Aptamer-Based Impedimetric Assay of Arsenite in Water: Interfacial Properties and Performance.

In this work, we explore the use of electrochemical methods (i.e., impedance) along with the arsenic-specific aptamer (ArsSApt) to fabricate and study the interfacial properties of an arsenic (As(III)) sensor. The ArsSApt layer was self-assembled on a gold substrate, and upon binding of As(III), a detectable change in the impedimetric signal was recorded because of conformational changes at the interfacial layer. These interfacial changes are linearly correlated with the concentration of arsenic present in the system. This target-induced signal was utilized for the selective detection of As(III) with a linear dynamic range of 0.05-10 ppm and minimum detectable concentrations of ca. 0.8 μM. The proposed system proved to be successful mainly because of the combination of a highly sensitive electrochemical platform and the recognized specificity of the ArsSApt toward its target molecule. Also, the interaction between the ArsSApt and the target molecule (i.e., arsenic) was explored in depth. The obtained results in this work are aimed at proving the development of a simple and environmentally benign sensor for the detection of As(III) as well as in elucidating the possible interactions between the ArsSApt and arsenic molecules.

Introduction

Arsenic is an extremely toxic substance commonly found in surface and groundwater due to both natural and anthropogenic sources.[1,2] The toxicity of arsenic is dependent on the oxidation state of the species, with arsenites (i.e., arsenic trioxide, As3+) and arsenates (arsenic pentoxide, As5+) being the most toxic forms.[3,4] Such species are found in well drinking water and have been the cause of about 300 000 deaths from cancer in Bangladesh alone.[5,6] Undoubtedly, ingestion of inorganic arsenic is an important public health problem worldwide. In 2001, the US Environmental Protection Agency set the minimum contaminant level for arsenic to 10 ppb, recognizing the deleterious effects of arsenic on humans. Consequently, developing methods for the safe detection of this substance in water at the levels of compliance (10 ppb according to WHO) is a pressing need.

Currently, the accurate and reliable measurement of inorganic arsenic requires the use of expensive equipment and facilities (e.g., ICP–MS, HPLC–ICP–MS, and ASV among others).[6] Thus, the use of arsenic field test kits could greatly help public health programs to identify high arsenic exposure immediately at the water source. The arsenic field test kits provide advantages such as low cost, on-site measurement, rapid alerts, and limited training costs. However, the on-site inorganic arsenic measurement in water possesses a major challenge because the most common field test kits commercially available are known to lack the sensitivity and reproducibility necessary and are mostly based on the Gutzeit method that generates the extremely toxic arsine gas. In 2006, Steinmaus and co-workers found that two of the most commonly used field test kits (i.e., Hach EZ and Quick Arsenic) were able to provide flexibility and portability but were not sensitive enough to comply with the USEPA and WHO guideline value of 10 ppb. This research led to the conclusion that both kits could be extremely useful to accurately and rapidly report arsenic concentrations above 15 ppb.[7] Nonetheless, the use of electrochemical sensors has demonstrated to be a rapid and sensitive method for the detection of target molecules in relevant environments.[8−10] Particularly, electrochemical impedance spectroscopy (EIS) is a useful technique to achieve label-free operation, which enables the detection of target–probe binding in real time.[8,11,12] Also, this electrochemical method provides information of the surface properties of the system because it allows effective measurement the electrode’s resistance and the resistance of the ionic transfer through the interfacial layer after any binding or interfacial event.[13,14]

Thus, because of the recognized deleterious effects that inorganic arsenic can pose in human health, the opportunity to develop a selective impedimetric sensor is foreseen. A possible strategy to achieve such a goal relies on the use of arsenic-binding aptamers. Aptamers are in vitro-selected single-stranded DNA or RNA, which are promising tools to detect contaminants and other molecules mainly due to the demonstrated superior target recognition capabilities over other biomolecules (antibodies, peptides, etc.).[15] Particularly, aptamers have emerged as an important aid in environmental monitoring as it has allowed for real-time and on-site detection of heavy metals.[16] In 2009, Kim et al. first reported the use of an arsenic-binding aptamer for the removal of inorganic arsenic from Vietnamese groundwater.[14] The 100-mer oligonucleotide aptamer with As(III) high affinity, (5′GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCGAGATAGTAAGTGCAATCT-3′), has been used to remove the most lethal forms of arsenic, As(III) and As(V), from water. In fact, complete removal was achieved after exposing the selected aptamer to arsenic for 5 min to arsenic solutions ranging from 0.5 to 30 ppb. The authors ascribe this great removal capacity to the high selectivity and specificity of the aptamer toward the target, and the dissociation constant for As(III) and As(V) was determined to be 7.05 and 4.95 nM, respectively.

In this work, a label-free impedimetric aptasensor using the arsenic-specific aptamer (ArsSApt) was developed and tested by immobilizing the ArsSApt on a gold electrode and further exposing the system to As(III). The electrochemical capability of the aptasensor was determined via a label-free approach by studying the charge-transfer resistance across the electrode using a redox probe. The decreasing resistance through the aptamer layer with the increasing arsenic concentration served as an indicator of the ArsSApt–As(III) interaction and As(III) detection. Cui et al. observed a similar behavior of the aptamer when developing a sensor based on the differential pulse voltammetry technique.[17] Nevertheless, herein, we present a first approach toward using an impedimetric technique to study the performance and deepen the fundamental understanding of the molecular interaction of the aptamer with inorganic arsenic. The results presented in this research would allow the development of point-of-use sensors without the generation of toxic byproducts and acceptable sensitivity and selectivity toward inorganic arsenic(III).

Materials and Methods

Materials

Gold-coated electrodes were purchased from LGA Thin Films Inc. (Santa Clara, CA). The electrodes are prepared by in situ sputter etch followed by sputter deposition of 10 nm Ti and 100 nm Au onto polished Si wafers as per vendor specification. Potassium phosphate monobasic (KH2PO4), potassium phosphate dibasic (K2HPO4), sulfuric acid (H2SO4, TraceSELECT Ultra, ≥95% (T)), nitric acid (HNO3), hydrochloric acid (HCl), potassium chloride (KCl), potassium hydroxide (KOH), potassium ferricyanide (K3Fe(CN)6), potassium ferrocyanide (K4Fe(CN)6), sodium meta-arsenite (NaAsO2), sodium arsenate dibasic heptahydrate (Na2HAsO4·7H2O), and all other chemicals used were purchased from Sigma-Aldrich (USA) and used without further purification. An SP-150 potentiostat/galvanostat in a low-current mode with EIS capabilities from BioLogic USA, along with a common glass three-electrode cell system, was used for all electrochemical procedures. The gold-coated substrates were used as the working electrode, Ag/AgCl (0.197 vs NHE) as the reference electrode, and a platinum wire as the counter electrode. The ArsSApt was purchased from Integrated DNA Technologies with a thiolated anchoring group (C6-SH). The ArsSApt sequence was previously determined by Kim et al.,[14] and it was purchased from Integrated DNA Technologies with a modification in the 5′ terminal: 5′SH-MC6-D/TTACAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCG-3′, and only using the selective portion of the sequence. A random sequence was also purchased for comparison purposes and as a selectivity measure: 5′SH-MC6-D/GCATTCAAGGGCATTCAAGGGCATTCAAGGGCATTCAAGG-3′. Nanopure water (18.2 MΩ·cm2, Milli-Q Direct 16) was used at all times.

Immobilization of ArsSApt onto Gold Electrodes and Arsenic-Binding Experiments

The ArsSApt was first solubilized in a Tris–EDTA buffer solution and deprotected using 1:1 v/v dilution of the aptamer solution with 20 mM tris(2-carboxyethyl)phosphine hydrochloride for 1 h, following the protocols published by Base Pair Biotechnologies, Inc. Thereafter, the ArsSApt was allowed to react with the gold substrate for a 2 h period, and the surface was washed with buffer solution several times. After aptamer immobilization, arsenic solutions of different concentrations ranging from 0.05 to 200 ppm were incubated in different electrodes containing the immobilized ArsSApt. This reaction was allowed to occur for 4 h, and then, the electrodes were washed several times before proceeding with the electrochemical experiments.

EIS Experiments for the Sensor

To evaluate the performance of the aptamer-based sensor, EIS was used to determine the resistance across the electrochemical double layer for all electrodes. In brief, EIS experiments were carried out at Eoc against a Ag/AgCl reference electrode in all cases with an alternating voltage amplitude of 10 mV, with a frequency range from 0.1 kHz to 0.11 Hz at 30 points per decade in a 5 mM K3Fe(CN)6/5 mM K4Fe(CN)6/0.1 M KCl solution as the redox probe.

