Literature DB >> 29467400

A Saliva Protein of Varroa Mites Contributes to the Toxicity toward Apis cerana and the DWV Elevation in A. mellifera.

Yi Zhang1, Richou Han2.   

Abstract

Varroa destructor mites express strong avoidance of the Apis cerana worker brood in the field. The molecular mechanism for this phenomenon remains unknown. We identified a Varroa toxic protein (VTP), which exhibited toxic activity toward A. cerana worker larvae, in the saliva of these mites, and expressed VTP in an Escherichia coli system. We further demonstrated that recombinant VTP killed A. cerana worker larvae and pupae in the absence of deformed-wing virus (DWV) but was not toxic to A. cerana worker adults and drones. The recombinant VTP was safe for A. mellifera individuals, but resulted in elevated DWV titers and the subsequent development of deformed-wing adults. RNAi-mediated suppression of vtp gene expression in the mites partially protected A. cerana larvae. We propose a modified mechanism for Varroa mite avoidance of worker brood, due to mutual destruction stress, including the worker larvae blocking Varroa mite reproduction and Varroa mites killing worker larvae by the saliva toxin. The discovery of VTP should provide a better understanding of Varroa pathogenesis, facilitate host-parasite mechanism research and allow the development of effective methods to control these harmful mites.

Entities:  

Mesh:

Year:  2018        PMID: 29467400      PMCID: PMC5821841          DOI: 10.1038/s41598-018-21736-9

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Varroa destructor Anderson & Trueman (Acari: Varroidae) was originally identified as an ectoparasite of the Asian honeybee Apis cerana. Before the year 2000, V. destructor was miscalled V. jacobsoni. In fact, these two species are different in body shape, cytochrome oxidase (CO-I) gene sequence, and virulence to honey bees[1]. Importantly, V. destructor can reproduce on A. mellifera but V. jacobsoni cannot[1]. V. destructor was transmitted to the European honeybee A. mellifera in the 1950s[1,2] and is now a worldwide ectoparasite of the economically important honeybee, except in Australia[3]. Adult females of this species can be found within sealed drones and worker cells and attached to adult bees[4]. Adult female mites feed on the hemolymph of sealed brood and adult bees[4]. In addition to weakening bee hosts by extracting hemolymph, V. destructor transmits a number of pathogens to these hosts, notably deformed-wing virus (DWV)[5-8]. Occasionally, DWV may cause deformed-wings in 40% A. mellifera adults following conditioned artificial infestation[8,9]. The V. destructor mite has been associated with widespread losses of honeybee colonies in the United States and Europe since 2006[3], but not in China. The balanced relationship between the original host A. cerana and V. destructor is the most striking aspect of this ectoparasite. Three host factors control the growth of the Varroa population and preserve the infested bee colonies as follow: mite infertility in the worker brood[9], hygienic behaviors[10-13] and the “entombing” of the drone brood[10,13]. In nature, Varroa mites show a marked preference for the drone brood and a strong avoidance of the worker brood in A. cerana colonies[4,13]. The reason for Varroa mites expressing a strong avoidance of the worker brood remains unclear. Recently, we injected crude saliva collected from female Varroa mites into A. cerana and A. mellifera larvae and observed that this treatment killed A. cerana worker larvae, while injected A. mellifera larvae developed into adults with deformed wings. To explore the potential involvement of salivary proteins in the toxicity towards A. cerana worker larvae, a salivary secretome was established and analyzed (Zhang and Han, unpublished data). Based on the secretome results, we identified a Varroa saliva toxic protein (VTP) that exhibited toxic activity towards A. cerana worker larvae from freshly capped cells in the absence of DWV and increased DWV titers for the development of deformed-wing A. mellifera adults. We also proposed a modified mechanism for Varroa mite avoidance of the worker brood. The discovery of VTP should help elucidate the interaction mechanism between the host and parasite and allow the development of effective anti-mite methods, based on RNAi-mediated and/or gene-editing knockdown of vtp receptor genes, for protecting A. mellifera colonies.

Results

Virus contents of the samples

We detected deformed wing virus [DWV] in A. mellifera larvae, pupae and adult workers and drones, Varroa mites and their saliva, and A. cerana infested with mites or injected with mite saliva but not in A. cerana that were injected or not injected with E-VTP (E-VTP = the expressed VTP fused with an epitope tag) (Supplementary Table S1). The DWV load in the crude mite saliva was 2.78 × 104 copies/μL. Nosema ceranae was present in both bee species (Supplementary Fig. S1).

