Literature DB >> 29376826

Mitochondria-specific photoactivation to monitor local sphingosine metabolism and function.

Suihan Feng1, Takeshi Harayama1, Sylvie Montessuit2, Fabrice Pa David3, Nicolas Winssinger4, Jean-Claude Martinou2, Howard Riezman1.   

Abstract

Photoactivation ('uncaging') is a powerful approach for releasing bioactive small-molecules in living cells. Current uncaging methods are limited by the random distribution of caged molecules within cells. We have developed a mitochondria-specific photoactivation method, which permitted us to release free sphingosine inside mitochondria and thereafter monitor local sphingosine metabolism by lipidomics. Our results indicate that sphingosine was quickly phosphorylated into sphingosine 1-phosphate (S1P) driven by sphingosine kinases. In time-course studies, the mitochondria-specific uncaged sphingosine demonstrated distinct metabolic patterns compared to globally-released sphingosine, and did not induce calcium spikes. Our data provide direct evidence that sphingolipid metabolism and signaling are highly dependent on the subcellular location and opens up new possibilities to study the effects of lipid localization on signaling and metabolic fate.
© 2018, Feng et al.

Entities:  

Keywords:  biochemistry; cell biology; chemical biology; coumarin; human; metabolism; mitochondria; photoactivation; signaling; sphingolipids

Mesh:

Substances:

Year:  2018        PMID: 29376826      PMCID: PMC5819948          DOI: 10.7554/eLife.34555

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Sphingolipids are one of the major lipid species in cellular membranes of all eukaryotic cells. Apart from maintaining structural properties of membranes, at least four sphingolipid metabolites, sphingosine, ceramide, sphingosine 1-phosphate (S1P) and ceramide 1-phosphate (C1P), are also signaling messengers that regulate fundamental cellular processes (Aguilera-Romero et al., 2014; Hannun and Obeid, 2008; Maceyka and Spiegel, 2014; Atilla-Gokcumen et al., 2014). Due to their essential roles, aberrant sphingolipid levels are linked to a broad range of diseases, including cancers, diabetes, inflammation and neurodegeneration (Maceyka and Spiegel, 2014; Platt, 2014; Guri et al., 2017). Interestingly, sphingolipid messengers could serve distinct functions depending on their subcellular localization, but this is currently difficult to address (Hannun and Obeid, 2008). For example, extracellular S1P activates receptors on the cell surface (Lee et al., 1998; Van Brocklyn et al., 1998; Liu et al., 2000), while S1P generated inside the nucleus has been proposed to regulate histone acetylation through direct interactions with the histone deacetylases (HDAC) (Hait et al., 2009). Furthermore, several protein domains have been suggested to bind to S1P, which might affect the recruitment of many PH domains (Vonkova et al., 2015). Although cellular localization is likely to be an important regulator of the metabolism and functions of sphingolipids, there is no direct evidence to demonstrate this. In the last years some new techniques were introduced to explore lipid metabolism (Wenk, 2005; da Silveira Dos Santos et al., 2014; Papan et al., 2014) and to map lipid-protein interactions (Haberkant et al., 2016; Saliba et al., 2016). While proven to be valuable tools, they do not permit the acute manipulation of lipid amounts in living cells. Recently developed optogenetic (Levskaya et al., 2009) or chemical induced dimerization techniques (Feng et al., 2014) have been applied to rapidly change lipid levels by controlling the localization of lipid-metabolizing enzymes in living cells. Additionally, photoswitchable fatty acids and their derivatives also enables precise optical control of specific signaling lipid-protein interactions (Frank et al., 2015; Frank et al., 2016). However, successful design often requires detailed mechanistic understanding of the protein-lipid interactions. Alternatively, photoactivation ('uncaging’) has become a common way to quickly increase the lipid supply. This method requires the chemical protection of the lipid head group using a photo-labile moiety, which blocks the lipid bioactivities. Once inside cells, a strong light flash can easily remove the protecting group within milli-seconds to seconds, and thereby release the bioactive lipids with high temporal resolution (Höglinger et al., 2014; Klán et al., 2013). Equipped with confocal fluorescence microscopy, the uncaging approach offers a convenient platform to study lipid signaling at the single cell level with minimal perturbation. To date, a number of caged lipids, including sphingosine (Höglinger et al., 2015; Höglinger et al., 2017), S1P (Qiao et al., 1998), fatty acids (Nadler et al., 2015), and phosphatidylinositol phosphates (PIPs) (Subramanian et al., 2010) have been successfully applied in lipid signaling studies. To perform the photoactivation experiments, coumarin and nitrophenyl derivatives are widely used as caging groups to mask the bioactive small molecules (Klán et al., 2013). Nevertheless, the caged molecules are usually distributed in the cell randomly. Selective uncaging is only achieved through sophisticated fluorescence microscopy that is able to produce a highly focused laser beam in a defined area at the subcellular level. This method has disadvantages, though, because it is very difficult to exclusively activate the compartment of interest due to the diffraction limit of light. More importantly, this 'selective uncaging’ strategy is limited to single-cell analysis, and hence is not suitable for biochemical assays that are needed to study metabolism. Only a few exceptions allow uncaging with subcellular specificity, either from the outer leaflet of plasma membrane because the probes cannot enter into cells (Nadler et al., 2015), or in mitochondria to uncouple the membrane potential, but the latter system did not permit to visualize the caged compound once inside the cell making it difficult to determine its precise localization (Chalmers et al., 2012). Here, we report a new mitochondria-targeted photoactivation method, which enabled the rapid release of sphingosine inside the mitochondria in living cells. We combined this method with lipid analysis by mass spectrometry (da Silveira Dos Santos et al., 2014; Han, 2016) to study mitochondrial sphingosine metabolism in intact cells. We observed that after photo-release, free sphingosine was rapidly phosphorylated into S1P, driven by sphingosine kinases. Inhibition of sphingosine kinases largely suppressed the S1P generation. We also applied this technique to monitor the turnover of sphingosine and compared the mito-caged sphingosine (Mito-So) with the globally distributed caged sphingosine (Sph-Cou) (Höglinger et al., 2015; Höglinger et al., 2017). In both cases, sphingosine was quickly lost indicating that these signaling sphingolipids are rapidly metabolized even when targeted to mitochondria. Using stable isotope-labeled caged sphingosine precursors, we investigated the conversion of sphingosine into ceramides and sphingomyelins after uncaging, and found that sphingosine metabolism was highly dependent on its subcellular localization. Mitochondria released sphingosine was used to continuously produce ceramides, whereas globally released sphingosine was more rapidly metabolized through sphingolipid metabolic network. Finally, we compared the two caged probes in calcium mobilization experiments. In contrast to the globally distributed Sph-Cou, the Mito-So failed to trigger calcium mobilization, demonstrating the importance of lipid localization in signal transduction.

Results

Synthesis and characterization of Mito-caged sphingolipids

Coumarin and nitrophenyl derivatives are the most popular caging molecules for biological studies. Although both can be efficiently cleaved from the caged molecules inside living cells, only coumarin-based molecules generate fluorescent signals and thus can be easily visualized under fluorescence microscopy. In order to determine the subcellular localization of caged molecules in cells, we chose to modify the 7-amino coumarin (1) by introducing a carboxylic linker and a methyl group. SeO2-mediated hydroxylation at the benzylic position afforded (3). TFA deprotection of the t-Bu ester allowed facile conjugation to a triphenylphosphonium (TPP) group via an amide bond to afford TPP-Cou-OH (4). Introduced by Murphy and co-workers (Murphy, 1997; Murphy, 2008), the lipophilic TPP cation is the best known mitochondria tag that facilitates accumulation of functional groups into mitochondrial matrix. Using the TPP-labeled coumarin alcohol (TPP-Cou-OH), we synthesized caged sphingosine (Mito-So) and sphinganine (Mito-Sa) following standard protocols (Figure 1).
Figure 1.

Synthesis of Mito-caged sphingosine (Mito-So) and sphinganine (Mito-Sa).

Conditions: (i), tert-butyl bromoacetate, DIPEA, NaI, ACN, reflux, 80%; (ii) MeI, NaH, 0, 88%; (iii) SeO2, xylene, reflux; NaBH4, MeOH, 58%; (iv) TFA/DCM, 0; (3-Aminopropyl)triphenylphosphonium bromide, HBTU, DIPEA, DCM, 25%; (v) Bis-(4-nitrophenyl)carbonate, sphingosine or sphinganine, DIPEA, DMF, 60, 39–50%.

(A, B, C) Normalized absorption (in blue) and emission (in red) spectra of the caged molecules; (D) List of maximal absorption, emission, quantum yield, extinction coefficient of the caged molecules. All measurements were acquired in ethanol solution; quantum yields were calculated using coumarin 1 (=0.73 in ethanol) as a reference compound (Jones et al., 1985).

Synthesis of Mito-caged sphingosine (Mito-So) and sphinganine (Mito-Sa).

Conditions: (i), tert-butyl bromoacetate, DIPEA, NaI, ACN, reflux, 80%; (ii) MeI, NaH, 0, 88%; (iii) SeO2, xylene, reflux; NaBH4, MeOH, 58%; (iv) TFA/DCM, 0; (3-Aminopropyl)triphenylphosphonium bromide, HBTU, DIPEA, DCM, 25%; (v) Bis-(4-nitrophenyl)carbonate, sphingosine or sphinganine, DIPEA, DMF, 60, 39–50%.

Photophysical properties of mitochondria-specific caged molecules.

(A, B, C) Normalized absorption (in blue) and emission (in red) spectra of the caged molecules; (D) List of maximal absorption, emission, quantum yield, extinction coefficient of the caged molecules. All measurements were acquired in ethanol solution; quantum yields were calculated using coumarin 1 (=0.73 in ethanol) as a reference compound (Jones et al., 1985). To evaluate the photo-cleavage efficiency of the mitochondria-targeted caged lipids, we performed uncaging experiments in aqueous solution using a powerful UV lamp. Previously described diethylaminocoumarin caged sphingosine (Sph-Cou) was used as a reference compound (Höglinger et al., 2015). We analyzed the caging probes by LC-MS at different time points (Figure 2B). Most of the sphingosine was cleaved from the Mito-So after one minute, judging from the coumarin absorbance (Figure 2B). Compared to Sph-Cou, both Mito-So and Mito-Sa were completely cleaved after two minutes (Figure 2C), indicating the TPP-Cou-OH is an effective photolabile molecule. On the other hand, our measurement also indicated that the caged probes are fluorescent dyes that emit in the blue region (Figure 1—figure supplement 1). Next, we treated Hela cells with Mito-So for 15 min in the presence of MitoTracker. 5 μM of Mito-So was used to obtain sufficient signals since it is a relatively weak fluorophore. The pattern of Mito-So fluorescence completely overlaps with MitoTracker (Figure 2D,E, Figure 2—figure supplement 1), demonstrating Mito-So and Mito-Sa are predominantly targeted to mitochondria. Like other TPP-containing mitochondria targeting molecules (Murphy, 2008), this accumulation relies on the integrity of mitochondrial membrane potential. When the potential is disrupted by CCCP, the mitochondria staining of Mito-So was not seen (Figure 2F) and the probe was randomly distributed throughout the cell.
Figure 2.

Uncaging efficiency and localization of mitochondria-targeted caged sphingosine.

(A) Illustration of mitochondria-targeted photoactivation of sphingosine. (B) LC-MS spectral of Mito-So absorbance after exposing Mito-So (100 μM) solution (10% DMSO in water) under UV light for indicated time. (C) Uncaging efficiency of Mito-So, Mito-Sa, and Sph-Cou. All probes were treated using procedures described in (B) and quantified by the corresponding absorbance. (D) Representative fluorescence images of Hela cells stained with Mito-So (5 μM) and MitoTracker (50 nM). (E) Intensity profiles of the white dotted line (D) in Mito-So and MitoTracker channel, respectively. (F) Representative fluorescence images of Mito-So staining in the presence of CCCP (10 μM). Scale bar: 10.

Representative fluorescence images of live Hela cells stained with Mito-So (5) and MitoTracker (50) following procedures described in the materials and methods. Scale bar: 10.

Figure 1—figure supplement 1.

Photophysical properties of mitochondria-specific caged molecules.

(A, B, C) Normalized absorption (in blue) and emission (in red) spectra of the caged molecules; (D) List of maximal absorption, emission, quantum yield, extinction coefficient of the caged molecules. All measurements were acquired in ethanol solution; quantum yields were calculated using coumarin 1 (=0.73 in ethanol) as a reference compound (Jones et al., 1985).

Figure 2—figure supplement 1.

Fluorescence images Mito-Sa staining in living cells.

Representative fluorescence images of live Hela cells stained with Mito-So (5) and MitoTracker (50) following procedures described in the materials and methods. Scale bar: 10.

Uncaging efficiency and localization of mitochondria-targeted caged sphingosine.

(A) Illustration of mitochondria-targeted photoactivation of sphingosine. (B) LC-MS spectral of Mito-So absorbance after exposing Mito-So (100 μM) solution (10% DMSO in water) under UV light for indicated time. (C) Uncaging efficiency of Mito-So, Mito-Sa, and Sph-Cou. All probes were treated using procedures described in (B) and quantified by the corresponding absorbance. (D) Representative fluorescence images of Hela cells stained with Mito-So (5 μM) and MitoTracker (50 nM). (E) Intensity profiles of the white dotted line (D) in Mito-So and MitoTracker channel, respectively. (F) Representative fluorescence images of Mito-So staining in the presence of CCCP (10 μM). Scale bar: 10.

Fluorescence images Mito-Sa staining in living cells.

Representative fluorescence images of live Hela cells stained with Mito-So (5) and MitoTracker (50) following procedures described in the materials and methods. Scale bar: 10.

Uncaged sphingosine and sphinganine are rapidly phosphorylated

In mammalian cells, sphingosine can be phosphorylated into pro-proliferative S1P, or converted into pro-apoptotic ceramide. To explore the metabolism of mitochondrial sphingosine, we performed lipidomics on Hela cells incubated with Mito-So and exposed to UV light (350–450 nm) for 2 min, which should be long enough to uncage most of the Mito-So (Figure 2B). Immediately after uncaging on ice, cells were collected for lipid extraction. The results show that both sphingosine and S1P levels were dramatically elevated compared to the controls (Figure 3A,B). Similarly, sphinganine and sphinganine 1-phosphate (Sa-1P) were also increased after uncaging of Mito-Sa (Figure 3C,D). Interestingly, the sphinganine level after Mito-Sa uncaging is higher compared to the sphingosine level after uncaging Mito-So; the opposite effects were observed in the phosphorylated form. Since we treated the cells with equal amount of the probes, the results might reflect the fact that sphingosine is better recognized as a substrate for phosphorylation and/or that that Mito-Sa is more efficiently accumulated inside the cells.
Figure 3.

Sphingolipid analysis of mito-caged probes in Hela cells.

Fully confluent cells in 60 mm culture dishes were incubated with the caged probes (2 μM) for 15 min, washed, irradiated under 350–450 nm UV light for 2 min on ice. Cells were collected immediately after UV irradiation. Lipids were extracted and measured by LC-MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM.

Sphinganine 1-phosphate (Sa-1P) levels were not plotted due to the low signals that cannot be separated from background. (A, B, C, F) Values were normalized with respect to the amount of C17 internal standards and cell numbers. (D, E) Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. (F) Total ceramides and sphingosine levels in DMSO controls; of note, the two lipid classes were extracted and detected using different protocols. Nevertheless, the data here provides an estimation and direct comparison of endogenous ceramides and sphingosine. Data represents the average of three independent experiments. Error bars represent SEM. *p<0.05, n.s., not significant, student's t-test.

Cells in 60 mm culture dishes were irradiated under 350–450 nm UV light on ice for indicated time period. Cells were collected immediately after UV irradiation. Extracted lipids were derivatized by AQC, and measured by LC-MS/MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM.

Sphingolipid analysis of mito-caged probes in Hela cells.

Fully confluent cells in 60 mm culture dishes were incubated with the caged probes (2 μM) for 15 min, washed, irradiated under 350–450 nm UV light for 2 min on ice. Cells were collected immediately after UV irradiation. Lipids were extracted and measured by LC-MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM.

Lipid analysis of mito-caged probes in Hela cells.

Sphinganine 1-phosphate (Sa-1P) levels were not plotted due to the low signals that cannot be separated from background. (A, B, C, F) Values were normalized with respect to the amount of C17 internal standards and cell numbers. (D, E) Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. (F) Total ceramides and sphingosine levels in DMSO controls; of note, the two lipid classes were extracted and detected using different protocols. Nevertheless, the data here provides an estimation and direct comparison of endogenous ceramides and sphingosine. Data represents the average of three independent experiments. Error bars represent SEM. *p<0.05, n.s., not significant, student's t-test.

The effects of UV irradiation on sphingolipid levels.

Cells in 60 mm culture dishes were irradiated under 350–450 nm UV light on ice for indicated time period. Cells were collected immediately after UV irradiation. Extracted lipids were derivatized by AQC, and measured by LC-MS/MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. As a control, we examined the stability of Mito-So and Mito-Sa without photoactivation in the intracellular environments, and found no significant effects on sphingoid bases, showing that the Mito-caged lipids were sufficiently stable and were not cleaved by enzymatic activities such as esterases during the experiments. In addition, although sphingosine and sphinganine are structurally very similar, the sphinganine level remained stable after Mito-So uncaging (Figure 3—figure supplement 1A), and vice versa (Figure 3—figure supplement 1B,C). As a further control, we assessed the potential effects of UV light on the sphingolipid levels, by exposing the cells to continuous UV illumination without any caged probe and measuring the sphingosine and S1P levels. Although both lipids were slightly reduced after UV exposure (Figure 3—figure supplement 2), the reduction is rather minimal and is in the opposite direction compared to the effects of uncaging, showing that the effect of UV illumination is insignificant under these conditions. Likewise, the major lipid species and ceramides were not affected after Mito-So and Mito-Sa uncaging (Figure 3—figure supplement 1D,E). Taken together, our results demonstrate that these photochemical probes, upon illumination, effectively released sphingoid bases with high spatiotemporal resolution. As sphingosine is the major sphingoid base in mammalian cells, we focused on Mito-So in the following studies.
Figure 3—figure supplement 1.

Lipid analysis of mito-caged probes in Hela cells.

Sphinganine 1-phosphate (Sa-1P) levels were not plotted due to the low signals that cannot be separated from background. (A, B, C, F) Values were normalized with respect to the amount of C17 internal standards and cell numbers. (D, E) Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. (F) Total ceramides and sphingosine levels in DMSO controls; of note, the two lipid classes were extracted and detected using different protocols. Nevertheless, the data here provides an estimation and direct comparison of endogenous ceramides and sphingosine. Data represents the average of three independent experiments. Error bars represent SEM. *p<0.05, n.s., not significant, student's t-test.

Figure 3—figure supplement 2.

The effects of UV irradiation on sphingolipid levels.

Cells in 60 mm culture dishes were irradiated under 350–450 nm UV light on ice for indicated time period. Cells were collected immediately after UV irradiation. Extracted lipids were derivatized by AQC, and measured by LC-MS/MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM.

Next, we sought to confirm that the elevated S1P after photo-releasing sphingosine required enzymatic phosphorylation and occurred after uncaging. Since sphingosine and S1P are interconvertible molecules, we assumed that the increased amount of S1P was due to phosphorylation of sphingosine by sphingosine kinases. There are two isoforms of sphingosine kinases in mammalian cells, sphingosine kinase 1 (SphK1) and sphingosine kinase 2 (SphK2), both of which are capable of phosphorylating sphingosine into S1P (Maceyka et al., 2005). To investigate the role of SphKs, we employed the CRISPR/Cas9-based genome editing strategy to generate a control and the double kinase knock-out cell line based on HeLa MZ cells(Figure 4—figure supplement 1) (Ran et al., 2013; Liao et al., 2015; Harayama and Riezman, 2017). After showing that removing sphingosine kinases did not disrupt mitochondria morphology or membrane potential (Figure 4—figure supplement 2), we carried out uncaging experiments using Mito-So in the cell lines and measured their sphingolipid levels. Consistent with previous results (Figure 3), sphingosine levels were dramatically increased after uncaging in the cells (Figure 4A). As expected, SphK double knock-out (dKO) cells failed to raise the S1P level after uncaging, in contrast to the control cells in which significantly elevated S1P was detected (Figure 4B). The level of S1P in the control cells was not as high as in Figure 3, most likely due to the intrinsic differences between the cell lines used initially and the cell line used for generating knockout cells, even though at the beginning they were both selected from HeLa cells. Nevertheless, the Hela MZ is the most appropriate control for the mutant lines we produced.
Figure 4—figure supplement 1.

Analysis of mutation rates in knockout cells.

Each target locus was analyzed by PCR direct sequencing. High rates of aberrant sequences are observed around the estimated cutting site, at 3 bp from the NGG protospacer adjacent motifs (PAMs), only in the intended mutant cells. Guide RNA target sequences are underlined. The indicated values are the percentage of signals equivalent to control samples that were calculated by TIDE (tracking of indels by decomposition) analysis.

Figure 4—figure supplement 2.

Fluorescence images of Mito-So in SphK KO cells.

Representative fluorescence images of sphingosine kinase knockout cells stained with Mito-So (5 μM) and MitoTracker (50 nM) following procedures described in the materials and methods. Scale bar: 10 μm.

Figure 4.

Sphingolipid analysis after Mito-So uncaging in sphingosine kinase double knockout Hela MZ cells (A, B) or inhibitor treated Hela cells (C, D).

Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. **p<0.01, ***p<0.001, ****p<0.0001, n.s., not significant, student's t-test.

Each target locus was analyzed by PCR direct sequencing. High rates of aberrant sequences are observed around the estimated cutting site, at 3 bp from the NGG protospacer adjacent motifs (PAMs), only in the intended mutant cells. Guide RNA target sequences are underlined. The indicated values are the percentage of signals equivalent to control samples that were calculated by TIDE (tracking of indels by decomposition) analysis.

Representative fluorescence images of sphingosine kinase knockout cells stained with Mito-So (5 μM) and MitoTracker (50 nM) following procedures described in the materials and methods. Scale bar: 10 μm.

Cells were incubated with DMSO or caged probes (2 μM) for 15 min. From left to right, cells were collected only for lipid extraction (control; Mito-So, w/o UV); or cells were collected for extraction, dried, re-suspended in 200 water and irradiated for 10 min on ice (Mito-So, lipid extract,+UV); or cells were irradiated for 2 min on ice before lipid extraction (Mito-So, live-cell +UV). Extracted lipids were derivatized by AQC, and measured by LC-MS/MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. ****p<0.0001, n.s., not significant, student's t-test.

Sphingolipid analysis after Mito-So uncaging in sphingosine kinase double knockout Hela MZ cells (A, B) or inhibitor treated Hela cells (C, D).

Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. **p<0.01, ***p<0.001, ****p<0.0001, n.s., not significant, student's t-test.

Analysis of mutation rates in knockout cells.

Each target locus was analyzed by PCR direct sequencing. High rates of aberrant sequences are observed around the estimated cutting site, at 3 bp from the NGG protospacer adjacent motifs (PAMs), only in the intended mutant cells. Guide RNA target sequences are underlined. The indicated values are the percentage of signals equivalent to control samples that were calculated by TIDE (tracking of indels by decomposition) analysis.

Fluorescence images of Mito-So in SphK KO cells.

Representative fluorescence images of sphingosine kinase knockout cells stained with Mito-So (5 μM) and MitoTracker (50 nM) following procedures described in the materials and methods. Scale bar: 10 μm.

Mito-So was not phosphorylated in Hela cells in its caged form.

Cells were incubated with DMSO or caged probes (2 μM) for 15 min. From left to right, cells were collected only for lipid extraction (control; Mito-So, w/o UV); or cells were collected for extraction, dried, re-suspended in 200 water and irradiated for 10 min on ice (Mito-So, lipid extract,+UV); or cells were irradiated for 2 min on ice before lipid extraction (Mito-So, live-cell +UV). Extracted lipids were derivatized by AQC, and measured by LC-MS/MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. ****p<0.0001, n.s., not significant, student's t-test. To provide additional evidence supporting the role of SphKs in the S1P production, we performed uncaging experiments using HeLa cells in the presence of the sphingosine kinase inhibitor SKI-II, which inhibits both SphK1 and SphK2 (French et al., 2003). Consistent with the results in the knockout cells, SKI-II treated cells generated less S1P, and increased the level of sphingosine (Figure 4C,D). The SKI-II did not fully block S1P synthesis, which might be due to the fact that the SKI-II and sphingosine are competitive substrates for the kinases (Lim et al., 2012; French et al., 2003), and/or the access of SKI-II to the mitochondria might be limited. Taken together, our results clearly show that the rapid S1P accumulation after uncaging was catalyzed by sphingosine kinases. As we detected a significant amount of S1P rapidly after uncaging, it is essential to know whether the S1P accumulation was driven by very fast enzymatic reactions, or if phosphorylation occurred on the caged sphingosine molecules (Mito-So) prior to UV illumination. Therefore, we extracted lipids from cells that were incubated with Mito-So, uncaged them after extraction and measured sphingosine and S1P levels. There was no significant increase in S1P following this protocol, while, as expected, the amount of sphingosine was greatly increased (Figure 4—figure supplement 3). These results show that sphingosine kinases were not able to use the caged lipids as substrates in vivo even though the hydroxyl group was available, which further supports our conclusion that S1P accumulation is due to sphingosine kinase activity on the uncaged sphingoid bases.
Figure 4—figure supplement 3.

Mito-So was not phosphorylated in Hela cells in its caged form.

Cells were incubated with DMSO or caged probes (2 μM) for 15 min. From left to right, cells were collected only for lipid extraction (control; Mito-So, w/o UV); or cells were collected for extraction, dried, re-suspended in 200 water and irradiated for 10 min on ice (Mito-So, lipid extract,+UV); or cells were irradiated for 2 min on ice before lipid extraction (Mito-So, live-cell +UV). Extracted lipids were derivatized by AQC, and measured by LC-MS/MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. ****p<0.0001, n.s., not significant, student's t-test.

Although the sphingoid bases were initially photo-released in mitochondria, we cannot formally rule out that free bases were rapidly transported out of the mitochondria and phosphorylated in the cytoplasm. To investigate this issue, we isolated mitochondria from mouse liver and performed uncaging experiments using Mito-So (Figure 5). Consistent with live-cell experiments, after UV irradiation, we detected an elevated sphingosine level (Figure 5A). Importantly, we also observed a significant increase in S1P, which was suppressed by the addition of the SKI-II inhibitor (Figure 5B). Compared with Figure 3B, the phosphorylation of sphingosine into S1P was less efficient in purified mitochondria, which might have been due to the different experimental settings and the intrinsic activity of purified mitochondria compared to mitochondria in vivo. For instance, it is possible that the SPHKs are more efficient in their native environments than in isolated mitochondria. In addition, if some of the S1P generated inside mitochondria was exported during the experiments it would have been lost during our isolation and extraction procedure (see following). To make sure the newly generated S1P was not caused by the contamination of mitochondria during purification and therefore produced outside of the mitochondria, we added a large amount of S1P (10 pmol, approx. 10 times more than produced in vitro) in a mock experiment without Mito-So to the purified mitochondria, and then proceeded with pelleting and lipid extraction, but did not detect any significant change of either sphingosine or S1P (Figure 5C,D). We therefore conclude that the S1P found in our assay was indeed inside mitochondria as extra-mitochondrial S1P was not detected in our assay, probably due to its relatively high solubility in aqueous buffers.
Figure 5.

Sphingolipid analysis after Mito-So uncaging in purified mitochondria from mouse liver.

(A, B) Mitochondria were incubated with Mito-So (10 μM) for 10 min, ±SKI II (50 μM), irradiated under UV light for 2 min on ice, incubated for 15 min at 37°C prior to pelleting by centrifugation and lipid extraction. (C, D) C18 sphingosine 1-phosphate (10 pmol, approx. 10 times of the control) was added to the mitochondria, following the same experimental and extraction procedures. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. **p<0.01, ***p<0.001, ****p<0.0001, n.s., not significant, student's t-test.

Sphingolipid analysis after Mito-So uncaging in purified mitochondria from mouse liver.

(A, B) Mitochondria were incubated with Mito-So (10 μM) for 10 min, ±SKI II (50 μM), irradiated under UV light for 2 min on ice, incubated for 15 min at 37°C prior to pelleting by centrifugation and lipid extraction. (C, D) C18 sphingosine 1-phosphate (10 pmol, approx. 10 times of the control) was added to the mitochondria, following the same experimental and extraction procedures. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. **p<0.01, ***p<0.001, ****p<0.0001, n.s., not significant, student's t-test. Collectively, our data demonstrate that, upon illumination, free sphingosine was quickly released from Mito-So in the mitochondria and was partially and rapidly converted into S1P by SphKs. The rapid phosphorylation, together with our results using purified mitochondria, provide convincing evidence that at least part of the released sphingosine was phosphorylated inside mitochondria. This is consistent with reports finding that sphingosine kinases are partially localized to mitochondria (Lim et al., 2012; Strub et al., 2011).

Metabolism of locally uncaged sphingosine

Sphingolipids are key components of cellular membranes as well as signaling molecules involved in essential physiological and pathological processes (Maceyka and Spiegel, 2014; Aguilera-Romero et al., 2014; Platt, 2014). Their accumulation at specific intracellular locations could possibly be important for their physiological effects. Indeed, it has been proposed that sphingolipid signaling molecules could exhibit different cellular functions depending on their subcellular localization (Hannun and Obeid, 2008). Therefore, understanding their local metabolism is crucial to reveal the complexities of sphingolipid homeostasis and signaling. To address the effect of subcellular localization on metabolism, we applied the photochemical probe to release sphingosine in mitochondria, and thereafter monitored the decay of sphingosine over time. We also performed parallel experiments using a recent reported caged probe (Sph-Cou, Figure 6A [Höglinger et al., 2015]) that releases sphingosine without subcellular selectivity. During the experiments, after 2 min uncaging on ice, the cells were incubated at 37°C and then were collected for lipid extraction at different time points (Figure 6B). Not surprisingly, in both cases, the released sphingosine was quickly metabolized without affecting the amounts of other major lipid species (Figure 6—figure supplement 1). By simply fitting the time-course data with one-phase decay functions, we were able to estimate the half-lives of sphingosine. Notably, the decay of sphingosine (t1/2 = 2.63 min, Figure 6C) generated from Mito-So is much faster than the one from Sph-Cou (t1/2 = 4.21 min, Figure 6E). Also, unlike the Mito-So, sphingosine released from Sph-Cou did not drop to the basal level even after 20 min, suggesting that part of the globally released sphingosine was stored inside cells, which prevented further metabolism during the time course.
Figure 6.

Real-time metabolism of mito-caged sphingosine and globally-caged sphingosine in living cells.

(A) Chemical structure of Sph-Cou. (B) Illustration of uncaging followed by real-time detection. Cells were first treated with caged probes for 15 min, washed, irradiated by UV light for 2 min on ice, incubated at 37°C, and then collected for lipid extraction at different time points. (C, D , E) Changes of sphingosine levels over time after uncaging. The decay curves were generated by fitting into the one phase decay functions. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represent the average of three independent experiments. Error bars represent SEM.

No significant differences due to the different conditions were found. Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. Data represents the average of three independent experiments. Error bars represent SEM.

Figure 6—figure supplement 1.

Total lipid analysis of mito-caged probes in Hela cells and SphK dKO cells.

No significant differences due to the different conditions were found. Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. Data represents the average of three independent experiments. Error bars represent SEM.

Real-time metabolism of mito-caged sphingosine and globally-caged sphingosine in living cells.

(A) Chemical structure of Sph-Cou. (B) Illustration of uncaging followed by real-time detection. Cells were first treated with caged probes for 15 min, washed, irradiated by UV light for 2 min on ice, incubated at 37°C, and then collected for lipid extraction at different time points. (C, D , E) Changes of sphingosine levels over time after uncaging. The decay curves were generated by fitting into the one phase decay functions. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represent the average of three independent experiments. Error bars represent SEM.

Total lipid analysis of mito-caged probes in Hela cells and SphK dKO cells.

No significant differences due to the different conditions were found. Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. Data represents the average of three independent experiments. Error bars represent SEM. According to the sphingolipid metabolic network, sphingosine can either converted into ceramide by ceramide synthases, or be phosphorylated into S1P, which can be further degraded by sphingosine-1-phosphate lyase (SGPL), hydrolyzed to phosphate and sphingosine by lipid phosphatases, or secreted extracellularly (Aguilera-Romero et al., 2014). To explore the rate of conversion to ceramide, we uncaged Mito-So in SphK dKO cells, where the latter pathways are blocked due to a lack of formation of S1P and quantified the sphingosine level over time. Even though major lipid species were not affected (Figure 6—figure supplement 1), sphingosine levels still declined over time, but the half-life was significantly longer than in wild type cells (t1/2 = 4.2 min, Figure 6D). Since S1P formation and sphingoid base turnover were blocked, the most logical explanation is that sphingosine turnover was the result of its conversion into ceramide by ceramide synthases, but this did not affect the total ceramide pool since steady state levels of ceramide in HeLa cells are much higher than sphingosine or S1P levels. In order to further investigate the metabolic fate of sphingosine into more abundant lipid species, it is important to distinguish the newly formed ceramide from the endogenous ones. For this purpose, we synthesized the d7-Mito-So and d7-Sph-Cou using heavy isotope labeled d7-sphingosine as a precursor. Following the same time frame and experimental settings, we measured the d7-sphingolipids over time after uncaging in live Hela cells (Figure 7). To better understand the sphingolipid metabolism under various subcellular contexts, we performed experiments using direct addition of the d7-sphingosine to cells, and compared this with the mito-released and globally-released sphingosine probes. Among the downstream sphingolipids, we focused on the formation of isotope-labeled C16 and C24 ceramides, the most abundant ceramides in HeLa cells, which also showed the most pronounced increase with negligible background signals in our study. As shown in Figure 7 (left), we detected both d7-labeled ceramides immediately after uncaging of d7-Mito-So, demonstrating a rapid conversion to ceramide. The amount of newly formed ceramides steadily increased even after 20 min. Interestingly, globally localized d7-Sph-Cou generated a distinct metabolic pattern (Figure 7, middle). Fewer ceramides were formed at 0 min and both ceramides reached their maximum after 5 to 10 min and dropped significantly after 20 min, suggesting that the ceramides were quickly consumed to synthesize other sphingolipids. As for directly added d7-sphingosine, we observed continuous accumulation and sharp increase of ceramides over time, indicating that sphingosine entered from outside was efficiently metabolized by cells. As the most abundant sphingolipids on the plasma membrane, sphingomyelins are produced by sphingomyelin synthases using ceramides as precursors in the biosynthetic pathway. We also analyzed the signals of d7 C16 sphingomyelin and observed that, while the signals were increased over time in all cases, the signals generated after global release of d7 Sph-Cou uncaging was close to reaching a plateau, unlike the externally added and mitochondrial released d7 Sph that were still in an early phase. The lower sphingomyelin signals, compared to ceramides, suggests that only part of the ceramide population was readily converted to sphingomyelin.
Figure 7.

Real-time detection of d7-sphingolipids in living Hela cells after uncaging of d7-Mito-So, d7-Sph-Cou or direct addition of d7-sphingosine.

Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. Data represent the average of three independent experiments. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, n.s., not significant, students' t-test.

Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. Data represent the average of three independent experiments. Error bars represent SEM.

Real-time detection of d7-sphingolipids in living Hela cells after uncaging of d7-Mito-So, d7-Sph-Cou or direct addition of d7-sphingosine.

Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. Data represent the average of three independent experiments. Error bars represent SEM. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, n.s., not significant, students' t-test.

Total lipid profiles after releasing sphingosine in different subcellular compartments.

Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. Data represent the average of three independent experiments. Error bars represent SEM. