Literature DB >> 20973996

Genomic survey of the ectoparasitic mite Varroa destructor, a major pest of the honey bee Apis mellifera.

Scott R Cornman1, Michael C Schatz, Spencer J Johnston, Yan-Ping Chen, Jeff Pettis, Greg Hunt, Lanie Bourgeois, Chris Elsik, Denis Anderson, Christina M Grozinger, Jay D Evans.   

Abstract

BACKGROUND: The ectoparasitic mite Varroa destructor has emerged as the primary pest of domestic honey bees (Apis mellifera). Here we present an initial survey of the V. destructor genome carried out to advance our understanding of Varroa biology and to identify new avenues for mite control. This sequence survey provides immediate resources for molecular and population-genetic analyses of Varroa-Apis interactions and defines the challenges ahead for a comprehensive Varroa genome project.
RESULTS: The genome size was estimated by flow cytometry to be 565 Mbp, larger than most sequenced insects but modest relative to some other Acari. Genomic DNA pooled from ~1,000 mites was sequenced to 4.3× coverage with 454 pyrosequencing. The 2.4 Gbp of sequencing reads were assembled into 184,094 contigs with an N50 of 2,262 bp, totaling 294 Mbp of sequence after filtering. Genic sequences with homology to other eukaryotic genomes were identified on 13,031 of these contigs, totaling 31.3 Mbp. Alignment of protein sequence blocks conserved among V. destructor and four other arthropod genomes indicated a higher level of sequence divergence within this mite lineage relative to the tick Ixodes scapularis. A number of microbes potentially associated with V. destructor were identified in the sequence survey, including ~300 Kbp of sequence deriving from one or more bacterial species of the Actinomycetales. The presence of this bacterium was confirmed in individual mites by PCR assay, but varied significantly by age and sex of mites. Fragments of a novel virus related to the Baculoviridae were also identified in the survey. The rate of single nucleotide polymorphisms (SNPs) in the pooled mites was estimated to be 6.2 × 10-5 per bp, a low rate consistent with the historical demography and life history of the species.
CONCLUSIONS: This survey has provided general tools for the research community and novel directions for investigating the biology and control of Varroa mites. Ongoing development of Varroa genomic resources will be a boon for comparative genomics of under-represented arthropods, and will further enhance the honey bee and its associated pathogens as a model system for studying host-pathogen interactions.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20973996      PMCID: PMC3091747          DOI: 10.1186/1471-2164-11-602

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

Honey bees (Apis mellifera) are an important agricultural commodity providing honey, other bee products, and pollination services [1,2]. Domesticated honey bees in the United States and elsewhere have been in decline in recent years, despite an increasing need for honey bee pollination services [3]. This fact is often blamed on increasing challenges from pests and pathogens, as well as episodes of severe decline such as the enigmatic 'colony collapse disorder' (CCD) [4]. Among the most detrimental of honey bee pests is the ectoparasitic mite Varroa destructor [5]. V. destructor and its closely related congener, V. jacobsoni, are native to Asia where they parasitize the Eastern honey bee, A. cerana. V. destructor was only identified as a morphologically and genetically distinct species from V. jacobsoni relatively recently [6]. V. destructor began to appear in Asian colonies of A. mellifera during the last century and is now widely distributed, inadvertently aided by trade in bees and bee products. Mite-infested bee colonies suffer directly from parasitism of pupae and adults, and indirectly from viral and microbial pathogens that the mites vector [7,8]. Feeding by mites induces an immunosupression in bees that leads to increased titres of pre-existing infections [9], further compounding their impact. The economic toll of V. destructor on apiculture is estimated to be millions of U.S. dollars per year, and chemical control agents are worrisome both for their collateral effects on bee health and the potential for honey contamination [10]. Varroa-honey bee interactions are mediated to a large extent via chemical cues, and bees have numerous mechanisms to control Varroa populations (reviewed in [5,11]). Varroa mites reproduce on honey bee pupae, using chemical signals produced by the developing honey bee larvae to target appropriately aged hosts. The mature female offspring of reproductive Varroa emerge with the adult honey bee, and subsequently move to nurse bees (which are engaged in brood care), thereby allowing them to remain in close proximity to the brood [12,13]. Honey bees resist 'Varroatosis', the infestation of colonies by Varroa mites, via grooming of adult infested bees, removal of infested pupae (hygienic behavior), and physiological resistance mechanisms [5]. Recent successes in breeding Varroa-resistant bees, including the selection of 'Russian' bees with longstanding exposure to mites [14,15], indicate that a better understanding of how bees and mites interact with each other can lead to novel management strategies. Comparative studies of the fragility of the A. mellifera - V. destructor interaction, which has apparently prevented most Asian lineages of V. destructor as well as other Varroa species from colonizing A. mellifera [6,16-18], supports the hypothesis that mite olfaction or other requirements for mite reproduction may be suitable control targets. A molecular-genetic approach to develop such innovative controls would clearly benefit from further insights into Varroa genomics, which could be exploited in conjunction with tools already extant for honey bee. Prior to this study, genes for only two non-mitochondrial V. destructor proteins had been deposited in GenBank, a sodium channel gene (AAN37408.1) and a glycoprotein (ACU30143.1). Genome sequencing will greatly expand this gene catalog, and may also uncover unforeseen targets for novel and specific acaricides, such as divergence in metabolic pathways between mites and bees or the discovery of important microbial interactions. High-throughput, shotgun sequencing of whole genomes allows the rapid identification of thousands of genic sequences, greatly facilitating molecular and population-genetic studies that would otherwise proceed in piecemeal and laborious fashion. Here we report an initial sequence survey of the V. destructor genome in conjunction with a flow-cytometric estimate of genome size. Our annotations and analysis should aid investigators seeking molecular approaches to mite control. They will also provide a guide for a planned full genome project for this species [19], one of several genomics initiatives that are unfolding the molecular interactions between honey bees and a constellation of potentially interacting pathogens [4,7,20,21]. Of the eight genetically distinct lineages of V. destructor that parasitize A. cerana in Asia, two have been identified on A. mellifera [6,18,22,23]. Anderson [24] designated these lineages the Japan (J) and Korea (K) 'haplotypes' in reference to mitochondrial DNA makers, but they are concordantly distinct at nuclear markers as well [23]. Genetic differentiation within lineages is low [23], likely reflecting the population-genetic impact of life-history traits [5] such as full-sib mating and male haploidy [25], as well as potential population bottlenecks tied to host-shift events and subsequent range expansion [18,23]. In this study, we have analyzed the K haplotype of V. destructor from A. mellifera, the predominant haplotype presently found in North America [23]. We have identified over 13,000 contigs with sequences homologous to other species; many of these have recognized domains and/or functional annotations transferred from other arthropods. Interestingly, V. destructor appears to have experienced a higher rate of protein evolution than Ixodes scapularis since their divergence from the most recent common ancestor over 300 million years ago. Sequences attributable to a range of microbes were identified, including a large number of sequences from one or more novel actinomycete bacteria, the presence of which was confirmed by PCR in individual mites but not in adult honey bees. We also identified a novel virus related to the Baculoviridae that was abundant in the genomic survey. Finally, we found a low level of nucleotide polymorphism in the sequenced sample of ~1,000 mites, consistent with expectation [23]. This bodes well for future efforts to sequence and assemble a reference genome for this species and to identify genetic variation that correlates with host-interaction traits among Varroa strains and species.