Expression of VTP in Escherichia coli

The vtp cDNA sequence contains 405 bp and encodes 135 amino acids with a predicted signal peptide at the site between aa 16 and 17 (Supplementary Fig. S2); the predicted isoelectric point (PI) of VTP is 5.27 and its predicted molecular weight (MW) is 14.66 kDa. VTP has no homologs with known protein families and contains neither known domains nor repeated sequences, except a 29% homology to neuroligin-4 (Y-linked-like, XP_018496732) from Metaseiulus occidentalis. VTP possesses 4–6 α-helices in its secondary structure. The vtp cDNA sequence was submitted to the GenBank database under accession number KU647280. We also amplified the vtp DNA sequence using V. destructor genomic DNA as a template. The full-length vtp sequence contained 952 bp and included 3 introns (bp 79–219, 271–542, and 627–760), which confirmed the survey sequence of the Varroa genome[14]. We purified recombinant VTP from Escherichia coli Transetta (DE3) cells. The fusion protein (E-VTP) was estimated to have a MW of ~34.8 kDa (Fig. 1a), which was confirmed by Western blotting analysis (Supplementary Fig. S3).
Figure 1

Effects of the purified Varroa toxic protein (VTP) expressed in E. coli on A. cerana and A. mellifera. (a-(1)) Purified recombinant VTP (lane 1). (a-(2)) The purified E-VTP and different dilutions as visualized using silver staining. (b) Mortality rates of A. cerana and A. mellifera worker L3 larvae, L5 larvae, white-eyed pupae and adults injected with the purified E-VTP at different concentrations (0.1, 1.0, 2.0, and 5.0 ng/μL). CK, L5 larvae not injected; PBS, L5 larvae injected with PBS (10 mM, pH 7.4); TAG, injected with tag protein purified from E. coli Transetta pET32 (a). (c) Mortality rates of A. cerana and A. mellifera drone L3 larvae, L5 larvae and adults injected with the purified E-VTP at different concentrations (0.1, 1.0, 2.0, and 5.0 ng/μL). (d) Emergence rates and deformed wings rates of A. mellifera worker L5 larvae injected with the purified E-VTP at different concentrations (0.1, 1.0, 2.0, and 5.0 ng/μL). (e) Morphology of A. cerana and A. mellifera developed from worker L5 larvae with different treatments. One-way ANOVA with post hoc multiple comparison tests, NS, not significant; *P < 0.05, ***P < 0.001, n = 8 for L5 larvae, n = 10 for white-eyed pupae and adults, in each replicate per treatment. Three replicates were established. The data are presented as the mean values ± S.D.

Effects of the purified Varroa toxic protein (VTP) expressed in E. coli on A. cerana and A. mellifera. (a-(1)) Purified recombinant VTP (lane 1). (a-(2)) The purified E-VTP and different dilutions as visualized using silver staining. (b) Mortality rates of A. cerana and A. mellifera worker L3 larvae, L5 larvae, white-eyed pupae and adults injected with the purified E-VTP at different concentrations (0.1, 1.0, 2.0, and 5.0 ng/μL). CK, L5 larvae not injected; PBS, L5 larvae injected with PBS (10 mM, pH 7.4); TAG, injected with tag protein purified from E. coli Transetta pET32 (a). (c) Mortality rates of A. cerana and A. mellifera drone L3 larvae, L5 larvae and adults injected with the purified E-VTP at different concentrations (0.1, 1.0, 2.0, and 5.0 ng/μL). (d) Emergence rates and deformed wings rates of A. mellifera worker L5 larvae injected with the purified E-VTP at different concentrations (0.1, 1.0, 2.0, and 5.0 ng/μL). (e) Morphology of A. cerana and A. mellifera developed from worker L5 larvae with different treatments. One-way ANOVA with post hoc multiple comparison tests, NS, not significant; *P < 0.05, ***P < 0.001, n = 8 for L5 larvae, n = 10 for white-eyed pupae and adults, in each replicate per treatment. Three replicates were established. The data are presented as the mean values ± S.D.

Effects of purified E-VTP on honeybees

We found that the mortality rates of A. cerana worker larvae and pupae challenged with purified E-VTP were significantly higher than those of the controls and increased with the concentrations of injected E-VTP at 2 days (Fig. 1b-(1), L3 larvae: df = 6, 14, F = 5.194, P = 0.005; (2), L5 larvae: df = 7, 16, F = 15.644, P = 0.000; (3), pupae: df = 6, 14, F = 3.818, P = 0.018). No DWV was detected from these worker larvae and pupae, even after injecting purified E-VTP (Supplementary Table S1). The cadavers also exhibited the same traits as those resulting from infesting A. cerana worker L5 larvae with mites or injecting these insects with crude mite saliva (Fig. 1e). The survival rates of A. cerana worker L5 larvae injected with E-VTP were significantly lower than those of the controls (Fig. 1d, df = 7, 16, F = 96.533, P = 0.000). No deformed wings were found in A. cerana worker adults. When A. mellifera worker larvae and pupae were injected with purified E-VTP at different concentrations, we found that their mortality rates were similar to those of the controls at 2 days (Fig. 1b-(5), L3 larvae: df = 6, 14, F = 0.238, P = 0.956; (6), L5 larvae: df = 7, 16, F = 0.295, P = 0.946; (7): pupae: df = 6, 14, F = 1.653, P = 0.205); the survival rates of the worker larvae and pupae were not significantly different among the treatments and the controls. However, 40–60% of the resulting adults from the injected worker larvae had deformed wings (Fig. 1d). The DWV loads of A. mellifera wing-deformed adults were significantly higher than those of normal-winged adults (Supplementary Fig. S4), indicating that the E-VTP injection of A. mellifera worker L5 larvae significantly increased the DWV titers in the resulting adults. Similar wing traits were found in the adults after A. mellifera worker L5 larvae were challenged with E-VTP or with mites or injected with crude mite saliva (Fig. 1e). When the control materials were injected into A. mellifera worker L5 larvae, none of the resulting adults had increasing DWV loads or deformed wings. These results indicated that introducing VTP into A. mellifera worker larvae stimulated DWV proliferation and that high DWV titers caused deformed wing adults. When we injected E-VTP into A. cerana and A. mellifera worker adults (Fig. 1b-(4), df = 8, 18, F = 0.598, P = 0.767; (8), df = 8, 18, F = 0.668, P = 0.713), no significant difference in their mortalities was observed. The mortality rates of the drone larvae (L3 and L5 larvae) of both bee species (Fig. 1c-(1), df = 6, 14, F = 0.833, P = 0.564; (2), df = 6, 14, F = 1.562, P = 0.230; (3), df = 6, 14, F = 1.362, P = 0.295; (4), df = 6, 14, F = 0.357, P = 0.894; (5), df = 6, 14, F = 0.293, P = 0.930; (6), df = 6, 14, F = 0.439, P = 0.841) were not significantly different among the treatments and the controls, indicating that E-VTP was not toxic to the drone larvae. The worker and drone adults of the two bee species were alive for at least 7 days under laboratory conditions.

