Literature DB >> 29514656

Targeting Hif1a rescues cone degeneration and prevents subretinal neovascularization in a model of chronic hypoxia.

Maya Barben1,2, Christian Schori1,3, Marijana Samardzija4, Christian Grimm1,2,3.   

Abstract

BACKGROUND: Degeneration of cone photoreceptors leads to loss of vision in patients suffering from age-related macular degeneration (AMD) and other cone dystrophies. Evidence, such as choroidal ischemia and decreased choroidal blood flow, implicates reduced tissue oxygenation in AMD pathology and suggests a role of the cellular response to hypoxia in disease onset and progression. Such a chronic hypoxic situation may promote several cellular responses including stabilization of hypoxia-inducible factors (HIFs).
METHODS: To investigate the consequence of a chronic activation of the molecular response to hypoxia in cones, von Hippel Lindau protein (VHL) was specifically ablated in cones of the all-cone R91W;Nrl -/- mouse. Retinal function and morphology was evaluated by ERG and light microscopy, while differential gene expression was tested by real-time PCR. Retinal vasculature was analyzed by immunostainings and fluorescein angiography. Two-way ANOVA with Šídák's multiple comparison test was performed for statistical analysis.
RESULTS: Cone-specific ablation of Vhl resulted in stabilization and activation of hypoxia-inducible factor 1A (HIF1A) which led to increased expression of genes associated with hypoxia and retinal stress. Our data demonstrate severe cone degeneration and pathologic vessel growth, features that are central to AMD pathology. Subretinal neovascularization was accompanied by vascular leakage and infiltration of microglia cells. Interestingly, we observed increased expression of tissue inhibitor of metalloproteinase 3 (Timp3) during the aging process, a gene associated with AMD and Bruch's membrane integrity. Additional deletion of Hif1a protected cone cells, prevented pathological vessel growth and preserved vision.
CONCLUSIONS: Our data provide evidence for a HIF1A-mediated mechanism leading to pathological vessel growth and cone degeneration in response to a chronic hypoxia-like situation. Consequently, our results identify HIF1A as a potential therapeutic target to rescue hypoxia-related vision loss in patients.

Entities:  

Keywords:  Age-related macular degeneration; Cone photoreceptors; HIF1; Hypoxia; Mouse model; Retinal degeneration; VHL

Mesh:

Substances:

Year:  2018        PMID: 29514656      PMCID: PMC5842520          DOI: 10.1186/s13024-018-0243-y

Source DB:  PubMed          Journal:  Mol Neurodegener        ISSN: 1750-1326            Impact factor:   14.195


Background

Age-related macular degeneration (AMD) is the leading cause of visual impairment in the elderly population in industrialized nations [1-3]. Due to the degeneration of photoreceptors in the cone-rich macula and/or the ingrowth of blood vessels, patients suffering from AMD lose central, high acuity vision [4-6]. While there is no therapy available for geographic atrophy (dry AMD), the neovascular (wet) form of AMD is treated by vascular endothelial growth factor (VEGF)-targeting therapies to slow disease progression [7-9]. Choroidal neovascularization (CNV) defines the classic form of neovascular AMD and is characterized by the ingrowth of blood vessels from the choroid to the subretinal space [6, 10]. Retinal angiomatous proliferation (RAP) has been described as an additional, distinct form of neovascular AMD [11]. In RAP, also known as deep retinal vascular anomalous complexes, vessels originate not from the choroid but from the deep retinal plexus in the inner retina and extend into the photoreceptor layer and the subretinal space [12, 13]. AMD is a multifactorial disease. Besides genetic and environmental risk factors [5, 14, 15], tissue hypoxia and changes in retinal blood flow have been implicated in its etiology [16-20]. Oxygen supply to photoreceptors in the eyes of elderly people may be impaired due to an age-dependent reduction of choroidal blood flow [21, 22] and accumulation of drusen [23]. Choroidal ischemia in dry AMD [24, 25] and decreased choroidal blood volume in AMD [26] further support the hypothesis that hypoxia might be implicated in disease development and progression. The retina is considered as one of the most metabolically active tissues and is therefore highly vulnerable to changes in oxygen tension [17, 27]. In conditions of reduced oxygen supply (hypoxia), molecular responses are activated with hypoxia-inducible factor 1 (HIF1) playing a key regulatory role for adapting the cell/tissue to the new condition. Heterodimeric HIF1 proteins are composed of an oxygen-labile α-subunit and a constitutively expressed β-subunit [28]. Under normoxic conditions, HIF1A is hydroxylated by prolyl hydroxylase domain (PHD) proteins. This promotes the interaction with the von Hippel-Lindau (VHL) ubiquitin E3 ligase complex leading to ubiquitination and rapid degradation of hydroxylated HIF1A by proteasomes. Under hypoxic conditions, hydroxylation of HIF1A is reduced. Hence, HIF1A accumulates, enters the nucleus and drives transcription of a multitude of target genes [29-31]. In this study, we investigated the consequences of a chronic hypoxia-like response triggered in cone photoreceptors to elucidate the mechanisms of cell death in cone degenerative diseases such as AMD. To this end, we used R91W;Nrl double-mutant mice which express only cone photoreceptors in a well-layered, functional retina [32]. To induce the hypoxia-like response, we ablated the VHL protein specifically from cones using the Cre-loxP system. We analyzed the effects of the cone-specific activation of the hypoxic response and validated the contribution of HIF1A to the resulting retinal pathology.

Methods

Mice

All experimental procedures were performed according to ‘The Association for Research in Vision and Ophthalmology’ statement on animal use in ophthalmic and vision research and the regulation of the veterinary authorities of Kanton Zurich, Switzerland. R91W;Nrl mice were generated by crossing Rpe65 (R91W) [33] to Nrl mice [34], and were described recently [32]. BPCre;R91W;Nrl;Vhl (=cone) mice were generated by breeding R91W;Nrl mice to Vhl mice [35] and mice expressing the Cre recombinase under the transcriptional control of the blue cone opsin (BP) promoter [36]. To generate BPCre;R91W;Nrl;Vhl;Hif1a (=cone) mice, BPCre;R91W;Nrl;Vhl were bred to Hif1a mice [37]. R91W;Nrl;Vhl and R91W;Nrl;Vhl;Hif1a littermates without Cre recombinase served as respective control mice (=ctrl). Genotyping was performed by PCR using DNA isolated from ear clips and primer pairs as described previously [38, 39]. Presence of BPCre was tested using the following primer pair: forward (5’-GGACATGTTCAGGGATCGCCAGGCG-3’) and reverse (5’-GCATAACCAGTGAAACAGCATTGCTG-3’). The amplification reaction resulted in a 268 bp fragment in the presence of the transgene. To test for deletion of floxed sequences, genomic DNA was isolated from retinal tissues and tested by PCR using appropriate primer pairs as described [38, 39]. 129S6 (Taconic, Ejby, Denmark) mice were used as wild-type controls. To test expression of the Cre recombinase BPCre;R91W;Nrl mice were bred to a ZsGreen reporter line (Ai6 mice, Gt(ROSA)26Sor, [40]). Mice of both sexes were used for experiments and were housed at the animal facility of the University Zurich under a 14 h : 10 h light/dark cycle with lights on at 6 am and lights off at 8 pm. Food and water were provided ad libitum.

