Literature DB >> 29386092

miR-522-3p Promotes Tumorigenesis in Human Colorectal Cancer via Targeting Bloom Syndrome Protein.

Feng Shuai1, Bo Wang2, Shuxiao Dong3.   

Abstract

miR-522-3p is known to degrade bloom syndrome protein (BLM) and enhance expression of other proto-oncogenes, leading to tumorigenesis. This study aimed to investigate the molecular mechanisms of miR-522-3p in human colorectal cancer (CRC) cells. Expressions of miR-522-3p in CRC and adjacent tissues, as well as in normal human colon epithelial cell line (FHC) and five CRC cell lines, were detected. Human CRC cell lines, HCT-116 and HT29, were transfected with miR-522-3p mimic, inhibitor, or scrambled controls. Then cell viability, apoptosis, cell cycle progression, and the expressions of c-myc, cyclin E, CDK2, and BLM were assessed. It was found that miR-522-3p was highly expressed in CRC tissues when compared to adjacent nontumor tissues and was highly expressed in CRC cell lines when compared to FHC cells. miR-522-3p overexpression promoted cell viability, reduced apoptotic cell rate, arrested more cells in the S phase, and upregulated c-myc, cyclin E, and CDK2 expression. BLM was a target gene of miR-522-3p, and miR-522-3p suppression did not exert antiproliferative and proapoptotic activities when BLM was silenced. These findings demonstrate that miR-522-3p upregulation negatively regulates the expression of BLM, with upregulation of c-myc, CDK2, and cyclin E, and thereby promoting the proliferation of human CRC cells.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 29386092      PMCID: PMC7844714          DOI: 10.3727/096504018X15166199939341

Source DB:  PubMed          Journal:  Oncol Res        ISSN: 0965-0407            Impact factor:   5.574


INTRODUCTION

Globally, colorectal cancer (CRC) is the third most commonly observed malignancy, which accounts for approximately 8% of all cancer-related deaths. Although CRC is common in Western countries, the past decade has witnessed a significant increase in the disease frequency in a number of Asia Pacific countries, which include China, Japan, Korea, and Singapore. MicroRNAs (miRNAs) are a class of small noncoding RNAs, 20–22 nucleotides in length, and play an important role in regulating the gene expression by directly binding to the 3′-untranslated region (3′-UTR) of target mRNAs1. It has been observed in a number of studies that miRNAs are one of the pivotal factors in many biological processes, such as cell differentiation, cell proliferation, apoptosis, and energy metabolism2. Moreover, recent studies have revealed that miRNAs play a dual role in oncology either by enhancing carcinogenesis through inhibiting tumor suppressors or by acting as tumor suppressors to downregulate the oncogenes. miRNAs have recently caught the attention of scientists worldwide in studying their correlation in CRC, where their expression is reproducibly altered and their expression patterns are associated with diagnosis, prognosis, and therapeutic outcomes in CRC3. miR-522 is a member of the chromosome 19 miRNA cluster (C19MC), a 100-kb, primate-restricted region that encodes 54 tandem miRNAs; this cluster is the largest miRNA cluster in the human genome4. miR-522 is reportedly upregulated in hepatocellular carcinoma, non-small cell lung cancer, and glioblastoma, and may contribute to the development of these tumors4–7. However, little is known about the role of miR-522-3p in CRC. Bloom syndrome protein (BLM) is a protein that is encoded by the BLM gene in humans. It is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Normal BLM protein is known to suppress inappropriate homologous recombination. It has been observed in a number of studies that tumors are associated with the overexpression of c-myc and the loss of BLM protein8. As discussed above, miRNAs play an important role in regulating gene expression by targeting and binding to the 3′-UTR of target mRNAs, where a number of miRNAs (e.g., miR-3129, miR-522, miR-527, miR-516, miR-518) are known to target BLM gene and modulate its expression9. The present study investigated the functional impacts and the molecular mechanisms of miR-522-3p on CRC cell growth.

MATERIALS AND METHODS

Human CRC Specimens

Fifteen paired CRC and matched adjacent nontumor tissues (5 cm away from the tumor tissues) were collected from CRC patients undergoing surgery between August 2014 and April 2016 in the Department of Gastrointestinal Surgery, Linyi People’s Hospital of China. Of the patients recruited, nine were men and six were women, ranging from 42 to 67 years old. TNM classification was based on the tumor pathology after surgery. None of the patients received chemotherapy or radiation therapy before surgery. Tumor tissues and the paired adjacent nontumor tissues were collected, and, after twice washing with ice-cold phosphate-buffered saline (PBS), tissues samples were placed in liquid nitrogen until RNA extraction. This study was approved by the Ethics Committee of the Linyi People’s Hospital and was performed in accordance with the ethical standards. Written informed consent was obtained from each patient before tissue collection.

Cell Culture

Normal human colon epithelial cell line (FHC) and five human CRC cell lines (HCT-116, HT29, LoVo, SW480, and SW620) were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). FHC cells were cultured in DMEM/F12 medium (ATCC) containing 25 mM HEPES, 10 ng/ml cholera toxin, 5 μg/ml insulin and transferrin, and 100 ng/ml hydrocortisone. LoVo cells, HCT-116 and HT29 cells, and SW480 and SW620 cells were grown in F-12K medium, McCoy’s 5a medium modified, and Leibovitz’s L-15 medium (all ATCC), respectively. All of the media were supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA). Cells were maintained at 37°C in a humidified incubator under 5% CO2 condition10.

Cell Transfection

For miRNA transfection, synthetic miR-522-3p mimic, inhibitor, and their scrambled negative control RNAs (mimic NC and inhibitor NC), purchased from GenePharma (Shanghai, P.R. China), were transfected into cells. The sequences for miR-522-3p mimics were CUCUAGAGGGAAGCGCUUUCUG (sense) and GAAAGCGCUUCCCUCUAGAGUU (antisense). The sequence for miR-522-3p inhibitor was CAGAAAGCGCUUCCCUCUAGAG. For suppressing BLM expression, BLM-specific targeted small interfering RNA (si-BLM; AGCAGCGAUGUGAUUUGCA) purchased from GenePharma was transfected into cells. Nontargeted sequence (si-NC) served as negative control of si-BLM. Cells were seeded in six-well plates and were transfected using Lipofectamine 2000 (Invitrogen, Grand Island, NY, USA) on the following day when the cells reached approximately 70% confluence. In each well, 100 pmol of miRNAs or 50 pmol of si-BLM (si-NC) was added. At 48-h posttransfection, cells were collected for use in the following experiments. The efficiency of transfection was evaluated using quantitative real-time polymerase chain reaction (qRT-PCR).

MTT Assay

After cell transfection, HCT-116 and HT29 cells were collected and seeded in 96-well plates with a density of 5 × 103 cells/well. The plates were incubated at 37°C for 1–5 days; 10 μl of MTT (5 mg/ml; Sigma-Aldrich, St. Louis, MO, USA) was added to each well, and this mix was incubated for 4 h at 37°C. At the end of incubation, 100 μl of 0.04 N HCl in 2-propanol was mixed thoroughly into each well. Plates were read using a microplate reader (Molecular Devices, Sunnyvale, CA, USA) at a wavelength of 570 nm, with a background reading at 650 nm subtracted. Triplicate readings for each sample were averaged11.

Western Blot Analysis

The cells were washed two times with PBS and then lysed with 1× SDS loading buffer (50 mM Tris-Cl, pH 6.8, 100 mM DTT, 2% SDS, 10% glycerol, and 0.1% bromophenol blue) as the whole-cell sample. The protein samples were subjected to SDS-PAGE. Immunoblottings were carried out with primary antibodies: anti-BLM, anti-c-myc, anti-cyclin E, anti-CDK2, anti-tubulin (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA). The proteins were detected by enhanced chemiluminescence (ECL-plus; Amersham Pharmacia Biotech, Piscataway, NJ, USA)12. Densitometric measurements of the bands in the Western blot analysis were performed using ImageJ 1.49 (National Institutes of Health, Bethesda, MD, USA), and protein levels were normalized to tubulin.

Luciferase Reporter Assay

The fragment from BLM 3′-UTR containing the predicted miR-522-3p binding site was amplified by PCR and then cloned into a pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) to form the reporter vector BLM-wild-type (BLM-wt). The sequence of putative binding site in the BLM-wt was mutated, and the resultant plasmid was named as BLM-mutated-type (BLM-mt). HCT-116 cells were cotransfected with miR-522-3p mimics or mimic NC, BLM-wt or BLM-mt, and the control vector containing Renilla luciferase. Transfection was performed using Lipofectamine 2000 (Invitrogen). At 48 h posttransfection, the luciferase activity was measured using a Dual-Luciferase Reporter Assay System (Promega).