RNAi of vtp gene in the mites

We detected very low levels of vtp mRNA in dsRNA-vtp-treated mites on days 0, 3, 7 and 13 post-treatment but observed normal vtp mRNA levels in mites treated with 0.9% saline or dsRNA-gfp (Fig. 2a, 0d, df = 3, 8, F = 387.725, P = 0.000; 3d, df = 3, 8, F = 160.393, P = 0.000; 7d, df = 3, 8, F = 4514.652, P = 0.000; 13d, df = 3, 8, F = 765.466, P = 0.000). Interestingly, we found that the mortality rate of A. cerana worker L5 larvae infested with mites with a low vtp mRNA level was 41.1% of that of the controls, suggesting that the RNAi-mediated knock down of vtp gene expression protected A. cerana worker L5 larvae from the effects of V. destructor mites (Fig. 2b, df = 4, 10, F = 48.903, P = 0.000). Given the same treatment, the survival rate of Varroa-susceptible A. mellifera worker L5 larvae was significantly increased, but the resulting adults had high DWV titers (Supplementary Fig. S5) and deformed wings (Fig. 2c, df = 4, 10, F = 22.866, P = 0.000), which is probably due to the increasing vtp gene expression in the RNAi-treated mites after 13 days (Fig. 2a).
Figure 2

RNAi-mediated knock down of vtp expression in adult V. destructor and its effects on toxicity toward honeybees. Eight live mites were collected from each treatment group, for 2 repeats. The mites were treated by overnight (approximately 15 hours) immersion in different solutions at 16 °C and subsequently placed on A. mellifera and A. cerana worker L5 larvae. (a) CK, V. destructor mites that were not treated; 0.9% NaCl, mites treated with 0.9% NaCl; dsRNA-gfp, mites treated with dsRNA-gfp (2.5 μg/μL); dsRNA-vtp, mites treated with dsRNA-vtp (2.5 μg/μL). 0 d, mites collected immediately after immersion; 3 d, treated mites placed on L5 larvae for 3 days; 7 d, treated mites placed on L5 larvae for 7 days; 13 d, treated mites placed on L5 larvae for 13 days, when eclosion was observed. One-way ANOVA with post hoc multiple comparison tests, NS, not significant; ***P < 0.001, the values were expressed as the mean values ± S.D. (b) Mortality rate of A. cerana worker L5 larvae infested by Varroa mites; (c) Percentage of adult eclosion and percentage of eclosed adults with deformed wings resulting from A. mellifera worker L5 larvae infested by Varroa mites. CK, worker L5 larvae without mite infestation; Vd, worker L5 larvae exposed to Varroa mites that were not treated; 0.9% NaCl, worker L5 larvae exposed to Varroa mites treated with 0.9% NaCl; dsRNA-gfp, worker L5 larvae exposed to Varroa mites treated with dsRNA-gfp (2.5 μg/μL); dsRNA-vtp, worker L5 larvae exposed to Varroa mites treated with dsRNA-vtp (2.5 μg/μL). One-way ANOVA with post hoc multiple comparison tests, *P < 0.05, ***P < 0.001, n = 6 L5 larvae in each of three replicates per treatment. The data are presented as the mean values ± S.D. The experiment was repeated more than two times.