Morphology/quantification

To evaluate retinal morphology, eyes were enucleated and fixed in 2.5% glutaraldehyde in cacodylate buffer (pH 7.2, 0.1 M), according to the previously described procedure [41]. By cutting through the optic nerve head, nasal and temporal halves of the eyecups were separated and embedded in epon plastic. Semi-thin cross sections (0.5 μm) were counterstained with toluidine blue and analyzed by light microscopy (Axioplan; Zeiss, Jena, Germany). Thickness of the outer nuclear layer was measured at indicated distances from the optic nerve head using the Adobe Photoshop CS6 ruler tool (Adobe Systems, Inc., San Jose, CA, USA) on reconstructed retinal panorama images.

Immunofluorescence

After euthanasia, eyes were marked nasally, enucleated and fixed in 4% paraformaldehyde (PFA) in phosphate buffer for 1 h at 4°C. Cornea and lens were removed and the dissected eyecups postfixed for 2 h in 4% PFA. After immersion in 30% sucrose (in PBS 0.1 M) the eyecups were embedded in tissue freezing medium (O.C.T., Leica Biosystems Nussloch GmbH, Nussloch, Germany), frozen in a 2-methylbutane bath cooled by liquid nitrogen and stored at -80°C. Cryosections (12 μm) were blocked (3% normal goat serum (Sigma-Aldrich, St. Louis, MO, USA), 0.3% Triton X-100 (Sigma) in PBS) and incubated with the following primary antibodies overnight at 4°C: Isolectin GS-IB4-Alexa594 from Griffonia simplicifolia (1:300, I21413; Thermo Fisher Scientific, Waltham, MA, USA), rabbit anti-allograft inflammatory factor 1 (alias IBA1, 1:1000, 019-19741; Wako, Neuss, Germany), rabbit anti-albumin (ALB, 1:500, RARaAlb; Nordic Immunology, Tilburg, Netherlands). Sections were washed with PBS, incubated with secondary antibodies (Cy3-labeled, Jackson ImmunoResearch Laboratories, Westgrove, PA, USA) for 1 h at room temperature (RT), counterstained with DAPI (4',6-Diamidine-2'-phenylindole dihydrochloride, Roche, Basel, Switzerland) and analyzed by fluorescence microscopy (Axioplan; Zeiss).

Analysis of retinal vasculature in whole mounted retinas

Eyes were isolated and incubated for 5 to 10 minutes in 2% PFA in PBS as described recently [42]. After removal of cornea and lens, the retina was dissected and flat-mounted in PBS. After postfixation in 4% PFA for 1 h at RT, flat-mounts were blocked (3% normal goat serum, 0.3% Triton X-100 in PBS, 1 h) and incubated with isolectin GS-IB4-Alexa594 (1:300, Thermo Fisher Scientific) at 4°C overnight. Retinas were washed in PBS, mounted on glass slides and analyzed by fluorescence microscopy (Axioplan/ApoTome; Zeiss). Blood vessels were reconstructed in three dimensions using Imaris software (Versions 7.7.2/8.3.0, Bitplane AG, Zurich, Switzerland). For better recognition and distinction of the vascular plexi, the z-value of the z-stacks was increased five times.

RNA isolation and semi-quantitative real-time PCR

Retinas were isolated through a slit in the cornea, frozen in liquid nitrogen and stored at -80°C. RNA was extracted using an RNA isolation kit (RNeasy; Qiagen, Hilden, Germany) including a DNAse treatment. 1 μg of RNA, oligo (dT) and M-MLV reverse transcriptase (Promega, Fitchburg, WI, USA) were used to prepare cDNA. To analyze gene expression by real-time PCR, 10 ng of cDNA template was amplified using a PCR polymerase ready mix (LightCycler 480 SYBR Green I Master, Roche Diagnostics, Rotkreuz, Switzerland), specific primer pairs (Table 1) and a thermocycler (LightCycler 480, Roche Diagnostics). Expression levels were normalized to β-actin (Actb) and relative expression was calculated using the comparative threshold cycle method (∆∆CT) of the LightCycler480 software (Roche Diagnostics). At least 3 mice per strain and time point were used.
Table 1

Primers used for real-time PCR

GeneForward (5’-3’)Reverse (5’-3’)Product (bp)
Actb CAACGGCTCCGGCATGTGCCTCTTGCTCTGGGCCTCG153
Adm TCCTGGTTTCTCGGCTTCTCATTCTGTGGCGATGCTCTGA133
Bnip3 CCTGTCGCAGTTGGGTTCGAAGTGCAGTTCTACCCAGGAG93
Casp1 GGCAGGAATTCTGGAGCTTCAAGTCAGTCCTGGAAATGTGCC138
Fgf2 TGTGTCTATCAAGGGAGTGTGTGCACCAACTGGAGTATTTCCGTGACCG158
Gfap CCACCAAACTGGCTGATGTCTACTTCTCTCCAAATCCACACGAGC240
Glut1 CAGTGTATCCTGTTGCCCTTCTGGCCGACCCTCTTCTTTCATCTC151
Pdgfb GCTGCTGCAATAACCGCAATGTGGTCCTCCAAGGTCACTG131
Pdgfrb CTTGCCCTTCAAAGTGGTGGCCAGGTGGAGTCGTAAGGC199
Egln1 GCAGCATGGACGACCTGATCAACGTGACGGACATAGCCT123
Sema3f CGTCGCGCACAGGATTAGGAAAATGGCTGCATCGGTA166
Timp3 GCCTCAAGCTAGAAGTCAACAAATGTACATCTTGCCTTCATACACG69
Vegf ACTTGTGTTGGGAGGAGGATGTCAATGGGTTTGTCGTGTTTCTGG171
vWF CCCTGGACAACTTGACAGCAGACAAGCAGGCAGATCTCATACC192
Primers used for real-time PCR

Protein isolation and Western blotting

Proteins were isolated by homogenizing the retinas in ice-cold Tris-HCl (100 mM, pH 7.5) using ultrasound at 4°C. Protein concentrations were determined spectrophotometrically by using Bradford reagent (Bio-Rad, Hercules, CA, USA). SDS-PAGE and Western blotting were performed as described [41] and proteins detected by rabbit anti-HIF1A (1:2000, NB100-479, Novus Biologicals, Littleton, CO, USA) and mouse anti-β-actin (1:10’000, A5441, Sigma-Aldrich) antibodies. HRP-conjugated secondary antibodies were applied for 1 h at RT and signals were visualized using Western lightning chemiluminescence reagent (PerkinElmer, Waltham, MA, USA) and X-ray films.