Cell Cycle Assay

Cell cycle distribution was detected using the propidium iodide (PI) staining method and flow cytometric analysis. In brief, 1 × 105 miR-transfected cells were collected and suspended in ice-cold 70% ethanol. The cell suspension was kept at 4°C overnight, and then cells were collected and resuspended in 50 μg/ml PI (BD Biosciences, San Jose, CA, USA), 50 μg/ml RNase A (Solarbio, Beijing, P.R. China), and 0.1% Triton X-100 (Sigma-Aldrich) for 20 min at 37°C in the dark. In total, 3,000 cells were analyzed using a BD FACSCalibur flow cytometer (BD Biosciences). Proportions of the cells in the G0/G1, S, and G2/M phases were analyzed by the ModFit software (Verity Software House, Topsham, ME, USA).

Apoptosis Assay by FITC-Annexin V/PI Staining

Cell apoptosis was measured by FITC-Annexin V and PI double staining and flow cytometric analysis. The FITC-Annexin-V/PI detection kit from Beijing Biosea Biotechnology Co., Ltd. (Beijing, P.R. China) was utilized. Briefly, 1 × 105 miR-transfected cells were collected and suspended in 200 μl of binding buffer containing 10 μl of FITC-annexin V and 5 μl of PI. After 30 min of incubation at room temperature in the dark, a sample of 300 μl of PBS was added, and cells were analyzed using a BD FACSCalibur flow cytometer (BD Biosciences). Data were analyzed using the FlowJo 10.0.7 software (Treestar Inc., San Carlos, CA, USA)13.

RNA Extraction and Quantitative Real-Time PCR (qRT-PCR) Analysis

Total RNA in cell and tissue samples was extracted with TRIzol reagent (Invitrogen). RNA (500 ng) was polyadenylated and reversely transcribed to cDNA using an NCode miRNA First-Strand cDNA Synthesis Kit (Invitrogen). cDNA was used as the template for RT-PCR using FastStart Universal SYBR Green Master (Roche, Nutley, NJ, USA) with the universal reverse primers provided in the kit. Real-time PCR was performed on an Applied Biosystems real-time detection system (Applied Biosystems), and the thermocycling parameters were 95°C for 3 min and 40 cycles of 95°C for 15 s followed by 60°C for 30 s. Each sample was run in triplicate and was normalized to U6 snRNA levels [U6 primers 5′-CTTCGGCAGCACATATACT-3′ (forward) and 5′-AAAATATGGAACGCTTCACG-3′ (reverse)]. The primer sequences for miR-522-3p were 5′-GGGCTCTAGAGGGAAGCGC-3′ (forward) and 5′-CAGTGCGTGTCGTGGAGT-3′ (reverse). Melting curve analysis was performed to confirm the specificity of the PCR products. The replicates were then averaged, and fold induction was determined by a ΔΔCT-based fold change calculation14.

Statistical Analysis

All experiments were repeated three times. The results of the multiple experiments were presented as mean ± SD. Statistical analyses were performed using SPSS 19.0 statistical software (SPSS Inc., Chicago, IL, USA). Significant differences between two groups were analyzed by Student’s t-test, and differences between three or more groups were analyzed by one-way analysis of variance (ANOVA). A value of p < 0.05 was considered to be statistically significant.

RESULTS

miR-522-3p Expression in Human CRC Tissues and Cell Lines

The expression levels of miR-522-3p in 15 paired CRC tissues and matched adjacent nontumor tissues were measured by qRT-PCR. As shown in Figure 1A, the expression levels of miR-522-3p in the CRC tissues were higher than in adjacent nontumor tissues (p < 0.01). The expression levels of miR-522-3p in the normal human colon epithelial cell line (FHC) and five human CRC cell lines (LoVo, HCT-116, HT29, SW480, and SW620) were also measured by qRT-PCR. As shown in Figure 1B, expression levels of miR-522-3p in CRC cell lines were much higher than in FHC cells (p < 0.05, p < 0.01, or p < 0.001). These data indicated that miR-522-3p might be of importance in CRC. Because the HCT-116 and HT29 cell lines possessed remarkably highly expressed miR-522-3p levels, these two cell lines were selected for use in the following investigations.
Figure 1

miR-522-3p was highly expressed in human colorectal cancer (CRC) tissues and cell lines. (A) Expression of miR-522-3p in 15 paired CRC tissues and matched adjacent nontumor tissues was measured by quantitative real-time polymerase chain reaction (qRT-PCR). (B) Expression of miR-522-3p in normal human colon epithelial cell line (FHC) and five human CRC cell lines (LoVo, HCT-116, HT29, SW480, and SW620) was measured by qRT-PCR. *p < 0.05, **p < 0.01, ***p < 0.001.