Results

Genome size

Flow cytometry of V. destructor nuclei (normalized to nuclei of Drosophila virilis) yielded a haploid genome size estimate of 565 ± 3 Mbp (Figure 1). This genome size is larger than that of many insects but substantially smaller than that of numerous mites and ticks for which genome projects are underway or have been proposed (> 2,000 Mbp, [26]. It is also lower than the general range for ticks, which spans from roughly 1,000 Mbp in the argasid soft tick Ornithodoros turicata to 3,100 Mb in the ixodid hard tick Amblyomma americanum [27]. However, examples of very small acarid genomes are known. Most notably, the two-spotted spider mite Tetranychus urticae, which has been advocated as a model for genetic and developmental studies of chelicerates [28]), has an estimated genome size of only 75 Mbp. It is not yet clear to what extent these large differences in genome size are driven by variation in gene content, repetitive fraction, and/or ploidy. While the contributions of the latter two factors have been frequently noted, the potential contribution of gene expansion has been highlighted by recent analyses of waterflea [29] and pea aphid [30]that reveal a roughly two-fold increase in gene content relative to other arthropods.
Figure 1

2C genome size estimate for . 2C genome size estimate for V. destructor based on flow cytometry, normalized to the Drosophila virilis genome (A). The V. destructor fluorescence peak (B) corresponds to a genome size of 0.577 picograms or 565 ± 3 Mbp.

2C genome size estimate for . 2C genome size estimate for V. destructor based on flow cytometry, normalized to the Drosophila virilis genome (A). The V. destructor fluorescence peak (B) corresponds to a genome size of 0.577 picograms or 565 ± 3 Mbp.

Sequencing, assembly, and filtering

Six pyrosequencing runs on a Genome Sequencer FLX instrument (454 Life Sciences) produced 2.4 Gbp of unpaired sequencing reads. After trimming low quality sequence, the average read length was 365 bp, generating an expected genome coverage of 4.2×. The reads were then assembled into contigs with the CABOG package of Celera Assembler version 5.2 [31]. The resulting assembly had a realized median contig coverage of 4.3×, but was highly fragmented and summed to only 318 Mbp of sequence, substantially less than the estimated genome size of 565 Mbp. Table 1 provides statistics for this assembly before and after removing problematic or undesired sequences (detailed below). The modest contig lengths are primarily a consequence of low coverage, as over 97% of contigs greater than 1 Kbp terminate due to coverage gaps rather than ambiguity from repetitive sequences. In fact, contig lengths were comparable to that expected (~3,860 bp) for an idealized assembly of equivalent coverage and read length, following the method of [32].
Table 1

Statistics of the Varroa destructor genome sequence survey

StatisticInitial assemblyFiltered assembly
Number of contigs271,543184,094

Sum of contig length (Mbp)318294

Maximum contig length (bp)18,70316,332

Mean contig length (bp)1,170.41,597.5

N50 contig length (bp)2,1072,262

Contigs ≥ 1,000 bp107,195105,621

Contigs ≥ 5,000 bp5,4075,374

Contigs ≥10,000 bp120118

Mean coverage4.35.0
Statistics of the Varroa destructor genome sequence survey As detailed in the Methods, the small physical size of V. destructor required the collection of large numbers of mites from multiple honey bee colonies in order to obtain sufficient DNA for this survey. While mites were carefully cleaned and examined under a dissection microscope to remove any non-target organisms that might have been collected inadvertently, whole-organism extractions necessarily entail the possible inclusion of associated microbes, particularly gut microbes. The gut flora may include symbiotic, commensal, and pathogenic prokaryotes and eukaryotes, which are often important components of the ecology of arthropod species. We therefore filtered the assembled contigs based on G+C content, coverage, and sequence homology, in order to minimize the mis-annotation of microbial sequences as V. destructor, as well as to identify novel microbes of interest. Comparable strategies have been successfully applied to the classification of metagenomic samples (e.g., [33]). We first examined the distribution of contig-mean coverage versus length (Figure 2), which revealed relatively few outliers, and these were found to be enriched in mitochondrial and ribosomal sequences. Thus, the vast majority of the assembled contigs do not appear to contain many collapsed nuclear repeats. Based on the observed median and variance of coverage (Figure 2), we excluded contigs with less than 2× coverage and greater than 10× coverage, as well as contigs less than 300 bp in length, from the analyzed V. destructor assembly.
Figure 2

Scatterplot of contig coverage versus length for the unfiltered assembly. Fold sequence coverage of assembled contigs is distributed relatively narrowly around the mean, with few outliers. Contigs with coverage within the range 2-10× (shaded green) were included for further analysis as putative nuclear genomic contigs of V. destructor (see text for details). Short, high-coverage contigs are predominantly mitochondrial or ribosomal in nature. A cluster of longer contigs approximately with 30-50× coverage appear to derive from a baculovirus (see text); contigs in this coverage range are shaded in yellow.

Scatterplot of contig coverage versus length for the unfiltered assembly. Fold sequence coverage of assembled contigs is distributed relatively narrowly around the mean, with few outliers. Contigs with coverage within the range 2-10× (shaded green) were included for further analysis as putative nuclear genomic contigs of V. destructor (see text for details). Short, high-coverage contigs are predominantly mitochondrial or ribosomal in nature. A cluster of longer contigs approximately with 30-50× coverage appear to derive from a baculovirus (see text); contigs in this coverage range are shaded in yellow. We then examined G+C content of contigs (Figure 3), which suggested that Varroa nuclear DNA falls largely between 32-58% G+C content (40.9% G+C on average). Contigs with lower G+C content and higher coverage showed strong homology to mitochondrial and ribosomal DNA sequences previously reported for V. destructor, as would be expected. Contigs with higher G+C consistently showed higher sequence similarity to bacterial sequences than to arthropod sequences. For example, Figure 4 illustrates the distribution of contigs with BLASTX matches to the high G+C bacterial order Actinomycetales at an expectation of 10-8, plotted as a function of length and G+C content of contigs. Of these contigs, only those above approximately 58% G+C content were better matches (by sequence similarity and E-value) to Actinomycetales than to arthropods, or lacked an arthropod match entirely. Based on these considerations, we removed contigs outside the range of 32-58% G+C from the analyzed V. destructor assembly unless they contained a superior match to a eukaryotic sequence in GenBank at an expectation of 10-8. Additional filtering was performed as described in the Methods to specifically remove sequences from organisms that were considered potential contaminants a priori, such as known microbial pathogens of honey bees that are dispersed as spores.
Figure 3

Scatterplot of contig G+C content versus coverage. Scatterplot of contig G+C content versus fold sequence coverage shows a clear mode of G+C content in the range of 32-56%. The long tail of low G+C contigs includes low-complexity sequences such as AT repeats, as well as mitochondrial and ribosomal contigs. A secondary mode of high G+C contigs is also apparent; these contigs include many BLAST matches to the bacterial order Actinomycetales (see text).