Physical Characterization of Gold–ArsSApt Electrodes

Infrared spectra of substrates were recorded on a Thermo Scientific Nicolet Continuum infrared (IR) instrument in a transmittance mode from 400 to 4000 cm–1, with 4 cm–1 resolution and an accumulation of 32 scans. The thickness of the ArsSApt layer and chemistry was evaluated using an infrared variable angle spectroscopic ellipsometer (IR-VASE—Mark II, J.A. Woollam Co., Inc. IR-VASE, Lincoln, Nebraska). Data were collected using a DTGS detector in the range of 230–8000 cm–1, a bandwidth of 0, sample type as isotropic, zone average polarizer, and single position RCE analyzer. To obtain thickness, data were collected at an angle of incidence of 80°, a spectral resolution of 4 cm–1, and 500 scans. For IR, data were collected at an angle of incidence of 70°, a spectral resolution of 16 cm–1, and 15 scans (data not shown). The WVASE32 software within the IR-VASE was used to analyze the aptamer thickness. The collected data were fitted to ellipsometric models that are a function of film thickness and optical constants (n, k). A model was created containing layers for the underlying silicon wafer, titanium (used as an adhesion layer for gold), gold, and an infrared general oscillating layer (genosc_ir) to model the aptamer. The thickness was displayed in nanometers, and the mean-squared error (MSE) and depolarization were observed to be closest to zero. X-ray photoelectron spectroscopy (XPS) was conducted to ascertain the gold–thiol formation between the aptamer and the gold substrate. XPS binding energy was obtained using a PHI 5600 spectrometer equipped with an Al Kα mono- and polychromatic X-ray source operating at 15 kV, 350 W, and pass energy of 58.70 eV. All binding energies reported were corrected using the carbon 1s peak (C 1s) at 284.8 eV. Atomic force microscopy (AFM) was utilized to assess the interface of the gold substrates before and after the immobilization of the ArsSApt. The AFM utilized is a MultiMode scanning probe microscope and Software: NanoScope (version 8.15) in the tapping mode (tip: TAP150A), with a scan size of 5 μm at a 0.5 Hz scan rate.

Physical Characterization of an ArsSApt + As(III) System

Malvern ZetaSizer Nano series with 4 mW 632.8 nm laser was used to determine the average apparent hydrodynamic diameter of aptamer–arsenic colloids. In this case, the aptamer was utilized without the thiol modification in the 5′ terminal (5′-TTACAGAACAACCAACGTCGCTCCGGGTACTTCTTCATCG-3′). First, suspensions were sufficiently diluted with deionized water to avoid agglomeration. Then, approximately 1 mL of suspension was added to a disposable plastic cuvette. The backscattering mode was used in triplicate for all the samples, and the z-average (i.e., hydrodynamic radius) and polydispersity index (PDI) were recorded.

Circular dichroism (CD) spectra were recorded on a Jasco J-810 (Jasco, Inc., Easton, MD) spectropolarimeter interfaced with a computer. The CD spectra of the 5 μM aptamer (no-thiol modification) were analyzed from 200 to 300 nm. The data gathered were the average of three scans at a scanning rate of 10 nm/min. The scan of the buffer recorded at room temperature was subtracted from the average scans for each sample run.

Solution nuclear magnetic resonance (NMR) spectra were recorded in a Bruker AVANCE III HD spectrometer operating at a 1H Larmor frequency of 700 MHz and suited with a QCI cryoprobe optimized for proton detection. One-dimensional excitation sculpting 1H spectra were acquired for two samples of 5 μM aptamer (no-thiol modification), with and without arsenite. The samples contained 10% D2O for field locking and were measured at 298 K. Each spectrum was the average of 2048 transients recorded with a 2 s recycle delay, 60 μs dwell time, and 492 ms acquisition period.

Results and Discussion

Optimization of Sensing Conditions

In the context of the development of a sensor, it was important to obtain correct conditions to prevent agglomeration of the aptamer layer. To obtain this information, dynamic light scattering (DLS) was employed for aptamer concentrations ranging from 0.01 to 10 μM (Figure ). DLS results show enlarged apparent hydrodynamic diameter for the 0.01 μM (314 nm, PDI: 0.553) and 10 μM (900 nm, PDI: 0.764) solutions, suggesting sample aggregation likely due to DNA backbone interactions. These samples also presented a higher PDI than the 5 μM (132 nm, PDI: 0.389) sample, providing evidence that an intermediate aptamer concentration of 5 μM would be beneficial as a starting condition for immobilization. DLS plots were also obtained for ArsSApt concentrations of 0.5 and 1 μM (Figure S1). Parallel to DLS, surface zeta potentials were also recorded for the same samples to determine the stability of the dispersions and are presented in Figure S2.

Figure 1

Hydrodynamic radius results of increasing the ArsSApt concentration by means of DLS. Measured concentrations are 0.01, 5, and 10 μM and the obtained average sizes are 314, 132, and 900 nm, respectively.

Interaction between ArsSApt and As(III)

The interaction between ArsSApt and As(III) was initially studied by means of CD, a tool to determine protein and nucleic acid structural conformations. The spectra for both 5 μM ArsSApt and ArsSApt with 100 ppm arsenic (ArsSApt + As) were obtained and compared (Figure ). Both spectra presented a negative peak at around 245 nm and a positive peak at 220 and 280 nm, which are both in accordance with previous CD reports of the arsenic–aptamer complex.[17,18] These signals are known to represent the most common helical B-form of DNA.[19−21] Nonetheless, after the addition of As(III), both peaks decreased indicating a conformational change of the aptamer when in contact with arsenic. These changes are the result of interfered bases from the transition of strong π–π interactions of the bases with deoxyribose.[18] Such results not only confirm As(III) binding to the ArsSApt but also demonstrate that a conformational change is occurring, which provides further elucidation on the origin of the impedimetric response that is observed in the electrochemical experiments. Fourier transform infrared (FTIR) spectra were also obtained as an attempt to pin point changes in functional groups and structural conformations once the ArsSApt binds As(III) (Figure S3).

Figure 2

CD spectra of 5 μM ArsSApt in the absence and presence of 100 ppm As(III).

Solution NMR is a powerful method to obtain atomic-level structural and dynamical information of challenging biomolecular systems such as DNA aptamers. Figure compares the amino proton region of NMR spectra of the ArsSApt in solution without and with 100 ppm As(III). These 1H signals arise from the aptamer nitrogen bases and are therefore highly sensitive to changes in molecular conformation or in interactions such as hydrogen bonding. The spectral comparison reveals substantial chemical shift perturbations in the ArsSApt (highlighted by the inset in Figure ), consistent with an overall conformational change upon As binding. In addition, a slight increase in line width can be observed, which is likely a result of intermediate motions due to intermolecular interactions. Furthermore, the observation of new signals such as that seen at 8.58 ppm indicates the formation of specific interactions in the ArsSApt + As(III) complex. In our experimental conditions, no imino protons were observed because of the chemical exchange with the solvent. These high-resolution NMR data are thus consistent with a mechanism in which specific intermolecular interactions in the ArsSApt + As(III) complex result in changes to the overall aptamer structure in solution. Because the aptamer is only terminally bound to the gold electrode in the sensor, ArsSApt + As(III) interactions and conformational changes are anticipated to occur in the solid-phase sensor similar to those detected in solution.

Figure 3

Amino proton region of 1H NMR spectra of 5 μM ArsSApt in the absence (top) and presence (bottom) of 100 ppm As(III), recorded at 700 MHz 1H frequency. The inset highlights chemical shift perturbations, indicative of a conformational change in the aptamer upon binding.

To further explore the properties of the interfacial layer over the electrode, a systematic study utilizing XPS was executed. High-resolution spectra of phosphorus (P), nitrogen (N), sulfur (S), and arsenic (As) were obtained for three samples: bare electrode, electrode containing the aptamer, and the electrode with arsenic bound to the aptamer (Figure ). The XPS P 2p high-resolution spectrum showed a peak at 133 eV only for the samples containing the ssDNA aptamer.[22,23] The peak observed for these samples refers to the phosphate groups present in the aptamer’s backbone. Also, the XPS peak in the N 1s binding energy, 400 eV, ascertains the presence of the nitrogenous bases of the aptamer on the sensor’s surface.[24,25] The S 2p peak at 162.5 eV refers to a Au–S bond that ensures the linking between the thiol-modified aptamer and the gold surface, which is in fact absent for the bare electrode.[26,27] The 44.8 eV signal only observed in sample C indicates the presence of arsenic (As(III)) on the electrode.[28] This intense arsenic peak, present even after washing with copious amounts of buffer, is indicative of a strong interaction between the ArsSApt and As(III) that may result irreversible in nature. Au and C high-resolution spectra were also obtained for all three samples (Figure S4).