RNAi-mediated knock down of vtp expression in adult V. destructor and its effects on toxicity toward honeybees. Eight live mites were collected from each treatment group, for 2 repeats. The mites were treated by overnight (approximately 15 hours) immersion in different solutions at 16 °C and subsequently placed on A. mellifera and A. cerana worker L5 larvae. (a) CK, V. destructor mites that were not treated; 0.9% NaCl, mites treated with 0.9% NaCl; dsRNA-gfp, mites treated with dsRNA-gfp (2.5 μg/μL); dsRNA-vtp, mites treated with dsRNA-vtp (2.5 μg/μL). 0 d, mites collected immediately after immersion; 3 d, treated mites placed on L5 larvae for 3 days; 7 d, treated mites placed on L5 larvae for 7 days; 13 d, treated mites placed on L5 larvae for 13 days, when eclosion was observed. One-way ANOVA with post hoc multiple comparison tests, NS, not significant; ***P < 0.001, the values were expressed as the mean values ± S.D. (b) Mortality rate of A. cerana worker L5 larvae infested by Varroa mites; (c) Percentage of adult eclosion and percentage of eclosed adults with deformed wings resulting from A. mellifera worker L5 larvae infested by Varroa mites. CK, worker L5 larvae without mite infestation; Vd, worker L5 larvae exposed to Varroa mites that were not treated; 0.9% NaCl, worker L5 larvae exposed to Varroa mites treated with 0.9% NaCl; dsRNA-gfp, worker L5 larvae exposed to Varroa mites treated with dsRNA-gfp (2.5 μg/μL); dsRNA-vtp, worker L5 larvae exposed to Varroa mites treated with dsRNA-vtp (2.5 μg/μL). One-way ANOVA with post hoc multiple comparison tests, *P < 0.05, ***P < 0.001, n = 6 L5 larvae in each of three replicates per treatment. The data are presented as the mean values ± S.D. The experiment was repeated more than two times.

Discussion

The co-adaptation of V. destructor and A. cerana results from an interesting dynamic balance between the host and parasite populations and accounts for the resistance of A. cerana to these mites. Effective grooming and hygienic behavior, non-production of the mites in the worker brood, and the “entombing” of the infested drone brood are reportedly the major factors ensuring this resistance[10-13,15,16]. Grooming and hygienic behavior reduces the susceptibility of A. cerana colony to V. destructor infestation[16-19] but seems to be highly variable[20]. The higher susceptibility of mite-infested worker brood of A. cerana leads to more efficient hygienic behavior[21]. However, the removal of the Varroa-infested worker brood does not necessarily induce the death of the mites, as most mites may escape from brood cells that were opened during removal[10]. Interestingly, V. destructor mites or the injection of mite saliva can kill A. cerana worker larvae[21,22]. A. cerana larvae block Varroa mite reproduction in the infected worker brood[9] and are sacrificed due to mite saliva toxin (similar to a mutual destruction strategy). Lack of production of mites in the worker brood was not caused by the death of A. cerana larvae, as these mites, fed with fresh A. cerana or A. mellifera larvae, were also infertile (unpublished results). The reason why these mites produce a toxic protein to kill A. cerana larvae remains unknown. However, in the field, V. destructor mites exhibit a marked preference for the drone brood and are rarely found in the worker brood of A. cerana colonies as long as a sufficient drone brood is available[13]. This phenomenon is considered crucial for the balanced host-parasite relationship in A. cerana during the long co-evolution of these species[13]. Based on the results of the present study, we suggest a mechanism to explain why Varroa mites express the strong avoidance of the worker brood. Under mutual destruction stress, Varroa mites likely evolved to protect themselves in the field by avoiding the worker brood, instead by preferring drone brood where they do not kill drones by the saliva toxin and subsequently reproduce. This strategy significantly reduces mite death and non-reproduction risks. The mite infestation of drone brood typically does not induce a significantly negative effect on colony size[23], therefore almost the entire A. cerana colony can be protected. Thus, we propose a modified mechanism for the mite avoidance of the worker brood, which is probably due to mutual destruction stress. In contrast to A. cerana worker larvae, infected A. mellifera workers and drones support the fertility of V. destructor mites, and VTP is neither toxic to the workers nor to the drones of A. mellifera. This finding indicates that A. mellifera individuals are less susceptible to this mite. However, social behaviors, such as grooming, and hygienic behaviors in the A. mellifera colony were much weaker than those in the A. cerana colony[4], resulting in damage to the A. mellifera colony by the mites. Furthermore, two unique tolerance factors in the A. cerana colony, non-reproduction in the worker brood and entombing of drone larvae, do not occur in A. mellifera. These findings imply that A. mellifera colony is more susceptible to this mite than A. cerana, the original host of this mite. It is reasonable to imagine that without strong avoidance of the worker brood and the toxic effect on A. mellifera larvae, V. destructor successfully parasitizes the worker brood in A. mellifera. However, why A. mellifera individuals are less susceptible to VTP is unclear. This VTP contains neither known domains nor repeated sequences, but 4–6 α-helices in its secondary structure. The function of VTP receptors and/or detoxification factors in A. mellifera hemolymph deserves further research. Insects are generally attacked by many types of parasites. These parasites may secrete venomous proteins and non-proteinaceous compounds[24-28] that alter the immunity and/or modulate the development and physiology of the hosts or, in few cases, kill the hosts[28]. However, these proteins or compounds do not directly kill the hosts, and knowledge of the characteristics of individual salivary components is limited[28]. Unexpectedly, V. destructor mites deliver a toxic protein from the saliva to kill the infected host, which in turn prevents the reproduction of these mites in worker broods. This mutual destruction strategy may be too costly for the mites and A. cerana bees. However, from the point of view of evolutionary pressure, we can explain why these mites are rarely found in the worker brood cells of A. cerana colonies in the field[4]. VTP is not toxic to the drone of A. cerana, potentially explaining why the reproduction of Varroa mites in the original host A. cerana is limited to drone brood, although the reasons why the drones are resistant to the Varroa mites deserve further research. VTP is also safe to the worker adults of both bee species, which may reflect the importance of evolutionary adaptation, as the mites need the worker adults for transportation into other colonies[29], and the bee colony may be collapsed if the infected worker adults could be killed by the mites. DWV is prevalent in A. mellifera and V. destructor but is not common in A. cerana[30-32]. Although the introduction of higher titers of recombinant DWV into bee pupae caused A. mellifera adult wing deformities[33], in absence of V. destructor infestation or with lower titers of DWV in the mite-infested bees[33], A. mellifera adults did not show wing-deformities[6]. Interestingly, Varroa mites have been feeding on European bees on an isolated Brazilian island for decades, but do not activate DWV or cause deformed bees or colony losses[34]. The reasons for these results remain unknown. The following factors should be considered: the bees are not sensitive to DWV infection; the mites may lose or contain less toxin protein; DWV is a weakly pathogenic isolate. In the present study, although A. cerana adults from E-VTP-injected larvae showed no deformities wings, we found that introducing E-VTP into A. mellifera larvae increased DWV loads in the adults, which subsequently developed the deformed-wing trait. Although VTP together with DWV did not generally cause the death of the larvae of normal A. mellifera colonies, we observed that infestation with Varroa mites decreased the emergence rate of a Varroa-sensitive A. mellifera colony in presence of DWV. The RNAi-mediated suppression of vtp gene expression in the mites significantly increased the emergence rate of the larvae in this A. mellifera colony. Thus, these results would promote the development of anti-mite products for the protection of A. mellifera colonies, based on RNAi-mediated and/or gene-editing (such as CRISPR/cas9) knockdown of vtp receptor(s) in A. mellifera.