miR-522-3p was highly expressed in human colorectal cancer (CRC) tissues and cell lines. (A) Expression of miR-522-3p in 15 paired CRC tissues and matched adjacent nontumor tissues was measured by quantitative real-time polymerase chain reaction (qRT-PCR). (B) Expression of miR-522-3p in normal human colon epithelial cell line (FHC) and five human CRC cell lines (LoVo, HCT-116, HT29, SW480, and SW620) was measured by qRT-PCR. *p < 0.05, **p < 0.01, ***p < 0.001.

miR-522-3p Expression and Human CRC Cell Growth

To explore the functional impacts of miR-522-3p in the occurrence and development of CRC, expression of miR-522-3p in HCT-116 and HT29 cells was altered by transfection with miR-522-3p mimic/inhibitor. Transfection efficiency was verified by qRT-PCR, and results are shown in Figure 2A. miR-522-3p was significantly overexpressed in cells transfected with miR-522-3p mimic compared with mimic NC-transfected cells (p < 0.01) and was significantly knocked down by transfection with miR-522-3p inhibitor compared with inhibitor NC-transfected cells (p < 0.05), indicating miR-522-3p in cells was successfully up- and downregulated. MTT assays showed that miR-522-3p overexpression significantly increased cell viability at day 4 and day 5 posttransfection (p < 0.05 or p < 0.001), whereas miR-522-3p suppression reduced cell viability at the same time points (p < 0.05, p < 0.01, or p < 0.001) (Fig. 2B). miR-522-3p overexpression significantly decreased apoptotic cell rate (p < 0.05), and miR-522-3p suppression increased apoptotic cell rate (p < 0.05) (Fig. 2C). As shown in Figure 2D, miR-522-3p overexpression arrested more cells in the S phase (p < 0.01), and miR-522-3p suppression led to the decrease of the S phase ratio (p < 0.05).
Figure 2

miR-522-3p overexpression promoted cell proliferation and repressed cell apoptosis in human CRC cells. miR-522-3p mimic, inhibitor, or negative controls (mimic NC and inhibitor NC) was transfected into two human CRC cell lines (HCT-116 and HT29). (A) The expression changes of miR-522-3p were detected by qRT-PCR (*p < 0.05, **p < 0.01). (B) Cell viability was detected by MTT assay (*p < 0.05, ***p < 0.001, compared with the mimic NC group; #p < 0.05, ##p < 0.01, ###p < 0.001, compared with the inhibitor NC group). (C) The rate of apoptotic cells (*p < 0.05) and (D) cell cycle distribution were measured by flow cytometry detection (**p < 0.01, compared with the mimic NC group; #p < 0.05, compared with the inhibitor NC group).

miR-522-3p overexpression promoted cell proliferation and repressed cell apoptosis in human CRC cells. miR-522-3p mimic, inhibitor, or negative controls (mimic NC and inhibitor NC) was transfected into two human CRC cell lines (HCT-116 and HT29). (A) The expression changes of miR-522-3p were detected by qRT-PCR (*p < 0.05, **p < 0.01). (B) Cell viability was detected by MTT assay (*p < 0.05, ***p < 0.001, compared with the mimic NC group; #p < 0.05, ##p < 0.01, ###p < 0.001, compared with the inhibitor NC group). (C) The rate of apoptotic cells (*p < 0.05) and (D) cell cycle distribution were measured by flow cytometry detection (**p < 0.01, compared with the mimic NC group; #p < 0.05, compared with the inhibitor NC group).

Regulatory Role of miR-522-3p in c-myc, CDK2, and Cyclin E Expressions

We next focused on the regulatory role of miR-522-3p in c-myc, CDK2, and cyclin E expression to explore whether miR-522-3p exerted pro-growth functions via modulation of these proteins. Western blot analytical results showed that c-myc, cyclin E, and CDK2 were all upregulated in miR-522-3p-overexpressing cells (p < 0.01 or p < 0.001), whereas they were downregulated in miR-522-3p-suppressing cells (p < 0.05) (Fig. 3A–D).
Figure 3

miR-522-3p overexpression upregulated the expression of c-myc, cyclin E, and CDK2. miR-522-3p mimic, inhibitor, or negative control (mimic NC and inhibitor NC) was transfected into two human CRC cell lines (HCT-116 and HT29). (A) Protein expression of c-myc, cyclin E, and CDK2 in miR-transfected cells was assessed by Western blot analysis. Quantitative analysis of c-myc (B), cyclin E (C), and CDK2 (D) based on the results from Western blotting. *p < 0.05, **p < 0.01, ***p < 0.001.

miR-522-3p overexpression upregulated the expression of c-myc, cyclin E, and CDK2. miR-522-3p mimic, inhibitor, or negative control (mimic NC and inhibitor NC) was transfected into two human CRC cell lines (HCT-116 and HT29). (A) Protein expression of c-myc, cyclin E, and CDK2 in miR-transfected cells was assessed by Western blot analysis. Quantitative analysis of c-myc (B), cyclin E (C), and CDK2 (D) based on the results from Western blotting. *p < 0.05, **p < 0.01, ***p < 0.001.

Regulatory Role of miR-522-3p in BLM Expression

miR-522-3p mimic, mimic NC, miR-522-3p inhibitor, or inhibitor NC was transfected into HCT-116 and HT29 cells, and Western blot analysis was performed to determine the expression changes of BLM. miR-522-3p overexpression significantly downregulated the expressions of BLM (p < 0.05 or p < 0.01), whereas miR-522-3p suppression significantly upregulated the expressions of BLM (p < 0.01 or p < 0.001) (Fig. 4A and B). We then screened in the TargetScan database and found that miR-522-3p was predicted to target the 3′-UTR seed sequences of BLM (Fig. 4C). Through cotransfection of miR-522-3p mimic with the BLM-wt or BLM-mt, we found that the luciferase activity was significantly reduced in the BLM-wt group (p < 0.05) but not in the mutant group (p > 0.05) (Fig. 4D). These data indicated that BLM was a target gene of miR-522-3p, and BLM was negatively regulated by miR-522-3p.
Figure 4

Bloom syndrome protein (BLM) was a target gene of miR-522-3p. miR-522-3p mimic, inhibitor, or negative control (mimic NC and inhibitor NC) was transfected into two human CRC cell lines (HCT-116 and HT29). Protein expression of BLM in HCT-116 cells (A) and HT29 cells (B) was assessed by Western blot analysis. (C) The predicted binding site in 3′-untranslated region (3′-UTR) of BLM, which can directly bind to miR-522-3p. (D) Luciferase reporter assay was performed to verify whether BLM was a target of miR-522-3p. ns, p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.

Bloom syndrome protein (BLM) was a target gene of miR-522-3p. miR-522-3p mimic, inhibitor, or negative control (mimic NC and inhibitor NC) was transfected into two human CRC cell lines (HCT-116 and HT29). Protein expression of BLM in HCT-116 cells (A) and HT29 cells (B) was assessed by Western blot analysis. (C) The predicted binding site in 3′-untranslated region (3′-UTR) of BLM, which can directly bind to miR-522-3p. (D) Luciferase reporter assay was performed to verify whether BLM was a target of miR-522-3p. ns, p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001.

BLM Expression and Human CRC Cell Growth

To evaluate the role of BLM in miR-522-3p-modulated CRC cells, we then cotransfected miR-522-3p inhibitor and si-BLM into HCT-116 and HT29 cells. Results showed that BLM silencing exhibited the proproliferative and antiapoptotic functions on HCT-116 and HT29 cells, as cell viability was significantly increased (p < 0.05, p < 0.01, or p < 0.001) (Fig. 5A) and apoptotic cell rate was reduced (p < 0.05) (Fig. 5B) by transfection with si-BLM compared with the inhibitor NC + si-NC group. Of note, miR-522-3p suppression did not decrease cell viability and increase apoptosis when BLM was silenced. These data suggested that miR-522-3p affected CRC cell growth via targeting BLM.
Figure 5

miR-522-3p inhibition reduced cell viability and promoted cell apoptosis in human CRC cells via upregulation of BLM. HCT-116 and HT29 cells were transfected with miR-522-3p inhibitor or si-BLM, or cotransfected with miR-522-3p inhibitor plus si-BLM. Cells cotransfected with inhibitor NC and si-NC acted as control. (A) Cell viability was detected by MTT assay. (B) Cell apoptosis was measured by flow cytometry detection. ns, p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001. si-BLM, BLM-specific targeted small interfering RNA; si-NC, nontargeted sequence.