Figure 4

XPS high-resolution spectra of phosphorus (P), nitrogen (N), sulfur (S), and arsenic (As) for three samples: (A) bare Au electrode, (B) ArsSApt-immobilized electrode, and (C) ArsSApt + As(III)-bound electrode.

Sensor Preparation

Once the intermediate aptamer concentration of 5 μM was selected in section , we conducted a study to determine the optimum aptamer concentration for immobilization onto the electrode surface. EIS of the electrodes with aptamer concentrations ranging from 0.1 to 10 μM was obtained, and the resistance of the working electrode was determined (Figure A). The highest aptamer detection was observed for the 5 μM electrode, referring to a higher aptamer concentration on the electrode surface. A dramatic decrease in resistance is observed when the aptamer concentration is doubled, suggesting that the aggregation observed in Figure may result in decreased immobilization of the aptamer on the gold surface. According to the obtained results, the optimal aptamer concentration for immobilization and further arsenic detection was established to be 5 μM.

Figure 5

Effect of (A) ArsSApt concentration for aptasensor preparation and (B) As(III) binding time on aptasensor performance. EIS experiments were carried out at Eoc against an Ag/AgCl reference electrode in all cases with an alternating voltage amplitude of 10 mV, with a frequency range from 0.1 kHz to 0.11 Hz at 30 points per decade in a 5 mM K3Fe(CN)6/5 mM K4Fe(CN)6/0.1 M KCl solution as the redox probe.

Another parameter optimized was the time of incubation of arsenic(III) within the aptamer–electrode system: binding time (Figure B). In this study, electrodes were prepared with 5 μM aptamer for immobilization and were exposed to 50 ppm arsenic. Unique sensors were prepared for the 1, 2, 4, 8, and 24 h binding times. As expected, the reaction time between the ArsSApt and As(III) influenced the response of the sensor. It is observed that the resistance of the working electrode decreased gradually with increasing reaction time and reaches a plateau after 4 h, suggesting that such a timeframe as adequate for the operation of the sensor.

The immobilization of the ArsSApt on the gold electrode was confirmed by means of cyclic voltammetry (CV) and XPS (Figure ). CV of a redox probe containing [Fe(CN)6]3–/4– was recorded and compared to the bare electrode and the aptamer-coated electrode. The voltammogram of the bare gold electrode is consistent with common gold CV plots (Figure A).[29] However, once the aptamer is immobilized on the gold electrode, the charge-transfer resistance increases dramatically (Figure B), further confirming the immobilization of an organic layer on the interface of the electrode.

Figure 6

CV plot of the (A) bare gold electrode and (B) ArsSApt (5 μM)-covered gold electrode. Cyclic voltammograms were recorded in a three-electrode cell system at 100 mV/s using an Ag/AgCl reference electrode and a platinum wire as the counter electrode in a 5 mM K3Fe(CN)6/5 mM K4Fe(CN)6/0.1 M KCl solution as the redox probe.

Electrochemical Performance

Because of its studied specificity and high affinity, the ArsSApt was used as a sensing probe in the electrochemical sensing platform. The electrochemical performance once exposed to arsenic was then studied by means of EIS. As shown by the Nyquist plot (Figure B), there is a linear decrease in the working electrode’s resistance with increasing arsenic concentration. A calibration curve was generated for arsenic concentrations from 0.05 to 10 ppm (Figure C). The results proved that the aptasensor responds linearly between the working electrode resistance and the logarithm value of the As(III) concentration. The minimum detectable concentration (MDC) measured by the impedimetric sensor after 4 h of incubation was 0.05 ppm, and the dynamic range extends from 0.05 to 10 ppm. The fitted linear equation obtained was y = −172 045x + 914 705 with a correlation coefficient of 0.9972 and a slope standard error of 4060. The MDC was calculated to be ca. 0.8 μM (i.e., MDC plus 3 times the error of the measurement, 20%), which is higher than the World Health Organization guideline of 133 nM (i.e., 10 ppb) but represents an environmentally friendly method that does not produce harmful chemicals after the process. These detection limits could be further improved by modifying the interfacial layer.