Electroretinography (ERG)

Mice were dark-adapted overnight and pupils were dilated under dim red light with 1% cyclogyl (Alcon Switzerland SA, Rotkreuz, Switzerland) and 5% neosynephrin-POS (Ursapharm Schweiz GmbH, Roggwil, Switzerland) 30 minutes prior to recording. Mice were anesthetized with a subcutaneous injection of ketamine (85 mg/kg, Pfizer PFE Switzerland GmbH, Zurich, Switzerland) and xylazine (Rompun 2%, 4mg/kg, Bayer, Leverkusen, Germany). To keep the cornea moist, a drop of mydriaticum dispersa (Omnivision AG, Neuhausen, Switzerland) was applied to each eye. Low background illumination for 5 min was used for light adaptation. Electroretinograms were recorded simultaneously from both eyes with an LKC UTAS Bigshot unit (LKC Technologies, Inc. Gaithersburg, MD, USA) as described [32]. Flashes of 8 different light intensities ranging from -10 to 25 dB (0.25–790.5694 cd*s/m2) were applied under photopic conditions. 10 responses were averaged per light intensity. Traces from n≥4 mice were averaged for each light intensity.

Fundus imaging and fluorescein angiography

Fundus photographs were taken with a Micron IV system (Phoenix Research Labs, Pleasanton, CA, USA). The pupils were dilated and the mice were anesthetized as described above. Methocel 2% (Omnivision) was applied to lubricate the eyes. Fluorescein images were captured 1-5 minutes after intraperitoneal injection of 20 μL of 2% fluorescein solution (Akorn, Lake Forest, IL, USA).

Experimental design and statistical analysis

Two-way ANOVA with Šídák’s multiple comparison test was performed using GraphPad Prism (version 7.02, GraphPad Software, San Diego, CA, USA) for statistical analysis of gene expression levels and ERG traces. All data are shown as means ± SD.

Results

Cone-specific inactivation of Vhl increased HIF1A target gene expression and induced progressive cone degeneration

Photoreceptors in the all-cone R91W;Nrl mouse are predominantly blue-light sensitive S-cones [32, 34]. Therefore, we used BP-Cre transgenic mice, which express functional Cre recombinase under the transcriptional control of the blue cone opsin promoter (BP, [36]) to delete floxed sequences from cones in the all-cone mice. BPCre;R91W;Nrl;ZsGreen reporter mice verified that Cre expression was uniform over the entire retina and restricted almost exclusively to the majority of cones in the ONL (Fig. 1a). Green fluorescence of the activated reporter protein was only occasionally detected in few cells of the inner retina. We validated Vhl excision in the BPCre;R91W;Nrl;Vhl (=cone) mouse line by analyzing genomic DNA isolated from retinal tissues of 4-week-old cone mice. The detection of a PCR product corresponding to the excised fragment suggested a successful Cre-mediated deletion of Vhl in retinas of cone but not of ctrl mice (=R91W;Nrl;Vhl, Fig. 1b). Genomic deletion of Vhl led to the accumulation of HIF1A protein (Fig. 1c) and to increased transcript levels of known hypoxic target genes such as adrenomedullin (Adm), egl-9 family hypoxia-inducible factor 1 (Egln1, also known as Phd2), glucose transporter 1 (Glut1) and BCL2/adenovirus E1B 19-kDa interacting protein 3 (Bnip3) in normoxic cone mice (Fig. 1d). This suggested that cells, presumably cones, activated a hypoxia-like response in retinas of cone mice.
Fig. 1

Knockdown of Vhl in cones of the all-cone mouse (cone). a Expression of Cre recombinase in BPCre;R91W;Nrl;ZsGreen mice. Green fluorescence (ZsGreen) indicates Cre activity. RPE: retinal pigment epithelium, ONL: outer nuclear layer, INL: inner nuclear layer, IPL: inner plexiform layer, GCL: ganglion cell layer. Scale bar 50 μm. b PCR of genomic DNA from retinas of 4-week-old ctrl and cone mice. Floxed Vhl (fl) is detected at 460 bp and Cre-mediated excision (ex) results in a 260 bp fragment. c Western blot analysis of HIF1A in 4, 6, 8 and 12-week-old cone and ctrl (littermates without Cre recombinase) mice. ACTB served as loading control. d Relative expression of hypoxic target genes in retinas of ctrl (black) and cone (orange) mice. Expression levels were normalized to beta-actin (Actb) and calculated relatively to 4-week-old ctrl mice, which were set to 1. Shown are means ± SD. Two-way ANOVA with Šídák’s multiple comparison test was used for statistical analysis (Adm: ****p<0.0001, *p=0.0306; Egln1: ****p<0.0001; Glut1: ****p<0.0001; Bnip3: ****p<0.0001, **p=0.0043; n≥3 per time point). Adm: Adrenomedullin, Egln1: egl-9 family hypoxia-inducible factor 1, Glut1: Glucose transporter 1, Bnip3: BCL2/adenovirus E1B interacting protein 3. Cre-negative littermates were used as ctrl mice in all experiments unless otherwise indicated

Knockdown of Vhl in cones of the all-cone mouse (cone). a Expression of Cre recombinase in BPCre;R91W;Nrl;ZsGreen mice. Green fluorescence (ZsGreen) indicates Cre activity. RPE: retinal pigment epithelium, ONL: outer nuclear layer, INL: inner nuclear layer, IPL: inner plexiform layer, GCL: ganglion cell layer. Scale bar 50 μm. b PCR of genomic DNA from retinas of 4-week-old ctrl and cone mice. Floxed Vhl (fl) is detected at 460 bp and Cre-mediated excision (ex) results in a 260 bp fragment. c Western blot analysis of HIF1A in 4, 6, 8 and 12-week-old cone and ctrl (littermates without Cre recombinase) mice. ACTB served as loading control. d Relative expression of hypoxic target genes in retinas of ctrl (black) and cone (orange) mice. Expression levels were normalized to beta-actin (Actb) and calculated relatively to 4-week-old ctrl mice, which were set to 1. Shown are means ± SD. Two-way ANOVA with Šídák’s multiple comparison test was used for statistical analysis (Adm: ****p<0.0001, *p=0.0306; Egln1: ****p<0.0001; Glut1: ****p<0.0001; Bnip3: ****p<0.0001, **p=0.0043; n≥3 per time point). Adm: Adrenomedullin, Egln1: egl-9 family hypoxia-inducible factor 1, Glut1: Glucose transporter 1, Bnip3: BCL2/adenovirus E1B interacting protein 3. Cre-negative littermates were used as ctrl mice in all experiments unless otherwise indicated We observed an age-dependent decline in HIF1A protein levels and hypoxia target gene expression in cone mice (Fig. 1c, d). This prompted us to analyze retinal function and morphology. B-wave amplitudes and photopic ERGs were not significantly different between cone mice and ctrl mice at 6 weeks of age (Fig. 2a). However, the amplitudes were strongly reduced in 12-week-old cone mice as compared to age-matched ctrl mice (Fig. 2b). This indicated an age-dependent loss of function potentially due to retinal degeneration. Indeed, we observed severe, progressive thinning of the outer nuclear layer (ONL) in cone mice with most cones lost at 26 weeks of age (Fig. 3a, b). Additionally, partial loss of the retinal pigment epithelium (RPE) and strong perturbations in the inner nuclear layer (INL) were detected in older cone mice (Fig. 3a, 12we cone). In contrast, the ctrl mice showed only a slow age-related ONL thinning, as reported for the parental R91W;Nrl mouse line before [32].
Fig. 2

Reduced retinal function in aged cone mice. a Averaged traces of single-flash photopic ERGs and b-wave amplitudes showed no significant differences in cone mice (orange) compared to ctrl mice (black) at 6 weeks of age. b At 12 weeks of age, photopic b-wave amplitudes were strongly reduced in cone mice (orange) as compared to ctrl mice (black). b-wave amplitudes are shown as means ± SD. Two-way ANOVA with Šídák’s multiple comparison test was used for statistical analysis (6we ctrl and cone n=5, 12we ctrl n=6 and cone n=4, *p=0.0115, ****p<0.0001)

Fig. 3

Progressive cone degeneration in cone mice. a Inactivation of Vhl in cones led to progressive retinal degeneration (upper panels) as compared to ctrl mice (lower panels). Cone mice displayed disturbed layering with reorganization of the INL (asterisk, 12we cone), severe loss of the ONL and partial loss of the RPE (arrowhead, 12we cone, inset) at 12 and 26 weeks of age. Abbreviations as in Fig. 1. Scale bar 50 μm. b Line chart of ONL thickness in cone mice (orange) as compared to ctrl mice (black) at 4 and 12 weeks of age. n≥3. c Relative expression levels of genes involved in stress signaling and degeneration. Expression levels were normalized to Actb and calculated relatively to 4-week-old ctrl mice, which were set to 1. Shown are means ± SD. Two-way ANOVA with Šídák’s multiple comparison test was used for statistical analysis (Casp1: **p=0.0026, ****p<0.0001, *p=0.0244, Gfap: ****p<0.0001, **p=0.0035, ***p=0.0004, ****p<0.0001, Timp3: *p=0.0235, **p=0.0036, **p=0.0035, Vegf: ****p<0.0001, n≥3 per time point). Casp1: caspase 1, Gfap: glial fibrillary acidic protein, Timp3: tissue inhibitor of metalloproteinase 3, Vegf: vascular endothelial growth factor

Reduced retinal function in aged cone mice. a Averaged traces of single-flash photopic ERGs and b-wave amplitudes showed no significant differences in cone mice (orange) compared to ctrl mice (black) at 6 weeks of age. b At 12 weeks of age, photopic b-wave amplitudes were strongly reduced in cone mice (orange) as compared to ctrl mice (black). b-wave amplitudes are shown as means ± SD. Two-way ANOVA with Šídák’s multiple comparison test was used for statistical analysis (6we ctrl and cone n=5, 12we ctrl n=6 and cone n=4, *p=0.0115, ****p<0.0001) Progressive cone degeneration in cone mice. a Inactivation of Vhl in cones led to progressive retinal degeneration (upper panels) as compared to ctrl mice (lower panels). Cone mice displayed disturbed layering with reorganization of the INL (asterisk, 12we cone), severe loss of the ONL and partial loss of the RPE (arrowhead, 12we cone, inset) at 12 and 26 weeks of age. Abbreviations as in Fig. 1. Scale bar 50 μm. b Line chart of ONL thickness in cone mice (orange) as compared to ctrl mice (black) at 4 and 12 weeks of age. n≥3. c Relative expression levels of genes involved in stress signaling and degeneration. Expression levels were normalized to Actb and calculated relatively to 4-week-old ctrl mice, which were set to 1. Shown are means ± SD. Two-way ANOVA with Šídák’s multiple comparison test was used for statistical analysis (Casp1: **p=0.0026, ****p<0.0001, *p=0.0244, Gfap: ****p<0.0001, **p=0.0035, ***p=0.0004, ****p<0.0001, Timp3: *p=0.0235, **p=0.0036, **p=0.0035, Vegf: ****p<0.0001, n≥3 per time point). Casp1: caspase 1, Gfap: glial fibrillary acidic protein, Timp3: tissue inhibitor of metalloproteinase 3, Vegf: vascular endothelial growth factor To gain insight into cellular mechanisms leading to cone degeneration, we analyzed expression of specific genes during aging in cone and ctrl mice (Fig. 3c). Caspase 1 (Casp1), a gene involved in retinal degeneration, was upregulated in cone mice at 8 weeks and peaked at 12 weeks of age. Expression of the stress signaling gene glial fibrillary acidic protein (Gfap) was upregulated in cone mice already at 4 weeks and remained elevated throughout the observation period. Interestingly, we observed increased expression of tissue inhibitor of metalloproteinase 3 (Timp3) during the aging process, a gene associated with age-related macular degeneration [43, 44]. Similarly, expression of vascular endothelial growth factor (Vegf), a hypoxic response gene that is involved in neovascularization in wet AMD, was strongly increased in cone mice at 4 and 6 weeks of age.