Figure 4

Evidence that high G+C contigs are bacterial. Contigs with a BLASTX match to the bacterial order Actinomycetales (at an expectation of 10-8 or less), plotted as a function of G+C content and contig length. Points are color-coded according to the taxonomy of the best GenBank match overall. There is a clean separation between contigs with lower G+C that are more similar, by percent identity and expectation of BLASTX sequence alignments, to arthropod sequences and contigs with higher G+C that are more similar to actinomycete sequences.

Scatterplot of contig G+C content versus coverage. Scatterplot of contig G+C content versus fold sequence coverage shows a clear mode of G+C content in the range of 32-56%. The long tail of low G+C contigs includes low-complexity sequences such as AT repeats, as well as mitochondrial and ribosomal contigs. A secondary mode of high G+C contigs is also apparent; these contigs include many BLAST matches to the bacterial order Actinomycetales (see text). Evidence that high G+C contigs are bacterial. Contigs with a BLASTX match to the bacterial order Actinomycetales (at an expectation of 10-8 or less), plotted as a function of G+C content and contig length. Points are color-coded according to the taxonomy of the best GenBank match overall. There is a clean separation between contigs with lower G+C that are more similar, by percent identity and expectation of BLASTX sequence alignments, to arthropod sequences and contigs with higher G+C that are more similar to actinomycete sequences.

Actinomycete discovery

The strong secondary mode of high G+C contigs in Figure 3 and taxonomically coherent BLAST hits (Figure 4) suggests that one or more Actinomycete species were particularly abundant in the sequenced sample. Together these contigs totaled ~300 Kbp of sequence, which were further analyzed with the BLAST2GO annotation tool [34]. Additional file 1 includes BLAST2GO output that summarizes the distribution of BLASTX hits among these contigs with respect to matched species, expectation, and sequence similarity. All of the most frequently matched organisms are members of Actinomycetales. Ribosomal sequences were also found that had strong similarity to this clade, the closest match (98% identity) being to the genus Segniliparus. To further investigate the distribution of this bacterium in Varroa mites, we designed primers specific to a homolog of translation initiation factor TIF-3. These primers amplified the target sequence from DNA of individual mites, as confirmed by sequencing of the amplicon. The rate of infection in a sample of mites (see Methods) is shown in Table 2. Rates of infection varied significantly (P < 0.01, χ2 test) by age and sex. Mature females were infected more often than males (61% versus 33%). We did not detect the infection in a small sample of eggs and it was rare in nymphs (11%). These data suggest that horizontal transmission of the bacteria occurs within capped cells (from which males do not leave). We were not able to amplify the target from A. mellifera DNA extracted from adult bee abdomens, either with these primers or another pair targeting an ABC transporter gene (see Methods). Given the intimacy of Varroa mites with their hosts, this result suggests that the bacterium has some specificity to Varroa. While additional surveys at broader geographical scales are needed to confirm and extend these conclusions, the amount of sequence classified as actinomycete is remarkable given that common microbial components of the arthropod gut flora [35] (e.g., the Enterobacteriaceae) were not strongly evident in the initial assembly (see Methods). However, as the mites were not surface sterilized prior to extraction of genomic DNA, it is unclear whether the infection is topical or internal.
Table 2

Frequency of infection of individual mites by a novel actinomycete bacterium identified in the V. destructor sequence survey

ClassPresentAbsent
Male48

Female117

Nymph216

Egg05

Presence or absence of the bacterium is based on a PCR assay (see text for details).

Frequency of infection of individual mites by a novel actinomycete bacterium identified in the V. destructor sequence survey Presence or absence of the bacterium is based on a PCR assay (see text for details).

Baculovirus discovery

Curiously, the longest contig in the initial assembly was among those filtered due to high coverage across its entire length (a mean of 56×). In fact, this contig is part of a distinct group visible in Figure 2 that have mean coverage around 50×, sloping down to ~30× as contig length decreases (a frequently observed phenomenon attributable to low-coverage at contig ends). We therefore investigated whether contigs ≥ 1 Kbp in length and with 30-60× coverage were of a consistent type, such as microbial DNA or a class of repetitive sequence (e.g., ribosomal genes or transposable elements). BLASTX and Pfam [36] searches indicated that these high coverage contigs derive from a novel baculovirus. Baculoviruses are large DNA viruses that are common in certain arthropod taxa and often have strong impacts on host survival (reviewed by [37]). Known baculoviruses range from 80 to 180 kb in length and typically encode more than 100 ORFs, some of which are putatively specific to Baculoviridae. Indeed, several baculovirus-specific domains were detected among the 216 methionine-initiated ORFs greater than 90 amino-acids in length that were found on these high-coverage contigs (Table 3). Domains related to viral genome replication as well as other domains previously reported in Baculoviridae were also found. The baculovirus Spodoptera litura NPV appears to be the most similar viral species overall in GenBank, as there were strong matches to ribonucleotide reductase subunits RR1 and RR2 and weaker matches to a number of other peptides of this viral species. A number of ORFs encoding low-complexity proteins were identified from these high-coverage contigs, but it remains unclear which of these, if any, are viral in nature (all filtered contigs and predicted ORFs are given in Additional file 2). PCR primers specific to two separate loci (see Methods) confirmed the presence of these sequences in the original sample pool, but we were able to amplify these loci from only two of fifty individual mites collected at different times from the same colonies as the sequenced sample. Thus, the putative baculovirus-like sequences do not appear to be common in V. destructor, although we can infer from their high coverage in the initial assembly that high titres are sometimes achieved. This result also demonstrates that these sequences are not integrated into the V. destructor genome. Because baculoviruses are important tools for arthropod transgenics and biocontrol [38,39], efforts to clarify the nature of this virus and its hosts are underway.
Table 3

Evidence for a novel virus related to the Baculoviridae in the sequenced sample of Varroa destructor

ORFPfam domain descriptionExpectationReported in Baculoviridae?
VDK00007920-4466_1Ribonucleotide reductase, barrel domain5.50E-231Yes

