Literature DB >> 29398854

Calcitonin receptor gene polymorphisms at codon 447 in patients with osteoporosis and chronic periodontitis in South Indian population - An observational study.

Anuradha Ankam1, Rekha Rani Koduganti1.   

Abstract

CONTEXT: Chronic periodontitis and osteoporosis are multifactorial diseases which share common risk factors. Interactions between genetic and other factors determine the likely hood of osteoporotic fractures and chronic periodontitis. Calcitonin receptor (CTR) gene polymorphism is one of the important factors which contribute to the development of osteoporosis and chronic periodontitis. AIMS: This study highlights the association of CTR gene polymorphisms at codon 447 in patients with osteoporosis and chronic periodontitis and healthy controls in south Indian population. SETTINGS AND
DESIGN: The study was designed as a case-control retrospective, observational clinical trial which was conducted to assess the role of CTR gene polymorphism in patients with osteoporosis and periodontitis as well as in healthy controls.
MATERIALS AND METHODS: A total of 50 subjects were taken into the study comprising of 20 healthy and 30 osteoporotic subjects with chronic periodontitis between the age group of 30-55 years. Within the limitations of our study, only 50 subjects were taken in the study due to the strict sampling method (Patients who were just diagnosed with osteoporosis and periodontitis and hence not taking any medication). 2 ml of blood sample was collected in ethylenediamine tetra acetic acid containing vials, and polymerase chain reaction was run to identify CTR gene polymorphism. STATISTICAL ANALYSIS USED: Statistical analysis was done by student t-test. Pertaining to C > T allele pattern there was a significant difference between the test and control group.
RESULTS: A significant difference was observed between the test and control group in relation to the C > T allele pattern. Patients showing TT genotype distribution had greater periodontal destruction and lower bone-mineral density compared to CT genotype distribution followed by CC genotype distribution indicating TT homozygotes are more prone to the development of osteoporosis with increased risk of fracture and loss of alveolar bone. Males and females showed equal susceptibility to osteoporosis and chronic periodontitis.
CONCLUSIONS: CTR polymorphism at codon 447 may be associated with osteoporosis and chronic periodontitis.

Entities:  

Keywords:  Calcitonin; chronic periodontitis; osteoporosis; single nucleotide polymorphism

Year:  2017        PMID: 29398854      PMCID: PMC5771106          DOI: 10.4103/jisp.jisp_128_16

Source DB:  PubMed          Journal:  J Indian Soc Periodontol        ISSN: 0972-124X


INTRODUCTION

Periodontitis is said to be a chronic multifactorial disease which if left untreated causes deleterious effects on the supporting tissues of the teeth. The World Health Organization, defined osteoporosis as “a systemic skeletal disease characterized by low bone mass and microarchitectural deterioration of bone tissue, with a consequent increase in bone fragility and susceptibility to fractures.[1] Oral osteopenia and systemic osteopenia are chronic multifactorial diseases, sharing common risk factors.[2] Kribbs et al. in 1990 after conducting numerous studies on the interlink between osteoporosis and periodontitis, concluded that the osteoporotic patients had lower bone-mineral density (BMD) and thinner cortex at the gonion region of the lower jaw when compared to the controls.[3] Risk factors common to both are genetic, dietary, environmental, and systemic factors. The possibility of developing osteoporosis and periodontitis is increased when there is an interplay between genetic and other contributing factors. Loe et al. in 1986 were of the opinion that genetic and other environmental attributes play an important role in disease expression rather than the oral hygiene maintenance alone. Moreover, they stated that all individuals were not at equal risk of developing periodontitis.[4] Out of all genetic factors, calcitonin receptor (CTR) gene polymorphism is one important factor which contributes to the development of osteoporosis and chronic periodontitis. Calcitonin (CT) comprised of 32 amino acids is primarily synthesized by the thyroid gland. Its pivotal role is in the maintenance of blood calcium levels due to its inhibitory effect on the osteoclasts. Nakamura et al. in 1997 stated that a C/T variation at codon 447 (nucleotide 1340) of CTR gene causes a change in amino acid proline to lucine.[5] Dr. Genaro M. A. Palmieri et al. in 1989 observed that giving osteoporotic women high doses of vitamin D with CT negated chances of further bone resorption.[6] Cardona and Pastor in 1997 observed that providing CT in the form of injections or by intranasal application reduced the susceptibility of fractures among postmenopausal women.[7] Thus, the purpose of this study was to ascertain the role of CTR gene polymorphism at codon 447 in the test group and the control group.