Methods and Materials

Mites and insects

Using a camel hair brush, mature female V. destructor mites were collected from the worker pupae in A. mellifera hives that had not been treated with acaricides in an apiary in Conghua, Guangzhou, China. These mites were placed in sterile Petri dishes (diameter = 9 cm; 20 mites per dish) and used for bioassays within one hour. The 3rd stage larvae (L3 larvae) and 5th stage larvae (L5 larvae; spinning phase) from freshly capped cells, and the pupae (white-eyed, unpigmented cuticle pupae) and adults of drones and workers of A. mellifera or A. cerana derived from apiaries without chalkbrood and foulbrood symptoms in Conghua, Guangzhou were collected according to Kanbar and Engels[35] and used for bioassays in the laboratory[36]. The developmental stages of the honeybees were defined according to Bitondi et al.[37,38].

Viral and microsporidia loads

We used RT-PCR assays[30-32,39-49] to examine the mites and mite saliva collected according to Richards et al.[24]. The honeybees used in the present study were examined for the presence of 16 bee viruses using available sequences from NCBI (acute bee paralysis virus [ABPV], chronic bee paralysis virus [CBPV], deformed wing virus [DWV], Kashmir bee virus [KBV], sacbrood virus [SBV] and Israeli acute paralysis virus [IAPV], black queen cell virus [BQCV], A. mellifera filamentous virus [AmFV], Big Sioux River virus [BSRV], Lake Sinai virus complex [LSV], slow bee paralysis virus [SBPV], V. destructor macula-like virus [VdMLV]), cloudy wing virus [CWV], Apis iridescent virus [AIV], Varroa destructor virus 1 [VDV-1], Moku virus [MV], and two microsporidia parasites (Nosema apis and N. ceranae). Total RNA was isolated from honey bees (larvae, pupae and adults of workers and drones), mite saliva and mites using RNAqueous kits (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. The isolated RNA was quantified by spectrophotometry. DNA was removed from the samples by incubation with DNase I (5 units of DNase I in an appropriate buffer containing the RNase inhibitor RNAsin [Invitrogen, Carlsbad, CA, USA]) at 37 °C for 45 min. The primers for detecting each of the 16 viruses and two microsporidia parasites (Supplementary Table S2) were selected based on previous reports[31,32,39-49]. The cDNA synthesis was performed using a PrimeScriptTM 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China). The PCR amplification program involved an initial denaturation cycle at 95 °C for 5 min, followed by 35 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, with a final cycle at 72 °C for 7 min. The PCR products were sequenced using the corresponding specific primers.