Subretinal neovascularization and vascular leakage in cone mice

Increased transcription of Timp3 is potentially associated with a higher risk to develop neovascular AMD [43] and hypoxia-regulated genes such as Vegf contribute to retinal and choroidal neovascularization (reviewed in [45]). Therefore, we analyzed the vascular network of cone mice. All three vascular plexi were detected at 4 weeks of age (Fig. 4a, b, c). However, we observed vessels extending from the deep plexus into the normally avascular ONL in central retinas of cone mice (Fig. 4a, arrowheads). Vessels reached the RPE but did not cross Bruch’s membrane (Fig. 4d, e), as we never observed retinal-choroidal anastomoses. This suggests that abnormal vessels originated from the retinal vasculature and not from the choroid. Interestingly, abnormal vessel growth was characteristic for the central but not for the peripheral retina (Fig. 4b). To evaluate the integrity of retinal vessels we performed fluorescein angiography. Signs of leakage were observed in cone mice (Fig. 4f, g). To confirm these findings we stained retinal cross-sections for albumin (ALB), a marker for blood extravasation. Detailed analysis revealed strong ALB immunoreactivity in the ONL, RPE and inner plexiform layer (IPL) in cone mice, as opposed to the signal detected in ctrl mice that was confined to retinal vessels. The choroid with its extensive vasculature was also strongly positive for ALB in both types of mice (Fig. 4h, i). Microglia/macrophages detected by IBA1 staining were found within the photoreceptor and subretinal layer in cone but not ctrl mice (Fig. 4j, k).
Fig. 4

Subretinal neovascularization in cone mice. a-c Immunostaining of cross-sections of the central (a) and peripheral (b) retina of 4-week-old cone and age-matched ctrl mice (c, central retina) with isolectin. Arrowheads indicate vessels extending from the deep plexus into the ONL in central retinas of cone mice. DP: deep plexus, IP: intermediate plexus, PP: primary plexus. Scale bar 50 μm. d, e Light microscopy of 4-week-old cone and ctrl mice. Neovessels (arrowheads) reached the RPE, but did not cross Bruch’s membrane. Scale bar 20 μm. f, g Fundus imaging and fluorescein angiography of cone mice and ctrl mice at 4 weeks of age. Signs of leakage (arrowhead) were detected in cone mice. h-k Retinal cross-sections of ctrl h, j and cone mice (i, k) were stained with antibodies against ALB (h, i) and IBA1 (j, k) at 4 weeks of age. Microglia/macrophages were found within the photoreceptor layer and RPE in cone mice (arrowheads). Scale bar 50 μm. Abbreviations as in Fig. 1

Subretinal neovascularization in cone mice. a-c Immunostaining of cross-sections of the central (a) and peripheral (b) retina of 4-week-old cone and age-matched ctrl mice (c, central retina) with isolectin. Arrowheads indicate vessels extending from the deep plexus into the ONL in central retinas of cone mice. DP: deep plexus, IP: intermediate plexus, PP: primary plexus. Scale bar 50 μm. d, e Light microscopy of 4-week-old cone and ctrl mice. Neovessels (arrowheads) reached the RPE, but did not cross Bruch’s membrane. Scale bar 20 μm. f, g Fundus imaging and fluorescein angiography of cone mice and ctrl mice at 4 weeks of age. Signs of leakage (arrowhead) were detected in cone mice. h-k Retinal cross-sections of ctrl h, j and cone mice (i, k) were stained with antibodies against ALB (h, i) and IBA1 (j, k) at 4 weeks of age. Microglia/macrophages were found within the photoreceptor layer and RPE in cone mice (arrowheads). Scale bar 50 μm. Abbreviations as in Fig. 1

Early vascular defects in cone mice

S-opsin expression starts shortly before birth in mice [46, 47] and we observed Cre-activity in BPCre;R91W;Nrl;ZsGreen reporter mice as early as at postnatal day (PND) 1 (data not shown). The primary plexus in mice develops along a central-to-peripheral gradient and reaches the periphery around PND8-10 [48]. Vessels sprout from the primary plexus into the retina and turn laterally when they reach the outer and inner boundaries of the INL to first form the deep plexus and subsequently the intermediate plexus [48]. To determine the onset of neovascularization in cone mice we stained retinal flat mounts with isolectin at PND7 and PND11. Using 3D-reconstruction of blood vessels, no difference in early vessel formation was detected between cone and ctrl mice at PND7 (Fig. 5a). However, at PND11, before formation of the intermediate plexus, vessels growing from the deep plexus into the ONL were observed in cone mice (Fig. 5b).
Fig. 5

Pathological vessel growth starts around PND11 in cone mice. a, b 3D-reconstruction of blood vessels stained with isolectin on retinal flat mounts of ctrl (left) and cone (right) mice at PND7 (a) and PND 11 (b). At PND11, vessels extended from the deep plexus towards the ONL. The intermediate plexus has not yet been formed in both ctrl and cone mice. For better recognition and distinction the z-value of the z-stacks was increased five times. DP: deep plexus, PP: primary plexus. Scale bar 50 μm. c Relative expression levels of angiogenic genes in retinas of cone (orange), ctrl (black) and wt (green) mice at indicated time points. Expression levels were normalized to Actb and compared to ctrl mice at PND7, which were set to 1. Shown are means ± SD. Two-way ANOVA with Šídák’s multiple comparison test was used for statistical analysis comparing ctrl with cone mice (Vegf: ****p<0.0001, Fgf2: ****p<0.0001, Pdgfb: ***p=0.0009, n=3 per time point). Vegf: vascular endothelial growth factor, Fgf2: fibroblast growth factor 2, Sema3f: semaphorin 3F, Pdgfb: platelet derived growth factor, B polypeptide, vWf: von Willebrand factor, Pdgfrb: platelet derived growth factor receptor, beta polypeptide

Pathological vessel growth starts around PND11 in cone mice. a, b 3D-reconstruction of blood vessels stained with isolectin on retinal flat mounts of ctrl (left) and cone (right) mice at PND7 (a) and PND 11 (b). At PND11, vessels extended from the deep plexus towards the ONL. The intermediate plexus has not yet been formed in both ctrl and cone mice. For better recognition and distinction the z-value of the z-stacks was increased five times. DP: deep plexus, PP: primary plexus. Scale bar 50 μm. c Relative expression levels of angiogenic genes in retinas of cone (orange), ctrl (black) and wt (green) mice at indicated time points. Expression levels were normalized to Actb and compared to ctrl mice at PND7, which were set to 1. Shown are means ± SD. Two-way ANOVA with Šídák’s multiple comparison test was used for statistical analysis comparing ctrl with cone mice (Vegf: ****p<0.0001, Fgf2: ****p<0.0001, Pdgfb: ***p=0.0009, n=3 per time point). Vegf: vascular endothelial growth factor, Fgf2: fibroblast growth factor 2, Sema3f: semaphorin 3F, Pdgfb: platelet derived growth factor, B polypeptide, vWf: von Willebrand factor, Pdgfrb: platelet derived growth factor receptor, beta polypeptide Formation of the deep plexus is preceded by Vegf expression in the INL [49]. We analyzed gene expression levels in cone, ctrl and 129S6 (wt, rod-dominant retina) mice to test for different regulation of genes involved in angiogenesis and vessel guidance during and after the process of vessel formation (PND7, 14 and 28, Fig. 5c). Vegf mRNA was not elevated at PND7, slightly increased by 1.3-fold at PND14 and significantly increased at PND28 (2-fold) in cone mice compared to controls. Fibroblast growth factor 2 (Fgf2), a potent angiogenic factor that has been shown to be involved in retinal stress [50-52], was upregulated at PND28, at a time when developmental vascularization is completed. Recently, protective effects of semaphorin 3F (Sema3f) against subretinal neovascularization have been demonstrated [53]. We thus analyzed Sema3f gene expression levels to test for potential differential expression of this anti-angiogenic factor in cone mice. However, expression of Sema3f in all-cone mice did not differ between ctrl and cone mice (Fig. 5c). On the other hand, a pro-angiogenic factor, platelet derived growth factor, B polypeptide (Pdgfb), was upregulated in cone compared to ctrl mice at PND28. Pdgfb expression by endothelial cells is essential for pericyte recruitment and is increased under hypoxia [54-57]. Surprisingly, expression levels of von Willebrand factor (vWf), a marker for endothelial cells, as well as of Pdgfb receptor (Pdgfrb), which is expressed by pericytes/mural cells [58-61], were not increased in cone mice as compared to controls. The reason for this unexpected pattern of expression is not clear and requires further investigation.