VDK00121146-847_1Ribonucleotide reductase, small chain1.30E-125Yes

VDK00001240-6963_1Thymidylate synthase3.60E-114Yes

VDK00008686-4345_1Kinesin motor domain3.90E-060No*

VDK00103915-1040_1Reverse transcriptase7.80E-035Yes

VDK00064516-1660_1BRO family, N-terminal domain1.60E-017Yes

VDK00001041-7192_1Chitin binding domain1.50E-010Yes

VDK00192648-381_1Pacifastin inhibitor (LCMII)3.60E-008No

VDK00158309-530_2Baculovirus hypothetical protein1.10E-006Yes

VDK00025611-2890_1Matrixin (matrix metalloprotease)3.80E-006Yes

VDK00139482-672_1Protein of unknown function (DUF666)3.90E-006Yes

VDK00179897-428_1Phosphatidylinositol-specific phospolipase5.60E-006No*

VDK00008449-4382_2Protein of unknown function (DUF686)9.90E-006Yes

VDK00099267-1099_1Zinc knuckle (retroviral gag protein)1.20E-004Yes

VDK00107278-999_1Baculovirus BRO family, N-terminal domain1.80E-004Yes

VDK00158309-530_3Gamma-glutamyltranspeptidase2.60E-004No*

VDK00071395-1528_1Collagen triple helix repeat8.20E-004No*

VDK00038309-2357_1Collagen triple helix repeat9.20E-004No*

VDK00202991-345_3Amelogenin (cell adhesion protein)2.20E-003No

VDK00042225-2226_1Alpha/beta hydrolase fold2.40E-003No*

VDK00021332-3129_1Phage integrase family3.00E-003No*

VDK00104983-1027_1Collagen triple helix repeat4.20E-003No*

VDK00202991-345_2Collagen triple helix repeat4.20E-003No*

VDK00043167-2196_3Protein of unknown function (DUF686)9.10E-003Yes

VDK00073176-1494_3Gamma-glutamyltranspeptidase9.20E-003No*

VDK00048355-2046_1Matrixin (matrix metalloprotease)0.01Yes

Pfam matches are shown for methionine-initiated ORFs of 90 amino acids or more that were encoded by contigs at least 1 kb in length and with 30×-60× coverage. Collectively the matches are consistent with a viral origin and include several domains characteristic of Baculoviridae. Only matches with an expectation of 0.01 or less are shown. *Domain reported from at least one virus in Pfam [36] and Interpro [66] databases. **Present in one baculovirus accession (Q65353 of UniProt [67]) due to a retrotransposon insertion.

Evidence for a novel virus related to the Baculoviridae in the sequenced sample of Varroa destructor Pfam matches are shown for methionine-initiated ORFs of 90 amino acids or more that were encoded by contigs at least 1 kb in length and with 30×-60× coverage. Collectively the matches are consistent with a viral origin and include several domains characteristic of Baculoviridae. Only matches with an expectation of 0.01 or less are shown. *Domain reported from at least one virus in Pfam [36] and Interpro [66] databases. **Present in one baculovirus accession (Q65353 of UniProt [67]) due to a retrotransposon insertion.

V. destructor annotation and evolutionary comparison with other arthropods

We used BLASTX (for genomic contigs) and BLASTP (for ORFs of 90 residues or more) to identify genic sequences in the assembly. Sequences were initially searched against a database of five arthropod peptide predictions (Drosophila melanogaster, Anopheles gambiae, Pediculus humanus [a representative non-Dipteran insect], Daphnia pulex, and I. scapularis), with a minimum expectation of 10-8, and then secondarily against the eukaryotic Refseq database at the same expectation. In total, 13,031 contigs were identified with BLAST-detected similarity to database sequences (listed in Additional file 3). These contigs had a median length of 1,967 bp and summed to 31.3 Mbp, and represent roughly 10% of the total assembled sequence (294 Mbp after filtering). ORFs with significant Pfam domains are listed in Additional file 4 and the sequences are provided in Additional file 5. These annotated gene fragments are necessarily an incomplete accounting of the number and type of genes in V. destructor, given the limitations of the assembly and lack of transcriptome data. Additional genomic resources are needed for robust gene models and are in development [19]. However, we used two approaches to infer how well represented Varroa protein-coding genes are in this survey. We first identified ORFs that were putatively homologous to enzymes of the glycolysis/gluconeogenesis pathway, using KEGG-annotated pathway components [40] from the mosquito, Anopheles gambiae, and the tick, I. scapularis, as BLAST queries. I. scapularis is the most closely related organism to V. destructor for which an extensively annotated genome sequence exists [41]. We identified 19 putative pathway components in our search (Table 4), whereas there are 21 members in I. scapularis and 23 in A. gambiae. A second, similar approach to assessing how well V. destructor genes were represented in the assembly was to query all predicted ORFs against the CEGMA set of hidden Markov models of evolutionarily conserved proteins [42]. A Hmmer [43] search found matches for 303 of the 458 protein models available, at an E-value threshold of 1.0 (matches at this level also had BLASTP matches in GenBank with E-values less than 10-10). The same search performed on I. scapularis predicted proteins found matches for 429 models. Given that ORFs are proxies for single coding exons, both approaches used here are likely to under-sample V. destructor coding sequences. These comparisons nonetheless suggest that a majority of the coding potential of V. destructor was captured in this survey, if in fragmented form. However, they also indicate that comparisons of gene-family or protein-domain abundance in V. destructor relative to other arthropods may be premature.
Table 4

The Varroa destructor glycolysis/gluconeogenesis pathway is well represented in the genome sequence survey

Glycolysis/gluconeogesis enzymeKEGG IDAnnotated in A. gambiaeAnnotated in I. scapularisClosest contig match in the V. destructor assembly (BLASTX)StrandStartStopE-value
6-phosphofructokinaseK00850XxVDK00166959+2744866.00E-027

acetyl-CoA synthetaseK01895XxVDK00052872-31315543.00E-085

aldehyde dehydrogenaseK00128XxVDK00013090+238532241.00E-138

dihydrolipoamide dehydrogenaseK00382XxVDK00011534-3439171.00E-020

enolaseK01689XxVDK00029529-75222117.00E-143

fructose-1,6-bisphosphataseK03841XxVDK00132162+1583551.00E-023

fructose-bisphosphate aldolaseK01623XxVDK00012888+80121211.00E-073

glucose-6-phosphate isomeriseK01810XxVDK00034893+21456.00E-018

glyceraldehyde 3-phosphate dehydrogenaseK00134XxVDK00020468-14224772.00E-077

hexokinaseK00844XxVDK00023511-31315222.00E-094

phosphoenolpyruvate carboxykinaseK01596XxVDK00063370-116616841.00E-038

phosphoglucomutaseK01835XxVDK00033184-2364783.00E-024

phosphoglycerate kinaseK00927XxVDK00052433+35112294.00E-032

phosphoglycerate mutaseK01834XxVDK00033074-25725505.00E-031

pyruvate dehydrogenase E1 component, subunit alphaK00161XxVDK00079694-213828.00E-043

pyruvate dehydrogenase E1 component, subunit betaK00162XxVDK00041927-52721102.00E-020

pyruvate dehydrogenase E2 componentK00627XxVDK00062508-1654164.00E-033

pyruvate kinaseK00873XxVDK00096436-67611314.00E-067

S-(hydroxymethyl)glutathione dehydrogenaseK00121XxVDK00003663-173127004.00E-125

glucose-6-phosphate 1-epimeraseK01792Xx

triosephosphate isomeriseK01803Xx

aldose 1-epimeraseK01785X

L-lactate dehydrogenaseK00016X

Putative pathway components listed below were identified by BLASTX, using KEGG-annotated components [40] from Anopheles gambiae and Ixodes scapularis as search queries.