MATERIALS AND METHODS

The study was designed as a case–control retrospective, observational clinical trial conducted to identify the effect of CTR gene polymorphisms at codon 447 in both the test and control groups. The study was conducted according to the guidelines of the Helsinki declaration of 1975, as revised in 2000, and after approval of the Institutional Review Board (NCT02273128). A total of 50 subjects both male and female were selected through medical camp at Shivam hospital, kukatpally, Hyderabad, into the study comprising of 20 healthy (Control group) and 30 osteoporotic subjects with chronic periodontitis between the age group of 30–55 years of age (Test group). All patients were subjected to periodontal clinical examination using CPITN-C probe. Patients who were diagnosed as osteoporotic with chronic periodontitis and who had not yet started any treatment and willing to participate were enrolled in the study. Subjects were diagnosed as osteoporotic when the BMD was ≥−2.5 and with community periodontal index (CPI) ≥3. Patients who were systemically compromised, under any medications such as steroids, smokers, pregnant, and lactating women were excluded from the study. The importance and need for the study were explained to the selected subjects, and informed consent was taken from them. A volume of 2 ml of blood sample from each subject was taken and stored in vials containing ethylenediamine tetraacetic acid (EDTA) at − 20°C until DNA extraction by sucrose method. Polymerase chain reaction (PCR) was run followed by digestion by Alu 1 restriction enzyme. Gel electrophoresis was done to identify the DNA fragments. The amplified product size was 251 bps. To see the T > C polymorphism, PCR was carried out with the following primers. Forward primer: TATGTGATGGACTACCCAGG and reverse primer: CCTCTACATGGCCCTGTCTT. A 10 μl-Pcr mix, contained 1 μl of PCR buffer with MgCl2, 0.2 μl of dNTP's, 0.1 μl of each of the primers, 0.2 μl of taq polymerase, and the remaining was water along with 1 μl of DNA template containing 50–100 ng of genomic DNA. After mixing all the contents, the tubes were placed in a thermocycler [Figure 1], and the following conditions were setup. An initial denaturation was performed at 95°C for 7 min, followed by 30 cycles of further denaturation at 94°C for 30 s and was subjected to annealing at 54°C for 45 s. The final extension was achieved at 72°C for 5 min which was held at 4°C for 10 min [Figure 2]. After PCR amplification, to detect CTR mutation, Alu I restriction enzyme was used at CTG codon encoding the amino acid leucine forming a cuttable site. An uncuttable site at codon CCG encoding the amino acid proline will remain intact (228 bp). If the product is excisable, two fragments of 120 and 108 bp will be present. The presence of single band indicates homozygous normal (CC genotype), digested two band denotes TT genotype (120 and 108 bp), and three bands as heterozygous CT genotype [Figure 3].
Figure 1

Biorad thermocycler

Figure 2

Polymerase chain reaction samples lane 1–4 digestion with 50 bp ladder

Figure 3

Calcitonin receptor C > T genotypes after Alu I digestion

Biorad thermocycler Polymerase chain reaction samples lane 1–4 digestion with 50 bp ladder Calcitonin receptor C > T genotypes after Alu I digestion

DNA extraction by sucrose method

Five hundred microliter of blood was added to 1000 μL of red blood cell lysis buffer and was mixed properly and centrifuged for 2 min at 7000 rpm. Supernatant solution was discarded, and step 1 and 2 were repeated until the white pellet was formed. To this 400 μL of nucleic acid buffer, 100 μL of 5 molar Nacl and 600 μL of chloroform were added and centrifuged at 7000 rpm for 2 min. 400 μL of supernatant was transferred to new Eppendorf tube, and 800 μL of chilled ethanol was and centrifuged for 1 min at 12,000 rpm. Supernatant was carefully discarded and air dried at room temperature.

Red cell lysis buffer preparation

Three hundred and twenty millimeter of sucrose, 5 mM of magnesium chloride, 0.01M of tris hydrochloride, and 1% triton were added to distilled water.

Nucleic lysis buffer preparation

11.4 mM of sodium citrate, 1 mM of ethylene diamine tetracetic acid, 1% sodium dodecyl sulfate, and 0.01 mM tris hydrochloride were added to distilled water.

Chemicals and reagents used in agarose gel electrophoresis

Bromophenol blue, 40% sucrose, loading dye, ethidium bromide, ×10 tris borate EDTA (TBE) buffer and 1x TBE buffer

Statistical analysis

Student t-test was used for statistical analysis pertaining to C > T allele distribution among patients and controls.

RESULTS

Table 1 shows statistical significant difference in genotype distribution between test (Patients with osteoporosis and periodontitis) and control group (healthy subjects).
Table 1

Intergroup distribution of calcitonin receptor C > T gene polymorphism in patients and controls

Intergroup distribution of calcitonin receptor C > T gene polymorphism in patients and controls Table 2 shows no statistical significant difference between males and females in C > T gene polymorphism.
Table 2

Intragroup distribution of calcitonin receptor C > T gene polymorphism in males and females

Intragroup distribution of calcitonin receptor C > T gene polymorphism in males and females Table 3 shows the mean BMD value for females and males was -2.63 ± 0.15 and − 2.60 ± 0.11 respectively. The mean CPI value for females and males was 3.41 ± 0.33 and 3.84 ± 0.41, respectively. The mean age of females and males was 53.43 ± 7.38 and 54.21 ± 7.19, respectively.
Table 3

Intragroup comparison of parameters

Intragroup comparison of parameters Table 4 shows correlation between BMD and CPI among three different genotypes. TT homozygote's showed lesser BMD and greater CPI compared to CT heterozygotes and CC homozygotes in the test group. Thus, it can be inferred that patients with TT Genotype had less BMD and more periodontal attachment loss when compared to patients with CT Genotype and CC Genotype, respectively.
Table 4

Intragroup comparison of bone mineral density and Community Periodontal Index

Intragroup comparison of bone mineral density and Community Periodontal Index

DISCUSSION

Approximately 30,000–40,000 genes are involved in the human genetic framework. Only 5% of the genome contains genes of higher density whereas the function of the remaining DNA is yet to be understood. Homosapiens share 99.9% of identical genetic information and differ only by 0.1%. This very small variation could be the reason behind difference in disease susceptibility, and treatment response among individuals.[8] Researchers have estimated that every person has six billion nucleotides and 0.1% is polymorphic. Only a small fraction of these genetic variations are translated into alterations in amino acid sequence that is phenotypically important. Mutations lead to polymorphisms and a variation in only a single base pair is called a point mutation. Transition is the most common form of point mutation wherein the substitution of one nucleotide with another takes place, and the location harboring such a change is called a single nucleotide polymorphism. CT is a polypeptide hormone synthesized by the thyroid gland which plays a pivotal role in calcium homeostasis. The target cells are activated by the hormone by the CTR receptors which are a group of Class II G protein-coupled receptors. CT maintains blood calcium levels by directly inhibiting bone resorption and enhancing the efflux of calcium by the kidney. CTR is a very complex gene with minimum of 14 exons. A number of single nucleotide polymorphisms have been identified mostly present on the coding region except for two single nucleotide polymorphisms present on noncoding region. Hence, the present study was done to assess the presence of CTR gene polymorphisms in both the test and control groups. The CTR C > T pattern differed significantly between the patients and controls. 13 patients showed CT distribution and 4 patients showed TT distribution compared to 5 controls showing CT distribution and absent TT distribution. Moreover, the patients showing TT distribution had greater periodontal destruction and lower BMD compared to CT distribution followed by CC distribution, indicating that the presence of TT homozygous genotype increases the susceptibility of developing both osteoporosis and chronic periodontitis. There was no statistically significant difference in this study when CTR, C > T distribution was compared between males and females suggesting that both males and females are equally susceptible to osteoporosis and chronic periodontitis. This is contradictory to the study reported by Harvey et al. in 2008, wherein they observed that 50% of women and 20% of men have increased risk of fractures during their lifetime.[9] Woolf and Pfleger, in 2003 found that the percentage prevalence of osteoporosis increases more in women (5% at 50 years of age to 50% at 85 years of age) when compared to men (2.4%–20%).[10] Nosaka et al. in 2002 in their study evaluating the link between ctr gene polymorphism and early marginal bone loss around endosseous implants commented that patients with ctr gene polymorphism were 20 times more likely to present buccal marginal bone loss than patients who did not have the polymorphism.[11] Mittal et al. have done a study to evaluate the presence of polymorphisms of codon 447 CTR gene in 105 North Indians. It was observed that 26 individuals (24.8%) were C/C, 73 (69.5%) were C/T heterozygotes and remaining 6 (5.7%) were T homozygotes. It was observed that individuals with T/T allele are more prone to loss of BMD whereas the heterozygous state (T/C) provides protection against osteoporosis. They concluded that the SNP at Codon 447 in the ctr gene is linked with osteoporosis particularly in postmenopausal women.[12] Lekha Menon M and Bharathi studied the role of polymorphisms in ctr gene among south Indians. Out of 9 individuals, they have studied, they found C homozygotes were about 66.67%, and 33.33% were C/T heterozygotes. In this study, they could not find TT homozygote and stated that C/T heterozygotes were less susceptible to fractures.[13] This is contrary to the present study which was also done in southindians where TT homozygote's are showing 8% frequency which was completely absent in controls, more over the patients with TT homozygote's showed less BMD and high CPI.