HIF1 is responsible for pathological vessel growth and progressive cone degeneration in cone mice

We hypothesized that stabilized HIF1A, and not other Vhl targets, might promote retinal degeneration and neovascularization in cone mice. Therefore, we additionally deleted Hif1a in cone photoreceptors (BPCre;R91W;Nrl;Vhl;Hif1a=cone). After we confirmed the presence of deletion alleles for both Hif1a and Vhl in genomic DNA of cone retinas (not shown) we determined retinal function. At 12 weeks of age, photopic ERG traces and b-wave amplitudes were similar in cone and ctrl (R91W;Nrl; Vhl;Hif1a) mice (Fig. 6a, b) indicating no functional loss upon combined Hif1a and Vhl inactivation. Similarly, retinal morphology (Fig. 6c) and ONL thickness (Fig. 6d) of cone mice was comparable to ctrl mice, whereas the thickness of the ONL in cone mice was prominently reduced (same data as in Fig. 3b) at 12 weeks of age.
Fig. 6

Combined deletion of Hif1a and Vhl (cone) rescues the defects in retinal function, morphology and vasculature observed in cone mice. a, b Average single-flash photopic ERGs and b-wave amplitudes showed no significant differences in cone mice (green) compared to ctrl mice (R91W;Nrl;Vhl; Hif1a, black) at 12 weeks of age. n=4 per group. b-wave amplitudes are shown as means ± SD. c, d Light microscopy analysis and measurement of the ONL thickness in cone (green), ctrl mice (R91W;Nrl;Vhl; Hif1a, black) and cone mice (orange, as shown in Fig. 3b) at indicated time points. Abbreviations as in Fig. 1. Scale bar 50 μm. e 3D-reconstruction of blood vessels stained with isolectin on retinal flat mounts of ctrl (left), cone (middle) and cone mice (right). Inactivation of Hif1a (cone) rescued the pathological neovascularization. Analysis at 4 weeks of age, n=3. For better recognition and distinction the z-value of the z-stacks was increased five times. The yellow line indicates the border between the outer plexiform layer (OPL) and the ONL. DP: deep plexus, IP: intermediate plexus, PP: primary plexus. f Relative gene expression of hypoxic target genes in cone mice (green) and ctrl mice (R91W;Nrl;Vhl; Hif1a, black) at 4we, 8we and 12we as indicated. Abbreviations as in Figs. 1 and 3. Expression levels were normalized to Actb and compared to 4-week-old ctrl mice, which were set to 1. Shown are means ± SD. n≥3 per time point. Scale bar 50 μm

Combined deletion of Hif1a and Vhl (cone) rescues the defects in retinal function, morphology and vasculature observed in cone mice. a, b Average single-flash photopic ERGs and b-wave amplitudes showed no significant differences in cone mice (green) compared to ctrl mice (R91W;Nrl;Vhl; Hif1a, black) at 12 weeks of age. n=4 per group. b-wave amplitudes are shown as means ± SD. c, d Light microscopy analysis and measurement of the ONL thickness in cone (green), ctrl mice (R91W;Nrl;Vhl; Hif1a, black) and cone mice (orange, as shown in Fig. 3b) at indicated time points. Abbreviations as in Fig. 1. Scale bar 50 μm. e 3D-reconstruction of blood vessels stained with isolectin on retinal flat mounts of ctrl (left), cone (middle) and cone mice (right). Inactivation of Hif1a (cone) rescued the pathological neovascularization. Analysis at 4 weeks of age, n=3. For better recognition and distinction the z-value of the z-stacks was increased five times. The yellow line indicates the border between the outer plexiform layer (OPL) and the ONL. DP: deep plexus, IP: intermediate plexus, PP: primary plexus. f Relative gene expression of hypoxic target genes in cone mice (green) and ctrl mice (R91W;Nrl;Vhl; Hif1a, black) at 4we, 8we and 12we as indicated. Abbreviations as in Figs. 1 and 3. Expression levels were normalized to Actb and compared to 4-week-old ctrl mice, which were set to 1. Shown are means ± SD. n≥3 per time point. Scale bar 50 μm Combined deletion of Hif1a and Vhl also prevented pathological neovascularization into the ONL but had no effect on the developmental formation of the three vascular plexi (Fig. 6e). No induction of the expression of hypoxic target genes such as Adm, Egln1, Vegf and Timp3 was detected in cone mice, confirming that HIF1 was the responsible HIF isoform for regulating their expression in cones (Fig. 6f). Altogether, these data demonstrate that combined deletion of Hif1a and Vhl (cone mice) rescues the retinal phenotype observed in cone mice and identify HIF1 as the causative factor for retinal degeneration and pathological vessel growth in cone mice.