The Varroa destructor glycolysis/gluconeogenesis pathway is well represented in the genome sequence survey Putative pathway components listed below were identified by BLASTX, using KEGG-annotated components [40] from Anopheles gambiae and Ixodes scapularis as search queries. We used RepeatMasker [44] to characterize the distribution of protein-coding transposable element classes in V. destructor, which are summarized in Table 5. The Mariner class of DNA transposon was by far the most abundant transposable element identified. Some retrotransposons were also common, particularly gypsy-type long-terminal-repeat (LTR) retrotransposons and LINEs (long interspersed nuclear elements). Helitrons, which replicate by a rolling-circle method, were also numerous. Given the quasi-clonal nature of the K and J haplotypes of V. destructor[23], comparative re-sequencing of these two groups could uncover recently active transposable elements. Active elements are of interest because they are important contributors to genome evolution, including the creation of novel host genes [45], and have utility for functional genomics [46].
Table 5

Protein-encoding transposable elements in V. destructor

ClassFamilyNumber identified
DNATcMar-Mariner6511

DNATcMar-Tc1357

DNAhAT58

DNATcMar-Fot127

DNAMuDR12

HelitronHelitron338

LINER1981

LINEL293

LINECR183

LINEBovB47

LINEJockey28

LINEL117

LTRGypsy914

LTRPao102

LTRCopia74

LTRGypsy-Cigr31

Transposable elements identified with the protein-level repeat masking mode of RepeatMasker [44]. Class abbreviations are DNA, type II DNA transposon; LINE, long interspersed nuclear element; LTR, long-terminal repeat retrotransposon. Family designations are those of RepBase [68].

Protein-encoding transposable elements in V. destructor Transposable elements identified with the protein-level repeat masking mode of RepeatMasker [44]. Class abbreviations are DNA, type II DNA transposon; LINE, long interspersed nuclear element; LTR, long-terminal repeat retrotransposon. Family designations are those of RepBase [68]. Although the I. scapularis genome should be a valuable guide for homology-based gene prediction in V. destructor, these lineages are estimated to have diverged 336 ± 26 million years ago [47]. It is therefore of interest to assess the level of sequence divergence between these two taxa, as well as the divergence of these Acari from other model arthropods. We identified 730 peptide blocks, averaging 128 residues in length, that were conserved between putative orthologs in these two species and among their closest homologs in Da. pulex, Dr. melanogaster, and P. humanus. We then calculated the average genetic distance among species for each block, using the JTT substitution matrix [48] and weighted by block length (see Methods). The unrooted dendrogram derived from a total of 94,146 aligned positions is shown in Figure 5. The V. destructor branch (0.42333) is substantially longer than the I. scapularis branch (0.26667) from their shared common ancestor, implying a high rate of amino-acid evolution in the Varroa lineage and/or a low rate of amino-acid evolution in the Ixodes lineage. Note that this distance-based approach does not require specifying a nucleotide substitution model or correcting for multiple substitutions; the branch lengths are approximately proportional to the product of the time since divergence and the branch-specific rate of molecular evolution (see [49] for a discussion). Furthermore, the branching order of these taxa are well-supported by independent data [50,51]. Of course, this result is averaged across many loci and does not necessarily represent the pattern of sequence divergence at any given gene. It remains to be seen whether other gene features, such as exon structure, have also evolved at a comparably divergent rates.
Figure 5

A distance-measure dendrogram of five arthropod taxa based on aligned blocks of conserved peptides. The unrooted tree was constructed with Phylip [64] using neighbor joining and the JTT exchange matrix as described in the text. The tree was drawn with TreeView [65].

A distance-measure dendrogram of five arthropod taxa based on aligned blocks of conserved peptides. The unrooted tree was constructed with Phylip [64] using neighbor joining and the JTT exchange matrix as described in the text. The tree was drawn with TreeView [65].

Nucleotide polymorphism in V. destructor

Life-history traits of V. destructor [5] that act to reduce genetic polymorphism within family lineages include male haploidy [25] and a predominance of full-sib mating. Genetic variation within a population can nonetheless be high in principle if populations are admixtures of distinct lineages. High-frequency polymorphisms, whether due to admixture or heterozygosity, can cause difficulties for shotgun assembly algorithms because they weaken the computational discrimination of allelic and non-allelic sequences. On the other hand, polymorphisms may be useful as genetic markers for population-genetic studies. It is therefore of interest to estimate levels of genetic polymorphism in the sequenced sample (~1,000 mites drawn from three adjacent colonies). We used the program SWAP454 [52] to estimate the occurrence of moderate- to high-frequency SNPs, i.e. those present in reads at a minimum ratio of 0.1 to the assembly reference base. SNP calls also required a minimum of two reads with the alternative base, but did not require reads in both directions. Polymorphisms meeting these parameters occurred at a rate of 6.2 × 10-5 per base pair. Given a median per-contig coverage of 5.0× in the final assembly (Table 1), our ability to detect low frequency polymorphisms is of course limited, but such polymorphisms contribute much less ambiguity to genome assembly. To further investigate the potential for sequence polymorphism within a V. destructor population, we identified trinucleotide microsatellite loci in the genomic sequence and obtained amplification products for ten of these (see Methods). Consistent with our estimate of SNP frequency, we found no polymorphism at these loci in 65 individual mites collected from research apiaries at the USDA-ARS facility in Beltsville, Maryland, the source of the genome survey pool.

