygous wildtype fish as well as their heterozygous siblings. When generating these mutants, we did not perform experiments exploring whether the mutant phenotype can be rescued by expressing wildtype TRPA1b due to technical constraints. We do not have a way to effectively re-institute TRPA1 expression specifically in TRPA1 neurons. While injecting TRPA1 mRNA into a zebrafish embryo would initially seem like a viable procedure, we could not ensure specificity of expression. Additionally, given that mRNA injections are performed early in development (i.e., at the 1-cell stage), the mRNA expression would not last until 5dpf, the age at which we performed all of our behavioral screens due to mRNA degradation and protein turnover.“We identified two nonsense mutants for TRPA1, one that possessed a 4bp insertion and one that possessed a 7bp deletion. […] In the TLR7 experiments, a pure TLR7-/- line was established and compared to age-matched WT fish, since we were unable to genotype the 1bp mutation via conventional methods (gel electrophoresis, HRMA) and could only be identified via sequencing.11) Is the IMQ-responsive subset of neurons in larvae genetically specified or determined stochastically? This could be addressed by imaging responses to IMQ at different times and determining if the same neurons are activated each time.The reviewers raise an excellent point. We have performed the suggested experiments to image responses to IMQ at different times and determine whether the same neurons are activated each time. We found that nearly all of IMQ responsive neurons respond to multiple pulses of IMQ, arguing that this is a defined population of neurons and that IMQ responses are not determined stochastically. We have modified both the Results and Discussion sections of the paper to include this new information, and have added an additional figure (Figure 4—figure supplement 2).Results: “To verify that IMQ activates a selective subset of TRPA1+ neurons as opposed to activating TRPA1+ neurons stochastically, we performed calcium imaging experiments in which 3dpf elavl3:H2BGCaMP6 were exposed to successive pulses of 100 μM IMQ. […] The finding that nearly all IMQ-responsive neurons were dual responders, argues that these neurons comprise a distinct population of TRPA1 expressing neurons, primed to respond to low intensity TRPA1 dependent stimuli.”Discussion: “Our observation that sequential pulses of IMQ (100 μM) activate the low intensity TRPA1 agonist responsive population in zebrafish demonstrates that this population is likely genetically defined, and not determined stochastically.”12) These experiments show that IMQ responses require TrpA1b, but not TLR7. They also show that in heterologous cells, expression of TrpA1b, but not TLR7, confers a response to IMQ, albeit more weakly than AITC. These results lead the authors to propose that TrpA1b is the direct sensor of IMQ, rather than a channel downstream of a GPCR. The fact that TrpA1b can be directly activated is compelling, but the results do not exclude the possibility that there is another receptor in vivo. This issue should be discussed.We thank the reviewer for their thoughtful suggestion of discussing this issue more thoroughly, and have provided an additional paragraph in the Discussion section exploring the possibility of IMQ-evoked itch mediated by an unknown co-receptor. While the existence of an alternate IMQ-binding co-receptor is possible, we feel that this is improbable. First, results from our in vitro experiments necessitate that such a receptor would be endogenously expressed in HEK cells in order to couple with TRPA1 and evoke calcium flux, as we did not observe any response to IMQ in cells that were not transfected with TRPA1. This seems unlikely. Secondly, results from experiments in which we modified the stimulus intensity similarly make this possibility unlikely. The overlap we observed in the number of neurons that were responsive to IMQ and low-dose AITC similarly implies that the same receptor on these neurons was activated under these two conditions. If a neuron has two distinct ways of being activated by IMQ (either directly through TRPA1 or through the coupling of TRPA1 to a mystery co-receptor), we would not expect the neuronal recruitment to scale with stimulus intensity the way we observed.Additionally, we have also elaborated upon the possibility of “indirect itch” that could occur when pruriceptors are activated indirectly as a result of an immune response generated via activation of TLR7 and/or other immune receptors. We think that these mechanisms most certainly exist, and are likely responsible for our observations that IMQ-induced scratching behavior is not entirely abolished in TRPA1-/- animals, and that IMQ-induced scratching behavior is identical between TRPA1-/- mice and their wildtype siblings at higher concentrations of IMQ (also discussed in our response to Essential revision #8; the indirect role of TLRs in fish responses are also discussed in our response to Essential revision #4). At such high concentrations, mechanisms involving the direct activation of TRPA1 to evoke itch may be saturated, and additional increases in responses may result from the indirect stimulation via immune modulation. We hope that this addition adequately addresses the reviewer’s concerns.“Our data implicates a mechanism for the direct activation of TRPA1 by IMQ to elicit sensations of itch in both zebrafish and mice. […] Furthermore, the dose-dependent overlap we observed in the number of neurons that were responsive to IMQ and AITC, as well as similarities in the dose dependent itch and nociceptive behaviors elicited by these compounds in both zebrafish and mice, implies that these compounds are acting via the direct activation of TRPA1.”13) The fact that low concentrations of AITC activate a similar fraction of TrpA1b-expressing neurons in zebrafishlarvae as IMQ is a nice finding supporting the authors' hypothesis that IMQ-expressing neurons are primed for TrpA1 activation. This idea was strengthened by an experiment showing that IMQ-responsive DRG neurons are enriched in the population of neurons activated by low AITC concentrations. This finding could be strengthened further by addressing the same question with calcium imaging in zebrafishlarvae- i.e. are the same trigeminal neurons that respond to IMQ also those responsive to low TrpA1 concentrations?We realize that we may not have been explicit as necessary in our original text, but we did perform imaging experiments in which we sequentially applied IMQ, a low concentration of AITC (10 μM), and a high concentration of AITC (50 μM) to 3dpf elavl3:GCaMP5 zebrafishlarvae. The results of these experiments are shown in Figure 4—figure supplement 1C. We show that the population of IMQ+ neurons is entirely contained within the population of neurons responding to low AITC concentrations, which is itself within a broader population of neurons that are activated by high concentrations of AITC. From this data, it can be extrapolated that IMQ responding neurons are enriched within the population of neurons that respond to low AITC levels. In the original Discussion section of the paper, we only referenced data obtained from mouse experiments, and following the reviewer’s suggestions, we have expanded our treatment of this topic to include results from zebrafish experiments.Results section: “in vivo GCaMP imaging bolstered our CaMPARI findings that stimulus intensity affects which subpopulations of TRPA1+ neurons are activated. […] Only a subset of neurons that responded to a high concentration (50 μM) of AITC responded to a lower concentration (10 μM) of AITC (11/42), and of those even fewer neurons responded to 100 μM IMQ (4/11) (Figure 4—figure supplement 1C).”Discussion: “Additionally, in both species, IMQ (100 μM) responsive neurons were enriched within populations of neurons that responded to low concentrations of AITC; in other words, we observed a high degree of overlap in the populations of neurons that responded to low intensity TRPA1 agonists irrespective of stimulus identity. Together, this provides further evidence of the greater sensitivity of a population of itch-encoding neurons to TRPA1 agonists.”
Authors: Veit Hornung; Margit Guenthner-Biller; Carole Bourquin; Andrea Ablasser; Martin Schlee; Satoshi Uematsu; Anne Noronha; Muthiah Manoharan; Shizuo Akira; Antonin de Fougerolles; Stefan Endres; Gunther Hartmann Journal: Nat Med Date: 2005-02-20 Impact factor: 53.440
Authors: Chris R Højland; Hjalte H Andersen; Jeppe N Poulsen; Lars Arendt-Nielsen; Parisa Gazerani Journal: Acta Derm Venereol Date: 2015-09 Impact factor: 4.437
Authors: Lillian Cruz-Orengo; Ajay Dhaka; Robert J Heuermann; Timothy J Young; Michael C Montana; Eric J Cavanaugh; Donghee Kim; Gina M Story Journal: Mol Pain Date: 2008-07-31 Impact factor: 3.395
Authors: David P Roberson; Sagi Gudes; Jared M Sprague; Haley A W Patoski; Victoria K Robson; Felix Blasl; Bo Duan; Seog Bae Oh; Bruce P Bean; Qiufu Ma; Alexander M Binshtok; Clifford J Woolf Journal: Nat Neurosci Date: 2013-05-19 Impact factor: 24.884
Authors: Mee Jung Ko; Logan C Ganzen; Emre Coskun; Arbaaz A Mukadam; Yuk Fai Leung; Richard M van Rijn Journal: Sci Rep Date: 2019-02-20 Impact factor: 4.379
Authors: Hans Jürgen Solinski; Mette C Kriegbaum; Pang-Yen Tseng; Thomas W Earnest; Xinglong Gu; Arnab Barik; Alexander T Chesler; Mark A Hoon Journal: Cell Rep Date: 2019-03-26 Impact factor: 9.423
Authors: Jenny J Wei; Hali S Kim; Casey A Spencer; Donna Brennan-Crispi; Ying Zheng; Nicolette M Johnson; Misha Rosenbach; Christopher Miller; Denis H Leung; George Cotsarelis; Thomas H Leung Journal: Sci Immunol Date: 2020-08-28