Amplification of the full-length sequence of the vtp gene

We obtained the partial amino acid sequence of a metalloprotease homolog (herein called VTP) based on the Varroa mite salivary secretome (Zhang and Han, unpublished data). To obtain the full-length sequence of the vtp gene, we isolated total RNA from pooled samples of adult females Varroa mites using RNAiso Plus reagent (No. 9109, TaKaRa, Dalian, China). The full vtp cDNA was cloned using the SMARTer™ RACE cDNA Amplification Kit (No. 634924, Clontech, TaKaRa, Tokyo. Japan) according to the manufacturer’s instructions. For 5′-cDNA amplification, the R primer 5′-TCCATCRTGHKKWSMACC-3′ and the UPM primer (5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3′) from the kit were used. The following PCR program was used: 95 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 45 °C for 30 s, and 72 °C for 45 s, with a final cycle at 72 °C for 10 min. For 3′-cDNA amplification, the forward primer 5’- ATGTCGGGACTCAGCCTGAAATTGTGGAT-3′ was designed, and touchdown PCR was performed using Titanium Taq DNA Polymerase (No. 639206, Clontech, TaKaRa, Tokyo, Japan). The PCR program contained 5 cycles at 94 °C for 30 s and 72 °C for 1.5 min; 5 cycles at 94 °C for 30 s, 65 °C for 30 s and 72 °C for 1.5 min; and 25 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1.5 min. The PCR products were visualized on a 1.1% agarose gel and subsequently purified and cloned into the T-vector for sequencing. To determine the full-length sequence of the vtp gene, we also isolated genomic DNA from six sterilized V. destructor eggs (sterilized using 70% ethanol) using the KAPA Express Extraction Kit (No. KK7101, Kapa Biosystems, Boston, USA). The vtp gene was PCR amplified from genomic DNA using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Heidelberg, Germany) and the primers VTP-F-EcoRI (5′-ATGTTCAAACTTCTCGTTATCG-3′) (EcoRI) and VTP-R-HindIII (5′-TTAGGAGGCGAGCGCCTGCTGGA-3′) (HindIII). The PCR product was purified and cloned into the pEASY-Blunt cloning vector (Transgen BioTech, Beijing, China), after which the resulting plasmid was transformed into E. coli Trans T1 (Transgen BioTech, Beijing, China). The start codon (ATG) and stop codon (TAA) in the primers are indicated in bold, and the restriction sites are indicated in italics. Two clones were sent to Invitrogen LTD. (Shanghai) for DNA sequencing. The resulting sequence was analyzed using DNASTAR software and the ClustalW program and was submitted to GenBank under accession number (KU647280). The translated protein sequence was analyzed by Expasy (http://web.expasy.org/protparam/). The signal peptide, secondary structure and subcellular localization of the translated protein were predicted by the SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP), Interpro (http://www.ebi.ac.uk/interpro/sea-rch/sequence-search) and TargetP (http://www.cbs.dtu.dk/services/TargetP/), respectively.

Western blotting analysis

To confirm the VTP protein in the saliva of the mites, we prepared mite saliva, purified E-VTP and TAG protein as described above and analyzed these proteins via Western blotting. The proteins were transferred to a polyvinylidene difluoride (PVDF) membrane. The membrane was incubated overnight at 4 °C with primary rabbit polyclonal anti-VTP antibodies (diluted 1:1000) produced by AB Clonal Technology (Yingji Biotechnology, Shanghai, China). Following three washes, the membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (Boster Biological Technology, Wuhan, China) at a 1:1000 dilution for 1 hour. The immunoreactive protein bands were detected using DAB Western Blotting substrate (Boster Biological Technology, Wuhan, China).

Expression of VTP in Escherichia coli and bee bioassay

We cloned the amplified gene cDNA into the pEASY-T1-Simple vector and transformed the resulting plasmid into E. coli TransT1 cells (Transgen BioTech, Beijing, China). DNA sequencing was performed by Invitrogen (Shanghai, China). The pEASY-T1-Simple-vtp plasmid was digested using EcoRI and HindIII. The resulting vtp fragment was purified and subsequently ligated into the expression vector pET-32a(+) (Novagen, Darmstadt, Germany), which has an N-terminal His-Tag/thrombin/S-Tag enterokinase configuration plus an optional C-terminal His-Tag sequence. This plasmid was digested using EcoRI and HindIII to yield pET-32a(+)-vtp. The resulting plasmid was transformed into E. coli Transetta cells (Transgen BioTech, Beijing, China) to create Transetta/pET-32a(+)-vtp for expression of the recombinant protein VTP (=E-VTP). The vector without insert sequence was transformed into the same E. coli strain to express the tag protein (approximately 20.2 kDa) as a control (=TAG). A single bacterial colony was grown overnight in 15 mL of LB-carbenicillin (100 μg/mL) broth. The culture was diluted 3:100 in 200 mL of fresh LB-carbenicillin medium and was grown until the OD600 value reached 0.6. For E-VTP induction, isopropyl-beta-D-thiogalactopyranoside (IPTG) was added at a final concentration of 0.2 mM at 16 °C overnight. E-VTP was isolated from the soluble protein fraction using a Bio-Scale Mini Profinity IMAC cartridge (No. 7324610, Bio-Rad, Berkely, CA, USA) according to the manufacturer’s instructions. The purity of the obtained protein was evaluated using SDS-PAGE, and the protein concentration was determined by using the Modified Bradford Protein Assay Kit (Sangon, Shanghai, China). A 0.2-μL aliquot of the purified E-VTP at different concentrations (0.10, 1.0, 2.0, and 5.0 ng/μL) was injected into A. mellifera and A. cerana L3 larvae (L3 larvae are never naturally fed on by Varroa, and this is only an artificial situation), L5 larvae, pupae and adults of workers and drones, using a microinjector (IM-31, Narishige, Tokyo, Japan). Larvae and pupae were injected into the hemocoel of each insect near the end of the abdomen. The bled larvae were discarded after injection. The adults of workers were anesthetized using nitrogen for 8 min prior to injection[50]. After injection, the larvae were reared with 30 μL of larval food[51] and the adults were fed 3 mL of sugar solution (w/v, 50%) in a culture plate in a growth cabinet at 34 °C and 80% RH. Fresh food was provided to the larvae at 12-h intervals. After 60 hours, the larvae were transferred to a culture plate sealed with Parafilm. Various negative controls, such as uninjected bees (=CK) and bees injected with only PBS (=PBS) or only the TAG protein, were established, with 3 replicates per treatment. The L5 larvae were also injected with crude saliva as a positive control. The bees were assessed daily for mortality, emergence or deformed wing rate (for A. mellifera).