Discussion

Previously, it has been demonstrated that the knockdown of Vhl in rod cells causes HIF1A stabilization under normoxic conditions [39]. Here, we particularly investigated the effects of a chronic hypoxia-like response in cone photoreceptors. We show that ablation of Vhl in cones resulted in a chronic hypoxia-like situation with accumulation of HIF1A and induction of HIF1A target genes. This led to pathological vessel growth into the photoreceptor layer, reduced retinal function and severe, progressive cone degeneration. These consequences resemble some of the features of AMD pathology, particularly of a subset of neovascular AMD known as RAP. In human patients, HIF1A and HIF2A were detected in macrophages and endothelial cells of neovascular membranes associated with AMD [62]. Additionally, the correlation of drusen density and decreased choroidal blood flow [26] as well as choroidal ischemia in AMD patients [23-25] suggest reduced oxygen transport from the choroid to the inner retina [63]. Therefore, tissue hypoxia and HIFs might play an important role in disease development and/or progression. Expression of numerous genes involved in metabolism, stress, cell survival and angiogenesis was increased in cone mice (Fig. 1d, 3c, 5c), as was Timp3 (Fig. 3c). TIMP3 is an important regulator of extracellular matrix (ECM) remodeling through inhibition of matrix metalloproteases and has been suggested to be a senescence-related protein [64] that is potentially regulated by HIF2 in rods [38]. Importantly, TIMP3 inhibits angiogenesis by interacting with VEGF [65] and is relevant for Bruch’s membrane integrity [64, 66]. Furthermore, mutations in Timp3 have been associated with Sorsby’s fundus dystrophy, an autosomal dominant maculopathy with submacular choroidal neovascularization [67, 68]. We can only speculate about the reasons for elevated Timp3 during the aging process in cone mice but it seems plausible that retinas of cone mice require extensive ECM remodeling due to progressive cone degeneration (Fig. 3). We detected early and prominent vascular defects with abnormal vessel growth into the ONL, subretinal space and RPE layer in cone mice. Increased VEGF levels in transgenic mice expressing Vegf under the transcriptional control of the rhodopsin promoter (rho/VEGF mice) were shown to cause subretinal neovascularization [69-71]. In our model, Vegf was not upregulated at PND14, at a time when vessels had already started growing into the ONL (Fig. 5). However, transient Vegf expression in the INL regulates the formation of the deep plexus during development [49], i.e. already minor changes in the local Vegf concentration gradient, which are not detectable by RT-PCR, may misguide retinal vessels in cone mice. To date, it remains unclear which pro-angiogenic factor(s) are responsible for the observed neovascularization. Nonetheless, our findings demonstrate that this is a Hif1a-mediated mechanism, as additional deletion of Hif1a fully rescued the vascular defects (Fig. 6). Interestingly, cone-specific deletion of Hif1a did not affect formation of the three vascular plexi (Fig. 6e), while it has been shown that knockdown of Hif1a in most cells of the retinal periphery prevented formation of the intermediate plexus [42]. Thus, our results suggest that Hif1a expression in cones, as opposed to other cells presumably in the INL, is not essential for the development of the intermediate plexus. Our data do not define whether cone degeneration in cone mice is due to the effects of the chronic intrinsic activation of the hypoxic response or to early development of vascular defects. Another mouse model shows, however, that a chronic hypoxia-like response in rods leads to slow photoreceptor degeneration in the absence of reported vascular defects (rod mice [39]). This suggests that the long-term activation of HIF1 may reduce cell survival by an intrinsic mechanism. During hypoxia, HIF1 regulates mitochondrial respiration and thus metabolic adaptation towards glycolysis [72] leading to reduced energy (ATP) levels and potentially starvation. It has been shown that starvation of cones may lead to cone cell death [73]. Furthermore, it has been suggested that cones might be more sensitive to reduced oxygen and nutrient levels compared to rods, for reasons not fully understood [74, 75]. This could possibly explain the progressive degeneration and the accelerated phenotype in cone compared to rod mice. It might also be possible, however, that photoreceptor degeneration is secondary to the early pathological vascular defects. Inactivation of Vhl in the retinal periphery during development leads to vessel growth into the ONL and severe retinal degeneration [52, 76]. Whereas the retinal periphery was strongly degenerated at 10 weeks of age, photoreceptor loss in the normal vascularized central retina was less pronounced [52]. We observed microglia activation and impaired function of the blood-retina-barrier in cone mice, as shown by IBA1 and ALB staining, respectively (Fig. 4h-k). It seems likely that retinal hemorrhages exacerbate cone photoreceptor degeneration in our model, as suggested for other models [77, 78]. Photoreceptor degeneration was also observed in very low density lipoprotein receptor knockout mice (Vldlr; [79]) where early retinal neovascularization causes vessels to extend from the deep plexus into the subretinal space [80, 81]. Interestingly, it has been suggested that the Vldlr phenotype is linked to HIF1A. Joyal and colleagues proposed that starved Vldlr photoreceptors have reduced amounts of the Krebs cycle metabolite α-ketoglutarate, which decreases PHD activity and thus promotes stabilization of HIF1A. Consequently, Vegf is secreted, leading to RAP-like neovascularization [82]. We hypothesize that the combination of early vascular defects and the activation of a chronic hypoxia-like response, which affects expression of genes involved in cellular metabolism and retinal stress, leads to the progressive cone degeneration observed in cone mice. Our findings identify HIF1 in cones as the factor causing cone degeneration, pathological neovascularization and loss of function. Similarly, chronic activation of the hypoxic response in rods resulted in an HIF1- and age-dependent retinal degeneration (Barben et al., submitted). Whereas this provides strong evidence that activation of HIF1 in rod and cone photoreceptors leads to retinal degeneration, the activation of HIF2 but not of HIF1 is responsible for metabolic stress in RPE upon RPE-specific Vhl inactivation [75]. Thus, our data and data published by others suggest cell type-specific roles for HIF1A and HIF2A in retinal pathology.

Conclusions

Our data demonstrate that a chronic hypoxic response in cone photoreceptors induces HIF1A-mediated pathological vessel growth and cone degeneration. Evidence shows that HIF1A can be safely inactivated in cones (see above), rods ([38], Barben et al., submitted) and RPE [75] suggesting that targeting HIF transcription factors in photoreceptors and RPE may provide a potential therapeutic approach to rescue hypoxia-mediated retinal degeneration in patients and an alternative to anti-VEGF agents.
  81 in total

1.  Hypoxic preconditioning protects photoreceptors against light damage independently of hypoxia inducible transcription factors in rods.

Authors:  Brigitte Kast; Christian Schori; Christian Grimm
Journal:  Exp Eye Res       Date:  2015-12-22       Impact factor: 3.467

2.  Pericyte loss and microaneurysm formation in PDGF-B-deficient mice.

Authors:  P Lindahl; B R Johansson; P Levéen; C Betsholtz
Journal:  Science       Date:  1997-07-11       Impact factor: 47.728

3.  Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation.

Authors:  P Jaakkola; D R Mole; Y M Tian; M I Wilson; J Gielbert; S J Gaskell; A von Kriegsheim; H F Hebestreit; M Mukherji; C J Schofield; P H Maxwell; C W Pugh; P J Ratcliffe
Journal:  Science       Date:  2001-04-05       Impact factor: 47.728

4.  Changes of retinal capillary blood flow in age-related maculopathy.

Authors:  H Remsch; C W Spraul; G K Lang; G E Lang
Journal:  Graefes Arch Clin Exp Ophthalmol       Date:  2000-12       Impact factor: 3.117

5.  Leukemia inhibitory factor extends the lifespan of injured photoreceptors in vivo.

Authors:  Sandrine Joly; Christina Lange; Markus Thiersch; Marijana Samardzija; Christian Grimm
Journal:  J Neurosci       Date:  2008-12-17       Impact factor: 6.167

6.  Normal plasma lipoproteins and fertility in gene-targeted mice homozygous for a disruption in the gene encoding very low density lipoprotein receptor.