Figure 7

Electrochemical performance and the aptamer behavior on the electrode surface when in contact with arsenic. (A) Schematic representation of the aptamer conformational change when exposed to As(III). (B) Impedimetric response and (C) calibration curve of an aptasensor with increasing arsenic concentration from 0.05 to 10 ppm. (D) Film thickness results of the aptasensor with varying arsenic concentrations and (E) AFM images of the bare electrode, ArsSApt-immobilized electrode, and arsenic-bound electrode.

An important factor influencing the electrochemical behavior of the sensor is the packing density of the aptamer molecules on the surface.[30] Therefore, we attribute this decrease in the EIS signal to a conformational change in the aptamer layer upon binding to As(III), causing the aptamer chains to reorganize on the surface. We hypothesize that after the arsenic-binding event occurs, the aptamer layer compacts because of the strong interaction with the target molecule, likely leading to a thinner interfacial layer that results in a lower resistance across the electrochemical capacitor (Figure A). Such a statement can be confirmed by means of ellipsometric analysis of film thickness. IR-VASE was used to obtain the aptamer thickness before and after arsenic exposure (Figure D). We observe a thickness of 4.474 nm for the aptamer thickness before arsenic binding. Exposure to arsenic decreases the aptamer thickness as a function of the As(III) concentration.

Similarly, AFM images of three ArsSApt sensors (bare, ArsSApt, and ArsSApt + As(III)) could also confirm the decrease in film thickness when in contact with arsenic (Figure E). A significant increase in height is observed after aptamer immobilization on the gold surface. A slight darkening in the sample surface is observed with arsenic addition, which refers to decrease in height yet increase in surface roughness. The roughness analysis for the bare gold electrode showed a value of 0.568 nm. Once a homogeneous layer of the aptamer was added on the electrode (ArsSApt sample), the roughness increased to 3.66 nm, which resulted in less surface roughness than for the ArsSApt + As(III) sample. The ArsSApt + As(III) sample having a roughness of 6.86 nm.

ArsSApt Selectivity

The specificity of the sensor was determined by including a series of ions that are commonly found in water, namely: PO43–, Pb2+, NH4+, Fe3+, Cd2+, K+, Na+, Ni3+, and As5+, at 10 ppm (Figure A). In the absence of As(III), we observe changes in resistance that are certainly because of nonspecific binding of the ions tested with the aptamer. Upon the addition of AsO2–, there is a large decrease in resistance, analogous to the signal obtained when detecting arsenic alone. Also, even when testing the sensor against another arsenic species, As(V), its response remains specific toward As(III).

Figure 8

Aptamer specificity analysis. (A) EIS resistance response of the aptasensor when exposed to 10 ppm PO43–, Pb2+, NH4+, Fe3+, Cd2+, K+, Na+, Ni3+, As5+, and As3+. The mixture represents a solution containing 10 ppm of all ions. (B) Impedimetric signal analysis of the arsenic nonspecific aptasensor (random DNA sequence) when exposed to varying concentrations of As(III) from 0.1 to 200 ppm.

Another study designed to test the aptamer’s specificity toward its target molecule was by using an arsenic nonspecific aptamer to develop the device. EIS results show a nonlinear and low-signal detection of the aptamer against the As(III) species (Figure B). The observed detection is likely due to nonspecific binding of arsenic with the aptamer’s phosphate backbone, although the signal is negligible.

Conclusions

In this work, the performance and interfacial properties of an ArsSApt bound to an electrode were successfully presented. The aptamer showed excellent specificity toward arsenic, which was detectable even with other ions present in solution. By means of ellipsometry and AFM, we demonstrated interfacial changes that certainly shed light on the behavior of the aptamer once immobilized on the electrode and in contact with arsenic. Particularly, we determined that the increasing arsenic concentration leads to a decrease in the thickness of the aptamer layer, inducing a decrease in the charge-transfer resistance of [Fe(CN)6]3–/4– to the gold electrode. Therefore, this detection principle was used to develop a sensitive and selective arsenic determination method. The proposed aptasensor showed a linear range from 0.05 to 10 ppm with a correlation coefficient of 0.9972 and MDCs of 0.8 μM. Also included in this work is an effort to understand the interfacial properties between the ArsSApt and As(III). In this sense, NMR results revealed the likelihood of a mechanism in which specific intermolecular interactions in the ArsSApt + As(III) complex generates changes to the overall aptamer structure.