miR-522-3p inhibition reduced cell viability and promoted cell apoptosis in human CRC cells via upregulation of BLM. HCT-116 and HT29 cells were transfected with miR-522-3p inhibitor or si-BLM, or cotransfected with miR-522-3p inhibitor plus si-BLM. Cells cotransfected with inhibitor NC and si-NC acted as control. (A) Cell viability was detected by MTT assay. (B) Cell apoptosis was measured by flow cytometry detection. ns, p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001. si-BLM, BLM-specific targeted small interfering RNA; si-NC, nontargeted sequence.

DISCUSSION

Recent studies have validated the varied and pivotal roles played by a range of miRNAs in different types of cancers15–17. In the current study, we demonstrated that miR-522-3p was highly expressed in CRC tissues and cell lines when compared to adjacent nontumor tissues and normal cell line, respectively. Overexpression of miR-522-3p enhanced cell viability, suppressed apoptosis, and arrested more cells in the S phase of HCT-116 and HT29 cells. miR-522-3p overexpression upregulated the protein expression of c-myc, cyclin E, and CDK2. BLM was a target gene of miR-522-3p, and miR-522-3p suppression-induced decrease in viability of cells and increase in apoptotic cell rate were rescued by the addition of si-BLM. miR-522 encodes 54 tandem miRNAs and is normally expressed in a variety of human tissues and deregulated in several types of tumors, including hepatocellular carcinoma, non-small cell lung cancer, and glioblastoma4–7. Furthermore, miR-522 was reported to exert tumor-promoting activities in these cancers. For instance, Zhang et al. demonstrated that miR-522 contributed to cell proliferation of hepatocellular carcinoma by targeting DKK1 and SFRP218. Another investigation reported that miR-522 downregulation suppressed proliferation and metastasis of non-small cell lung cancer cells by directly targeting DENN/MADD domain-containing 2D19. Herein we found that miR-522-3p was highly expressed in CRC tissues and cell lines, indicating the underlying importance of miR-522-3p overexpression in CRC prognosis. Functional investigations indicated that miR-522-3p overexpression increased cell viability, reduced apoptosis, and increased the ratio of S phase cells, providing the first evidence that miR-522-3p exerted pro-growth activity in CRC cells. c-myc, a proto-oncogene, is a family member of myc. c-myc performs a pivotal function in growth control, differentiation, and apoptosis by modulating the interactions of protein–protein and protein–DNA20. The c-myc gene was subsequently found to be activated in various animal and human tumors21,22. It is a central oncogenic switch for oncogenes and the tumor suppressor23. Cyclin E and CDK2 are two main factors taking part in the regulation of the cell cycle, and dysfunction of cyclin E and CDK2 causes abnormal cell growth and, eventually, tumors24. As the key regulators in cell proliferation, cyclin E and CDK2 are essential for the G1/S transition by shortening the G0/G1 phase. In this study, we found that c-myc, cyclin E, and CDK2 were all upregulated in miR-522-3p-overexpressing cells, whereas they were downregulated in miR-522-3p-suppressing cells. These data indicated that miR-522-3p might exert pro-growth activity in CRC cells via modulating c-myc, cyclin E, and CDK2. Studies have hypothesized that BLM acts as a tumor suppressor by targeting the myc gene, which is a proto-oncogenic and encodes c-myc25,26. Studies have also proposed a spectrum of tumors that are associated with overexpression of c-myc and loss of BLM function25,27. This was further validated in detail in a study by Chandra et al., which suggested that BLM indeed promoted the degradation of c-myc and subsequently caused a delay in c-myc-dependent initiation of tumors8. In this study, we found that BLM was a target gene of miR-522-3p, and miR-522-3p suppression could not suppress cell viability and promote apoptosis when BLM was silenced. Our data indicated that miR-522-3p might exert pro-growth activities in CRC cells via targeting BLM. However, the regulatory impacts of BLM on the expression of c-myc need to be revealed in further investigations. In conclusion, this study demonstrates that miR-522-3p upregulation promotes proliferation and suppresses apoptosis of human CRC cells through negatively regulating the expression of BLM, along with upregulation of c-myc, CDK2, and cyclin E.
  26 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  Expression of miRNA-130a in nonsmall cell lung cancer.

Authors:  Xiao-Chun Wang; Li-Li Tian; Hai-Liang Wu; Xiao-Yan Jiang; Li-Qing Du; Heng Zhang; Yue-Ying Wang; Hong-Ying Wu; De-Guan Li; Yi She; Qing-Fen Liu; Fei-Yue Fan; Ai-Min Meng
Journal:  Am J Med Sci       Date:  2010-11       Impact factor: 2.378

3.  Expression of the gut-enriched Krüppel-like factor (Krüppel-like factor 4) gene in the human colon cancer cell line RKO is dependent on CDX2.

Authors:  D T Dang; C S Mahatan; L H Dang; I A Agboola; V W Yang
Journal:  Oncogene       Date:  2001-08-09       Impact factor: 9.867

4.  MiR-522 contributes to cell proliferation of human glioblastoma cells by suppressing PHLPP1 expression.

Authors:  Shubao Zhang; Hongzhen Zhang; Jianxin Zhu; Xueguang Zhang; Yuguang Liu
Journal:  Biomed Pharmacother       Date:  2015-01-13       Impact factor: 6.529

5.  An Antagomir to MicroRNA-106b-5p Ameliorates Cerebral Ischemia and Reperfusion Injury in Rats Via Inhibiting Apoptosis and Oxidative Stress.

Authors:  Pengfei Li; Meihong Shen; Feng Gao; Jinping Wu; Jiahui Zhang; Fengmeng Teng; Chunbing Zhang
Journal:  Mol Neurobiol       Date:  2016-03-29       Impact factor: 5.590

6.  Modelling Myc inhibition as a cancer therapy.

Authors:  Laura Soucek; Jonathan Whitfield; Carla P Martins; Andrew J Finch; Daniel J Murphy; Nicole M Sodir; Anthony N Karnezis; Lamorna Brown Swigart; Sergio Nasi; Gerard I Evan
Journal:  Nature       Date:  2008-08-17       Impact factor: 49.962

7.  Identification of deregulated miRNAs and their targets in hepatitis B virus-associated hepatocellular carcinoma.

Authors:  Wen Wang; Lan Juan Zhao; Ye-Xiong Tan; Hao Ren; Zhong-Tian Qi
Journal:  World J Gastroenterol       Date:  2012-10-14       Impact factor: 5.742

8.  Downregulation of miR-522 suppresses proliferation and metastasis of non-small cell lung cancer cells by directly targeting DENN/MADD domain containing 2D.

Authors:  Tianze Zhang; Yingying Hu; Jin Ju; Liangyu Hou; Zhange Li; Dan Xiao; Yongchao Li; Jianyu Yao; Chao Wang; Yong Zhang; Linyou Zhang
Journal:  Sci Rep       Date:  2016-01-19       Impact factor: 4.379

9.  Colorectal cancer characterization and therapeutic target prediction based on microRNA expression profile.

Authors:  Peng Xu; Yanliang Zhu; Bo Sun; Zhongdang Xiao
Journal:  Sci Rep       Date:  2016-02-08       Impact factor: 4.379

10.  The landscape of somatic copy-number alteration across human cancers.

Authors:  Rameen Beroukhim; Craig H Mermel; Dale Porter; Guo Wei; Soumya Raychaudhuri; Jerry Donovan; Jordi Barretina; Jesse S Boehm; Jennifer Dobson; Mitsuyoshi Urashima; Kevin T Mc Henry; Reid M Pinchback; Azra H Ligon; Yoon-Jae Cho; Leila Haery; Heidi Greulich; Michael Reich; Wendy Winckler; Michael S Lawrence; Barbara A Weir; Kumiko E Tanaka; Derek Y Chiang; Adam J Bass; Alice Loo; Carter Hoffman; John Prensner; Ted Liefeld; Qing Gao; Derek Yecies; Sabina Signoretti; Elizabeth Maher; Frederic J Kaye; Hidefumi Sasaki; Joel E Tepper; Jonathan A Fletcher; Josep Tabernero; José Baselga; Ming-Sound Tsao; Francesca Demichelis; Mark A Rubin; Pasi A Janne; Mark J Daly; Carmelo Nucera; Ross L Levine; Benjamin L Ebert; Stacey Gabriel; Anil K Rustgi; Cristina R Antonescu; Marc Ladanyi; Anthony Letai; Levi A Garraway; Massimo Loda; David G Beer; Lawrence D True; Aikou Okamoto; Scott L Pomeroy; Samuel Singer; Todd R Golub; Eric S Lander; Gad Getz; William R Sellers; Matthew Meyerson
Journal:  Nature       Date:  2010-02-18       Impact factor: 49.962