Limitations

Sample size of the study should have been larger for an observational study.

CONCLUSIONS

There are various common risk factors for the development of osteoporosis and chronic periodontitis. CTR gene polymorphism is one among them. The present observational study has shown positive correlation between CTR gene polymorphism in osteoporosis, and chronic periodontitis, where TT homozygote's in patient group showed lesser BMD and higher CPI. Thus from the present study, it can be concluded that patients with TT homozygote's are more prone to development of osteoporosis which increases the risk of fracture and loss of alveolar bone. More studies with larger sample size should be done to throw more light on the role of CTR gene polymorphisms in the etiology of chronic periodontitis and osteoporosis.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.
  9 in total

1.  Calcitonin versus etidronate for the treatment of postmenopausal osteoporosis: a meta-analysis of published clinical trials.

Authors:  J M Cardona; E Pastor
Journal:  Osteoporos Int       Date:  1997       Impact factor: 4.507

2.  Relationships between mandibular and skeletal bone in a population of normal women.

Authors:  P J Kribbs; C H Chesnut; S M Ott; R F Kilcoyne
Journal:  J Prosthet Dent       Date:  1990-01       Impact factor: 3.426

3.  Assessment of fracture risk and its application to screening for postmenopausal osteoporosis: synopsis of a WHO report. WHO Study Group.

Authors:  J A Kanis
Journal:  Osteoporos Int       Date:  1994-11       Impact factor: 4.507

4.  Allelic variants of human calcitonin receptor in the Japanese population.

Authors:  M Nakamura; Z Q Zhang; L Shan; T Hisa; M Sasaki; R Tsukino; T Yokoi; A Kaname; K Kakudo
Journal:  Hum Genet       Date:  1997-01       Impact factor: 4.132

5.  Effect of calcitonin and vitamin D in osteoporosis.

Authors:  G M Palmieri; J A Pitcock; P Brown; J G Karas; L J Roen
Journal:  Calcif Tissue Int       Date:  1989-09       Impact factor: 4.333

6.  Association of calcitonin receptor gene polymorphism with early marginal bone loss around endosseous implants.

Authors:  Yasuhiro Nosaka; Yoichi Tachi; Hitomi Shimpuku; Tatsuya Kawamura; Kiyoshi Ohura
Journal:  Int J Oral Maxillofac Implants       Date:  2002 Jan-Feb       Impact factor: 2.804

7.  Osteoporosis: "A risk factor for periodontitis".

Authors:  Rekha Rani Koduganti; Chandana Gorthi; P Veerendranath Reddy; N Sandeep
Journal:  J Indian Soc Periodontol       Date:  2009-05

Review 8.  Burden of major musculoskeletal conditions.

Authors:  Anthony D Woolf; Bruce Pfleger
Journal:  Bull World Health Organ       Date:  2003-11-14       Impact factor: 9.408

9.  Natural history of periodontal disease in man. Rapid, moderate and no loss of attachment in Sri Lankan laborers 14 to 46 years of age.

Authors:  H Löe; A Anerud; H Boysen; E Morrison
Journal:  J Clin Periodontol       Date:  1986-05       Impact factor: 8.728

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.