RNAi-mediated knock down of vtp gene expression

To determine the functions of VTP, we knocked down the expression of vtp using the RNAi method[52]. Briefly, dsRNA-vtp was prepared using the MEGAscript kit (AM1334, Ambion, Carlsbad, CA, USA) according to the manufacturer’s instructions. The dsRNA-gfp was prepared for use as a negative control. A 405-bp (bases 1–405) fragment of the vtp gene was amplified from the cDNA transcripts of a female V. destructor using vtp-specific primers (VTP-F/R), and the GFP coding region was amplified from the control GFP-plasmid using GFP-specific primers (GFP-F, TCAAGAAGGACCATGTGGTC and GFP-R, TTCCATGGCCAACACTTGTCC). The dsRNAs were generated using the Ambion MEGAscript T7 Kit and subsequently purified using MEGAclear (AM 1908, Ambion, Carlsbad, CA, USA). The resulting dsRNAs were ethanol-precipitated, resuspended in 0.9% NaCl at a working concentration of 2.5 μg/μL[52], and subsequently stored at −80 °C until further use. Adult mites collected from capped brood cells were soaked overnight in 500-μL microfuge tubes containing 15 μL of dsRNA-vtp, dsRNA-gfp (both at 2.5 μg/μL) or 0.9% NaCl at 16 °C, and subsequently transferred to cell culture plates containing L5 larvae of A. mellifera or A. cerana. A Varroa-sensitive A. mellifera population from Gaozhou, Guangdong was employed to determine the effect of the RNAi-mediated knock down of vtp expression on the mortality of A. mellifera L5 larvae. Two mites and one L5 larva were placed in each culture plate, and the plates were maintained at 33 ± 1 °C and 80% RH in a growth cabinet (SANYO, Tokyo, Japan) for 12 days until the adults emerged[52]. Emerged adults with normal or deformed wings were frozen using liquid N2 and stored at −80 °C for subsequent RNA extraction to determine their DWV titers[32,33]. We also employed qRT-PCR to determine the effect of knocking down the expression of vtp using RNAi. The total RNA was extracted from mites at 0, 3, 7 and 13 d after the various treatments described above to evaluate the persistence of the effect of vtp RNAi. After DNase I treatment, the RNAs were reverse-transcribed using a TransScript All-in-One First-Strand cDNA Synthesis SuperMix for PCR Kit (Transgen BioTech, Beijing, China). The PCR reactions were conducted in triplicate in an Mx3000P Real-Time PCR System (Stratagene, California, USA) using SYBR Green (SYBR Premix Ex Taq II [Tli RNaseH Plus], TaKaRa, Dalian, China). A control without template was included in all PCR batches. The vtp primer pairs used were VTP-qF (AACGCATTCAAGACTACATCACCAA) and VTP-qR (CTTTGACAACGTTCTCCTTCTGCT). The V. destructor actin gene was used for normalization and amplified using Actin-F (CATCACCATTGGTAACGAG) and Actin-R (CGATCCAGACGGAATACTT) primers. The PCR program included a single cycle at 95 °C for 5 min and 40 cycles at 95 °C for 15 s, 58 °C for 30 s and 72 °C for 30 s. To obtain dissociation curves, the PCR products were heated to 95 °C for 15 s, cooled to 58 °C for 60 s and subsequently heated to 95 °C for 15 s. The mRNA levels relative to that of actin mRNA were calculated using Mx3000P Software (version 4.1) (Agilent, Palo Aito, CA, USA). The fold-differences in the mRNA levels were calculated using the 2−∆∆Ct method.

Data analysis

The data were analyzed using a normal one-way analysis of variance (ANOVA) using SPSS statistical software (16.0), and the significance of the between-treatment differences was evaluated using Duncan’s multiple range test, with significance indicated at a P value of <0.05. All data were expressed as percentages and arcsine-square root transformed prior to conducting ANOVA. The values are expressed as the mean values ± S.D. A P value of <0.05 indicated statistical significance. Supplementary information
  37 in total

1.  A serine proteinase homolog venom protein from an endoparasitoid wasp inhibits melanization of the host hemolymph.

Authors:  Sassan Asgari; Guangmei Zhang; Reza Zareie; Otto Schmidt
Journal:  Insect Biochem Mol Biol       Date:  2003-10       Impact factor: 4.714

Review 2.  Modulation of host immunity by tick saliva.

Authors:  Jan Kotál; Helena Langhansová; Jaroslava Lieskovská; John F Andersen; Ivo M B Francischetti; Triantafyllos Chavakis; Jan Kopecký; Joao H F Pedra; Michail Kotsyfakis; Jindřich Chmelař
Journal:  J Proteomics       Date:  2015-07-17       Impact factor: 4.044

3.  Varroa jacobsoni (Acari: Varroidae) is more than one species.

Authors:  D L Anderson; J W Trueman
Journal:  Exp Appl Acarol       Date:  2000-03       Impact factor: 2.132

4.  Replication of Varroa destructor virus 1 (VDV-1) and a Varroa destructor virus 1-deformed wing virus recombinant (VDV-1-DWV) in the head of the honey bee.

Authors:  Naama Zioni; Victoria Soroker; Nor Chejanovsky
Journal:  Virology       Date:  2011-06-11       Impact factor: 3.616

5.  Genetic characterization of slow bee paralysis virus of the honeybee (Apis mellifera L.).

Authors:  Joachim R de Miranda; Benjamin Dainat; Barbara Locke; Guido Cordoni; Helène Berthoud; Laurent Gauthier; Peter Neumann; Giles E Budge; Brenda V Ball; Don B Stoltz
Journal:  J Gen Virol       Date:  2010-06-02       Impact factor: 3.891

Review 6.  Deformed wing virus.

Authors:  Joachim R de Miranda; Elke Genersch
Journal:  J Invertebr Pathol       Date:  2009-11-11       Impact factor: 2.841

7.  Varroa destructor Macula-like virus, Lake Sinai virus and other new RNA viruses in wild bumblebee hosts (Bombus pascuorum, Bombus lapidarius and Bombus pratorum).

Authors:  Laurian Parmentier; Guy Smagghe; Dirk C de Graaf; Ivan Meeus
Journal:  J Invertebr Pathol       Date:  2015-12-18       Impact factor: 2.841

8.  Prevalence of Nosema and Virus in Honey Bee (Apis mellifera L.) Colonies on Flowering Period of Acacia in Korea.

Authors:  In-Pyo Hong; Soon-Ok Woo; Yong-Soo Choi; Sang-Mi Han; Nam-Suk Kim; Hye-Kyung Kim; Sang-Hoon Han; Man-Young Lee; Myeong-Lyeol Lee; Kyu-Ho Byeon
Journal:  Mycobiology       Date:  2011-12-07       Impact factor: 1.858

9.  Oldest Varroa tolerant honey bee population provides insight into the origins of the global decline of honey bees.

Authors:  L E Brettell; S J Martin
Journal:  Sci Rep       Date:  2017-04-10       Impact factor: 4.379

10.  The making of a queen: TOR pathway is a key player in diphenic caste development.

Authors:  Avani Patel; M Kim Fondrk; Osman Kaftanoglu; Christine Emore; Greg Hunt; Katy Frederick; Gro V Amdam
Journal:  PLoS One       Date:  2007-06-06       Impact factor: 3.240

View more
  4 in total

1.  Phylogenetic and recombination analyses of two deformed wing virus strains from different honeybee species in China.

Authors:  Dongliang Fei; Yaxi Guo; Qiong Fan; Haoqi Wang; Jiadi Wu; Ming Li; Mingxiao Ma
Journal:  PeerJ       Date:  2019-06-28       Impact factor: 2.984

2.  Reproduction of Distinct Varroa destructor Genotypes on Honey Bee Worker Brood.

Authors:  Wenfeng Li; Cheng Wang; Zachary Y Huang; Yanping Chen; Richou Han
Journal:  Insects       Date:  2019-10-25       Impact factor: 2.769

3.  Divergent evolutionary trajectories following speciation in two ectoparasitic honey bee mites.

Authors:  Maeva A Techer; Rahul V Rane; Miguel L Grau; John M K Roberts; Shawn T Sullivan; Ivan Liachko; Anna K Childers; Jay D Evans; Alexander S Mikheyev
Journal:  Commun Biol       Date:  2019-10-01

Review 4.  Cell Lines for Honey Bee Virus Research.

Authors:  Ya Guo; Cynthia L Goodman; David W Stanley; Bryony C Bonning
Journal:  Viruses       Date:  2020-02-20       Impact factor: 5.048

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.