View more
  9 in total

1.  CAF secreted miR-522 suppresses ferroptosis and promotes acquired chemo-resistance in gastric cancer.

Authors:  Haiyang Zhang; Ting Deng; Rui Liu; Tao Ning; Haiou Yang; Dongying Liu; Qiumo Zhang; Dan Lin; Shaohua Ge; Ming Bai; Xinyi Wang; Le Zhang; Hongli Li; Yuchong Yang; Zhi Ji; Hailong Wang; Guoguang Ying; Yi Ba
Journal:  Mol Cancer       Date:  2020-02-27       Impact factor: 27.401

2.  The circular RNA hsa_circ_000780 as a potential molecular diagnostic target for gastric cancer.

Authors:  Jian Song; Shuyong Yu; Dunjing Zhong; Weizhong Yang; Zhen Jia; Guihong Yuan; Ping Li; Ronglin Zhang; Yini Li; Guobing Zhong; Zhaowei Chen
Journal:  BMC Med Genomics       Date:  2021-11-27       Impact factor: 3.063

3.  MicroRNA Alterations Induced in Human Skin by Diesel Fumes, Ozone, and UV Radiation.

Authors:  Giuseppe Valacchi; Erika Pambianchi; Simona Coco; Alessandra Pulliero; Alberto Izzotti
Journal:  J Pers Med       Date:  2022-01-28

4.  LncRNA DHRS4-AS1 ameliorates hepatocellular carcinoma by suppressing proliferation and promoting apoptosis via miR-522-3p/SOCS5 axis.

Authors:  Yongping Zhou; Kuan Li; Xuexia Zou; Zhiyuan Hua; Hao Wang; Wuyang Bian; Hong Wang; Fangming Chen; Tu Dai
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

5.  Downregulation of Long Noncoding RNA LINC00261 Attenuates Myocardial Infarction through the miR-522-3p/Trinucleotide Repeat-Containing Gene 6a (TNRC6A) Axis.

Authors:  Chaoxin Jiang; Qing Zhao; Chenlong Wang; Minyan Peng; Guoqing Hao; Zhifeng Liu; Wenjin Fu; Kewei Zhao
Journal:  Cardiovasc Ther       Date:  2021-06-18       Impact factor: 3.023

6.  MiR-522-3p inhibits proliferation and activation by regulating the expression of SLC31A1 in T cells.

Authors:  Hengxiao Lu; Hao Wang; Peidao Sun; Jiang Wang; Shuhai Li; Tongzhen Xu
Journal:  Cytotechnology       Date:  2021-05-07       Impact factor: 2.040

7.  The SNP rs4846048 of MTHFR enhances the cervical cancer risk through association with miR-522: A preliminary report.

Authors:  Xinyue Zhou; Lili Shan; Jing Na; Ya Li; Jun Wang
Journal:  Mol Genet Genomic Med       Date:  2019-11-21       Impact factor: 2.183

8.  Paclitaxel exposure downregulates miR-522 expression and its downregulation induces paclitaxel resistance in ovarian cancer cells.

Authors:  Mayuko Miyamoto; Kenjiro Sawada; Koji Nakamura; Akihiko Yoshimura; Kyoso Ishida; Masaki Kobayashi; Aasa Shimizu; Misa Yamamoto; Michiko Kodama; Kae Hashimoto; Tadashi Kimura
Journal:  Sci Rep       Date:  2020-10-07       Impact factor: 4.379

9.  Targeting of ΔNp63α by miR-522 promotes the migration of breast epithelial cells.

Authors:  Yuanyuan Dong; Juan Long; Xingyong Luo; Gang Xie; Zhi-Xiong Jim Xiao; Ying Tong
Journal:  FEBS Open Bio       Date:  2021-01-10       Impact factor: 2.792

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.