Authors:  P K Frykman; M S Brown; T Yamamoto; J L Goldstein; J Herz
Journal:  Proc Natl Acad Sci U S A       Date:  1995-08-29       Impact factor: 11.205

Review 7.  Regulatory role of HIF-1alpha in the pathogenesis of age-related macular degeneration (AMD).

Authors:  Olli Arjamaa; Mikko Nikinmaa; Antero Salminen; Kai Kaarniranta
Journal:  Ageing Res Rev       Date:  2009-07-07       Impact factor: 10.895

Review 8.  Clinical risk factors for age-related macular degeneration: a systematic review and meta-analysis.

Authors:  Usha Chakravarthy; Tien Y Wong; Astrid Fletcher; Elisabeth Piault; Christopher Evans; Gergana Zlateva; Ronald Buggage; Andreas Pleil; Paul Mitchell
Journal:  BMC Ophthalmol       Date:  2010-12-13       Impact factor: 2.209

9.  Retinal degeneration modulates intracellular localization of CDC42 in photoreceptors.

Authors:  S R Heynen; N Tanimoto; S Joly; M W Seeliger; M Samardzija; C Grimm
Journal:  Mol Vis       Date:  2011-11-15       Impact factor: 2.367

10.  Retinal lipid and glucose metabolism dictates angiogenesis through the lipid sensor Ffar1.

Authors:  Jean-Sébastien Joyal; Ye Sun; Marin L Gantner; Zhuo Shao; Lucy P Evans; Nicholas Saba; Thomas Fredrick; Samuel Burnim; Jin Sung Kim; Gauri Patel; Aimee M Juan; Christian G Hurst; Colman J Hatton; Zhenghao Cui; Kerry A Pierce; Patrick Bherer; Edith Aguilar; Michael B Powner; Kristis Vevis; Michel Boisvert; Zhongjie Fu; Emile Levy; Marcus Fruttiger; Alan Packard; Flavio A Rezende; Bruno Maranda; Przemyslaw Sapieha; Jing Chen; Martin Friedlander; Clary B Clish; Lois E H Smith
Journal:  Nat Med       Date:  2016-03-14       Impact factor: 53.440

View more
  12 in total

1.  Rb1/Rbl1/Vhl loss induces mouse subretinal angiomatous proliferation and hemangioblastoma.

Authors:  Ran Wei; Xiang Ren; Hongyu Kong; Zhongping Lv; Yongjiang Chen; Yunjing Tang; Yujiao Wang; Lirong Xiao; Tao Yu; Sabiha Hacibekiroglu; Chen Liang; Andras Nagy; Rod Bremner; Danian Chen
Journal:  JCI Insight       Date:  2019-11-14

2.  A Novel Hypoxia-inducible Factor 1α Inhibitor KC7F2 Attenuates Oxygen-induced Retinal Neovascularization.

Authors:  Xiaoyu Tang; Kaixuan Cui; Xi Lu; Peiqi Wu; Shanshan Yu; Boyu Yang; Yue Xu; Xiaoling Liang
Journal:  Invest Ophthalmol Vis Sci       Date:  2022-06-01       Impact factor: 4.925

3.  Autosomal dominant retinitis pigmentosa-associated gene PRPF8 is essential for hypoxia-induced mitophagy through regulating ULK1 mRNA splicing.

Authors:  Guang Xu; Ting Li; Jiayi Chen; Changyan Li; Haixin Zhao; Chengcheng Yao; Hua Dong; Kaiqing Wen; Kai Wang; Jie Zhao; Qing Xia; Tao Zhou; Huafeng Zhang; Ping Gao; Ailing Li; Xin Pan
Journal:  Autophagy       Date:  2018-08-13       Impact factor: 16.016

4.  Impaired ABCA1/ABCG1-mediated lipid efflux in the mouse retinal pigment epithelium (RPE) leads to retinal degeneration.

Authors:  Federica Storti; Katrin Klee; Vyara Todorova; Regula Steiner; Alaa Othman; Saskia van der Velde-Visser; Marijana Samardzija; Isabelle Meneau; Maya Barben; Duygu Karademir; Valda Pauzuolyte; Sanford L Boye; Frank Blaser; Christoph Ullmer; Joshua L Dunaief; Thorsten Hornemann; Lucia Rohrer; Anneke den Hollander; Arnold von Eckardstein; Jürgen Fingerle; Cyrille Maugeais; Christian Grimm
Journal:  Elife       Date:  2019-03-13       Impact factor: 8.140

Review 5.  The Different Facades of Retinal and Choroidal Endothelial Cells in Response to Hypoxia.

Authors:  Effat Alizadeh; Parviz Mammadzada; Helder André
Journal:  Int J Mol Sci       Date:  2018-12-03       Impact factor: 5.923

6.  Hif1a and Hif2a can be safely inactivated in cone photoreceptors.

Authors:  Marijana Samardzija; Maya Barben; Vyara Todorova; Katrin Klee; Federica Storti; Christian Grimm
Journal:  Sci Rep       Date:  2019-11-06       Impact factor: 4.379

7.  Electrophysiological mechanisms underlying hypoxia-induced deficits in visual spatial and non-spatial discrimination.

Authors:  Qi Qiu; Pengpeng Lv; Yihao Zhongshen; Fengjuan Yuan; Xinjuan Zhang; Xiuzhu Zhou; Shanhua Li; Xiaonan Liu; Jiaxing Zhang
Journal:  Physiol Rep       Date:  2021-09

8.  DIX domain containing 1 (DIXDC1) modulates VEGFR2 level in vasculatures to regulate embryonic and postnatal retina angiogenesis.

Authors:  Yeaji Kim; Dong Young Kim; Haiying Zhang; Cho-Rong Bae; Daehyeon Seong; Yeomyung Kim; Jaewhan Song; Young-Myeong Kim; Young-Guen Kwon
Journal:  BMC Biol       Date:  2022-02-10       Impact factor: 7.431

9.  Selective Histone Deacetylase 6 Inhibitors Restore Cone Photoreceptor Vision or Outer Segment Morphology in Zebrafish and Mouse Models of Retinal Blindness.

Authors:  Husvinee Sundaramurthi; Sarah L Roche; Guinevere L Grice; Ailis Moran; Eugene T Dillion; Giuseppe Campiani; James A Nathan; Breandán N Kennedy
Journal:  Front Cell Dev Biol       Date:  2020-08-26

10.  APE1/Ref-1 as a Novel Target for Retinal Diseases.

Authors:  Curtis Heisel; Jonah Yousif; Mahmut Mijiti; Kostas Charizanis; Mitchel Brigell; Timothy W Corson; Mark R Kelley
Journal:  J Cell Signal       Date:  2021
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.