Discussion

V. destructor is considered the most damaging honey-bee pest and has become widespread since its host shift from A. cerana less than a century ago. Resistance to common acaricides has already appeared [53], and the development of new control strategies are hampered by our limited knowledge of the V. destructor - A. mellifera interaction, particularly at the genetic level. The present genome survey makes available a large number of genic sequences for analysis and manipulation by the community of researchers. The contigs we obtained from low-coverage shotgun sequencing were short, as expected, such that few complete gene models are likely to be annotated from this data set. Nonetheless, our assembly enables the identification of genes of interest and the cloning of complete transcripts as they are needed. The assembly will also greatly assist the validation and annotation of transcriptome surveys and can support proteomic initiatives. We hope the resources provided here will aid investigators already tackling the problem of mite control with molecular methods as well as encourage the involvement of others. Genetic approaches to the study of mite control are promising for a number of reasons. Successful reproduction of Varroa mites requires precise coordination with the care of honey bee brood and a sophisticated evasion of honey bee defences. Chemosensory genes are among those likely to play crucial roles in this process. At the phenotypic level, there is known variation among Varroa haplotype groups and species in their ability to successfully parasitize A. mellifera [16,17], as well as known variation in the resistance of honey bee strains [14,15,54,55]. While Varroa mites are not tractable to controlled crosses, associative mapping of traits such as reproductive success on different hosts remains an attractive possibility, as is the mapping of resistance traits in honey bee. Resequencing efforts are needed to uncover genetic variation that can be exploited for these purposes. Those efforts would also contribute to a better understanding of the demographic history of V. destructor and to species relationships within the genus. Polymorphic markers within haplotype groups would aid investigations of the population biology of the species, particularly in light of the difficulty of observing or manipulating Varroa mites in their habitat. For example, estimates of outcrossing and migration might be relevant to the design of new mitigation strategies, particularly if the evolution of resistance traits is expected. While consistent with previous work [23] that found low genetic polymorphism within the predominant V. destructor lineage, our analysis nonetheless enables genome-scale mining of markers for population-genetic studies. Our analysis of conserved peptide blocks showed a higher rate of protein evolution within the Varroa lineage relative to Ixodes. It remains to be clarified whether this level of sequence divergence is characteristic of mites or peculiar to the Varroa lineage. Similarly, whether this result correlates with divergence in other aspects of genome evolution, such as exon structure and regulatory features, will be an important question to pursue as annotations improve for both species. As genomic resources for V. destructor continue to improve, opportunities for evolutionary comparisons with other arthropods will be enriched. Such comparisons are of tremendous value because they can expose conserved elements that might otherwise elude detection by direct experiment, and they reveal the relative rates at which various classes of homologous sequence diverge. Varroa mites and others in the Parasitiformes comprise a lineage that diverged from ixodid ticks over 300 million years ago [56], while the chelicerates as a whole branched from the insects and crustacea 725 million years ago [57]. Consequently, as a representative of the Parasitiformes, Varroa provides a key evolutionary landmark for comparative studies across arthropods currently targeted for genomic analyses. An accessory goal of genome projects targeting arthropod pests is the identification of novel microbes and viruses that may be relevant to the epidemiology of vectored diseases, or that lend themselves to biocontrol programs. A significant finding of this study was the discovery of an actinomycete bacterium that infects V. destructor at intermediate frequencies (albeit presumably at high titer given its abundance in the genome sequence) but apparently does not infect A. mellifera at appreciable levels. However, these findings are preliminary and await a more systematic survey of infection among mites and bees. Future research should also be directed toward isolating this bacterium and assessing the fitness consequences of infection. Further characterization of the putative baculovirus identified in this survey is similarly a priority. This work contributes to the relatively small body of genomic studies to date that have applied next-generation sequencing to a complex eukaryotic genome phylogenetically distant from other reference genomes. As the costs and technical requirements for genome sequencing continue to decline, such studies will undoubtedly become commonplace. In many cases, the sequencing of a single genotype or inbred group will not be feasible, and there may also be a significant metagenomic contribution from associated microbes. While these factors introduce new challenges, our results underscore the utility of these methods for rapidly advancing the study of non-model organisms.

Conclusions

Our results have provided general tools for the research community and novel directions for investigating the biology and control of Varroa mites. Ongoing development of Varroa genomic resources will be a boon for comparative genomics of under-represented arthropods, and will further enhance the honey bee and its associated pathogens as a model system for studying host-pathogen interactions.

Methods

Genome-size estimation

Samples were prepared for flow cytometry as previously described [27]. For each replicate, the synganglion of a mature female V. destructor was placed along with the head of a mature female D. virilis into a 2 ml tissue grinder (Kimble-Kontes) containing 1 ml of cold Galbraith buffer, and stroked 15 times with the A pestle to release nuclei. The preparation was filtered through 20 μm nylon and stained with prodidium iodide to a final concentration of 50 ppm. Stained samples were held on ice in the dark for 1-2 hr prior to analysis. The mean fluorescence of stained nuclei in replicate preparations of Varroa and D. virilis standard was quantified using a Coulter Epics Elite flow cytometer (Coulter Electronic), with excitation provided by a laser tuned at 488 nm and 25 mW. PI fluorescence at > 615 nm was detected by a photomultiplier screened by a long pass filter. To ensure that scoring included only intact nuclei free from cytoplasmic tags, counting was activated by red fluorescence (discrimination), and only (gated) nuclei with low forward and side scatter were included in the analysis. The positions of sample peaks relative to the D. virilis peak were verified by running samples without a standard. DNA content was determined from co-preparations as the ratio of the 2C Varroa peak to the 2C D. virilis peak times the 1C genome size of D. virilis (333 Mb, after [58]).

Sample preparation and sequencing

V. destructor mites were collected on two occasions for sequencing from infested colonies of the USDA-ARS Bee Research Laboratory apiaries in Beltsville, MD, USA in October, 2008. For each collection, 300 bees were placed into a 0.5 liter glass jar containing 40 g confectioner's sugar. The sugar and bees were thoroughly mixed by shaking the jar for 30 s. The sugar and phoretic mites were then separated from their bee hosts by shaking the jar contents through a 1 mm wire mesh placed at the jar opening. Mites were shaken into a small water bath, which was then poured through a cheesecloth filter and rinsed twice with sterile water to remove residual sugar. Live mites were then picked onto sterile tissue paper and frozen at -80°C until nucleic acid extraction. To obtain sufficient high-quality DNA for six pyrosequencing runs, three separate DNA extractions were made from the collected mites. DNA from one sample of ~400 mites was extracted with DNAzol (Invitrogen) following the manufacturer's instructions. A second sample of ~400 mites was homogenized in 800 μl proteinase K buffer (10 mM NaCl, 10 mM Tris, 50 mM ethylenediamenetetracetic acid (EDTA), and 10 μg/ul proteinase K) and incubated 60 min at 55°C, vortexing every 20 min. Afterwards, 180 μl of 8 M potassium acetate was added and the sample incubated on ice for 30 min. After high-speed centrifugation, DNA was precipitated from the supernatant with ethanol and re-suspended in distilled, deionized water. A third sample of ~200 mites was homogenized in 500 μl hexadecyltrimethylammonuim bromide (CTAB) buffer (100 mM Tris-HCl at pH 8.0, 20 mM EDTA, 1.4 M NaCl, 2% CTAB, and 0.2% β-mercaptoethanol) and incubated 60 min at 65°C, vortexing every 20 min. An equal volume of 24:1 chloroform:isoamyl alcohol was then added and the sample centrifuged at high speed. DNA was precipitated from the supernatant with isopropanol and re-suspended in distilled, deionized water. For all extractions, DNA concentration and quality were evaluated with a Nanodrop ND-8000 spectrophotometer and were found to be comparable. DNA quality was also checked by gel electrophoresis. Pyrosequencing was performed at the Institute for Genome Sciences, University of Maryland School of Medicine, on a Genome Sequencer FLX instrument (454 LifeSciences) using GS-FLX titanium reagents. DNA was prepared for emulsion PCR according to the manufacturer's protocols.

Assembly and analysis

Contigs were assembled with the CABOG package of Celera Assembler version 5.2 [31]. The sequences were assembled iteratively, adjusting the assumed error rate incrementally between 0% and 6%. The assembly selected for analysis used a 1.5% error rate because this value maximized the length of the longest contig (18.7 Kbp). The weighted median N50 contig size was relatively stable across iterations at ~2.1 Kbp, meaning that half of the assembled bases were consistently contained in contigs of this size or larger across the different assemblies. Contigs were screened to identify sequences of organisms that were considered potential contaminants a priori. For example, a number of contigs were found to be nearly identical to the honey bee reference genome [59]. These fragments included low-copy genic sequences as well as ribosomal, nongenic, and mitochondrial sequence. PCR primers specific to A. mellifera sequences amplified genomic DNA extracted from adult female mites but not from embryos (data not shown), implying that the source of A. mellifera contamination is bee hemolymph consumed by mites. In contrast, searches against the genome sequences [21] of chalkbrood (Ascosphaera apis), a fungal pathogen of honey bees, and American foulbrood (Paenibacillus larvae), a bacterial pathogen, did not reveal the presence of these spore-dispersed microbes in the sample. All contigs were also screened for general bacterial contamination by searching ORFs of 90 codons or more against the RAST [60] seed database of bacterial sequences. ORFs were identified with the getorf program of the EMBOSS package [61]. ORFs with significant matches to the RAST database were then searched by BLASTP against the full GenBank nr database to determine the most closely matching organism. Candidate microbial sequences are summarized in Table 6. As expected (see Results), matches to the phylum Actinobacteria are the vast majority. Among the small number of BLASTP matches to other bacterial groups, the genera Burkholderia (β-proteobacteria) and Pseudomonas (γ-proteobacteria) were the most represented taxa.
Table 6

Distribution of contigs that were designated bacterial by BLAST analysis, sorted by phylum

PhylumNumber of contigs
Actinomycete1035

α-proteobacteria10

Aquificae1

Bacteroides2

β-proteobacteria13

Cyanobacteria3

δ-proteobacteria3

Euryarachaeota1

Firmicutes4

γ-proteobacteria12
Distribution of contigs that were designated bacterial by BLAST analysis, sorted by phylum Because many organisms show distinct patterns of codon usage [62], we compared codon usage for ORFs from unfiltered contigs (putatively V. destructor) with those from putatively bacterial contigs. Only ORFs with BLAST-supported homology to GenBank sequences were used for this comparison. We used the program INCA [63] to plot the codon-usage statistic 'B' of [62] as a function of third-position G+C (GC3) content (Additional file 6). The value of B for a given ORF is a measure of how similar its codon usage is to the overall codon usage in the data set. GC3 is considered here because third positions are much less constrained by protein function than first and second positions, and thus more indicative of background composition biases. The distinct patterns observed for the two groups of ORFs provide complementary evidence that these sequences do in fact derive from different organisms. The plot also shows that a few ORFs from contigs considered to be Varroa by our filtering methods may in fact be bacterial in nature and merit further evaluation. Of course, BLAST-supported ORFs are only proxies for transcripts and thus individual points may be highly inaccurate. In general, however, genic sequences that are putatively from V. destructor have a cohesive pattern of codon usage that can be distinguished form at least some bacterial contaminants, regardless of detectable homology. To confirm the presence in mites of the actinomycete bacterium and DNA virus identified in the assembly, individual eggs, nymphs, female adults, and male adults were collected from parasitized honey bee pupae. DNA for PCR was extracted from individual samples by grinding them in 200 μl of 5% Chelex-100 solution (Bio-Rad), incubating at 65°C for 30 min, pelleting the mixture by high-speed centrifugation, and taking a 1:10 dilution in water of the resulting supernatant. Primers for the putative actinomycete TIF3 locus were CCGATCTCGACCTTGTGGAA (forward) and CTCGGAACATGATCGTCACC (reverse), and for the ABC locus were GAGGTCCTCGTCTCCGAATG (forward) and CGATGTCCTGGATCCTCTGG (reverse). The amplified TIF3 product was confirmed by Sanger sequencing (GenBank:GU365869). Primers designed to amplify the putative Baculovirus targeted a ribonucleotide reductase small subunit gene (forward ACGAACGACTATCTAGCCATGAAC and reverse GTCCGTTTCGGAGTGCATGAC) and a thymidylate synthase gene (forward CGCATGTACCAACAACTCGTAC and reverse CACAGTTGGTGTAGCGCAGT). The identities of these products were also confirmed by Sanger sequencing (GenBank:GU980896 and GenBank:GU980897, respectively). All PCR reactions were performed using standard reagents and thermocycler protocols, with an annealing temperature of 54°C. To identify conserved peptide blocks, we first identified V. destructor ORFs that were reciprocal best BLASTP matches with I. scapularis predicted peptides. These were then used to identify the closest homologs in Da. pulex, Dr. melanogaster, and P. humanus. Sequences were aligned by ClustalW and then trimmed to include only blocks of well conserved, unambiguously aligned sequence for which we could have reasonable confidence of orthology. Genetic-distance matrices were calculated for each block with the protdist program of the PHYLIP package [64], weighted by alignment length and summed, then normalized to a maximum distance of one. Unrooted dendrograms were constructed with the fitch and neighbor programs of the PHYLIP package, giving virtually identical branch lengths; the neighbor-joining dendrogram is shown in Figure 5. Microsatellite loci used to assess polymorphism levels in V. destructor are characterized in Additional file 7. PCR amplifications consisted of 1 U Taq DNA polymerase with appropriate buffer, 1 mM dNTP, 2 mM MgCl2, 0.2 μM of each forward and reverse primer in a final reaction volume of 5 μl. Fluorescently labeled primers were mixed with unlabeled primers at a 12:20 ratio. Thermocycling was performed as follows: 96°C for 2 min., then 3 cycles of 96°C for 30 sec., 60°C for 30 sec. (-1°C/Cycle), 65°C for 1 min., followed by 35 cycles of 96°C for 30 sec., 56°C for 30 sec., 65°C for 1 min, and a final extension at 65°C for 2 min. PCR products were diluted 1:20 and 1 μl of this dilution was added to 10 μL formamide containing the LIZ size standard. Products were analyzed by capillary electrophoresis using an Applied Biosystems 3730XL instrument. Allele sizes were scored using ABI GeneMapper version 3.7 (Applied Biosystems).

Authors' contributions

RSC led the bioinformatic analyses and writing. JDE designed and coordinated the project and helped with analyses and writing. MCS generated the genome assembly. JSS performed the genome size estimation. YPC and JSP participated in project design and the collection of biological materials. GH, LB, CE, DA, and CMG aided in data analysis and manuscript preparation. All authors read and approved the final manuscript.

Additional file 1

Annotation statistics for filtered high G+C contigs. Annotation statistics derived from the BLAST2GO annotation tool [34]. A. Distribution of BLASTX hits (E ≤ 10-10) by organism. Note that the "Others" category is typically the most abundant in this type of analysis because of the wide taxonomic distributions of many conserved proteins. B. Distribution of BLASTX hits by sequence similarity score. C. Distribution of BLASTX hits by expectation. Click here for file

Additional file 2

Contigs identified as deriving from a novel virus of the Baculoviridae. Fasta-formatted contigs were classified as described in text. Also included are the methionine-initiated ORFs of 90 codons or more that are referenced in Table 3. Click here for file

Additional file 3

BLAST-annotated . Spreadsheet of Varroa destructor genomic contigs with significant similarity to the GenBank nr database by BLAST search. Click here for file

Additional file 4

ORFs with Pfam domains. Spreadsheet of significant Pfam domains within ORFs having BLASTP-detected similarity to GenBank sequences. Click here for file

Additional file 5

ORFs referenced in Additional file 3and Additonal file 4. Fasta-formatted ORFs from V. destructor contigs that had significant sequence similarity to database sequences. Click here for file

Additional file 6

Comparison of ORF codon usage for contigs assigned as either . Scatterplot comparing G+C content and codon usage of ORFs from contigs assigned as either Varroa destructor or bacterial. The X-axis value is third position G+C and the Y-axis value is the codon usage statistic B [62], which as used here is a measure of the difference in codon usage between each subgroup of ORFs relative to the whole. The possible range of values for B is 0 to 2, with larger values corresponding to greater divergence in codon frequencies. A. Residual contigs after filtering, which are assumed to all derive from V. destructor. B. Contigs filtered because they have a higher BLAST score to bacterial sequences than to eukaryotic sequences. The two groups of contigs have distinct patterns of codon usage and nucleotide composition. Click here for file

Additional file 7

Microsatellite loci used in . Table lists contig containing the microsatellite locus, forward and reverse primer sequences, expected product size based on the reference contig, and the 5' start coordinate on the contig for the forward primer. Click here for file
  40 in total

1.  EMBOSS: the European Molecular Biology Open Software Suite.

Authors:  P Rice; I Longden; A Bleasby
Journal:  Trends Genet       Date:  2000-06       Impact factor: 11.639

Review 2.  Repbase Update, a database of eukaryotic repetitive elements.

Authors:  J Jurka; V V Kapitonov; A Pavlicek; P Klonowski; O Kohany; J Walichiewicz
Journal:  Cytogenet Genome Res       Date:  2005       Impact factor: 1.636

Review 3.  Turning junk into gold: domestication of transposable elements and the creation of new genes in eukaryotes.

Authors:  Jean-Nicolas Volff
Journal:  Bioessays       Date:  2006-09       Impact factor: 4.345

4.  The invasive Korea and Japan types of Varroa destructor, ectoparasitic mites of the Western honeybee (Apis mellifera), are two partly isolated clones.

Authors:  Michel Solignac; Jean-Marie Cornuet; Dominique Vautrin; Yves Le Conte; Denis Anderson; Jay Evans; Sandrine Cros-Arteil; Maria Navajas
Journal:  Proc Biol Sci       Date:  2005-02-22       Impact factor: 5.349

Review 5.  Parasitic mites of honey bees: life history, implications, and impact.

Authors:  D Sammataro; U Gerson; G Needham
Journal:  Annu Rev Entomol       Date:  2000       Impact factor: 19.686

6.  Genome sequence of the pea aphid Acyrthosiphon pisum.

Authors: 
Journal:  PLoS Biol       Date:  2010-02-23       Impact factor: 8.029

7.  Codon usages in different gene classes of the Escherichia coli genome.

Authors:  S Karlin; J Mrázek; A M Campbell
Journal:  Mol Microbiol       Date:  1998-09       Impact factor: 3.501

8.  Genome sequences of the honey bee pathogens Paenibacillus larvae and Ascosphaera apis.

Authors:  X Qin; J D Evans; K A Aronstein; K D Murray; G M Weinstock
Journal:  Insect Mol Biol       Date:  2006-10       Impact factor: 3.585

9.  Insights into social insects from the genome of the honeybee Apis mellifera.

Authors: 
Journal:  Nature       Date:  2006-10-26       Impact factor: 49.962

10.  The colonization of land by animals: molecular phylogeny and divergence times among arthropods.

Authors:  Davide Pisani; Laura L Poling; Maureen Lyons-Weiler; S Blair Hedges
Journal:  BMC Biol       Date:  2004-01-19       Impact factor: 7.431

View more
  47 in total

1.  The power and promise of applying genomics to honey bee health.

Authors:  Christina M Grozinger; Gene E Robinson
Journal:  Curr Opin Insect Sci       Date:  2015-08-01       Impact factor: 5.186

2.  Comparison of tau-fluvalinate, acrinathrin, and amitraz effects on susceptible and resistant populations of Varroa destructor in a vial test.

Authors:  Martin Kamler; Marta Nesvorna; Jitka Stara; Tomas Erban; Jan Hubert
Journal:  Exp Appl Acarol       Date:  2016-02-24       Impact factor: 2.132

3.  Changes in the Bacteriome of Honey Bees Associated with the Parasite Varroa destructor, and Pathogens Nosema and Lotmaria passim.

Authors:  Jan Hubert; Martina Bicianova; Ondrej Ledvinka; Martin Kamler; Philip J Lester; Marta Nesvorna; Jan Kopecky; Tomas Erban
Journal:  Microb Ecol       Date:  2016-10-11       Impact factor: 4.552

4.  Transcriptome sequencing and annotation of the predatory mite Metaseiulus occidentalis (Acari: Phytoseiidae): a cautionary tale about possible contamination by prey sequences.

Authors:  Marjorie A Hoy; Fahong Yu; Jason M Meyer; Oscar A Tarazona; A Jeyaprakash; Ke Wu
Journal:  Exp Appl Acarol       Date:  2012-08-25       Impact factor: 2.132

5.  Metatranscriptome Analysis of Sympatric Bee Species Identifies Bee Virus Variants and a New Virus, Andrena-Associated Bee Virus-1.

Authors:  Katie F Daughenbaugh; Idan Kahnonitch; Charles C Carey; Alexander J McMenamin; Tanner Wiegand; Tal Erez; Naama Arkin; Brian Ross; Blake Wiedenheft; Asaf Sadeh; Nor Chejanovsky; Yael Mandelik; Michelle L Flenniken
Journal:  Viruses       Date:  2021-02-12       Impact factor: 5.048

6.  Two novel viruses associated with the Apis mellifera pathogenic mite Varroa destructor.

Authors:  Sofia Levin; Noa Sela; Nor Chejanovsky
Journal:  Sci Rep       Date:  2016-11-24       Impact factor: 4.379

7.  The Draft Genome Assembly of Dermatophagoides pteronyssinus Supports Identification of Novel Allergen Isoforms in Dermatophagoides Species.

Authors:  Thomas A Randall; James C Mullikin; Geoffrey A Mueller
Journal:  Int Arch Allergy Immunol       Date:  2018-01-11       Impact factor: 2.749

8.  Protecting honey bees: identification of a new varroacide by in silico, in vitro, and in vivo studies.

Authors:  Fabienne Dulin; Céline Zatylny-Gaudin; Céline Ballandonne; Bertrand Guillet; Romain Bonafos; Ronan Bureau; Marie Pierre Halm
Journal:  Parasitol Res       Date:  2014-10-31       Impact factor: 2.289

9.  Gene-knockdown in the honey bee mite Varroa destructor by a non-invasive approach: studies on a glutathione S-transferase.

Authors:  Ewan M Campbell; Giles E Budge; Alan S Bowman
Journal:  Parasit Vectors       Date:  2010-08-16       Impact factor: 3.876

10.  Comparison of Varroa destructor and Worker Honeybee Microbiota Within Hives Indicates Shared Bacteria.

Authors:  Jan Hubert; Martin Kamler; Marta Nesvorna; Ondrej Ledvinka; Jan Kopecky; Tomas Erban
Journal:  Microb Ecol       Date:  2016-04-29       Impact factor: 4.552

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.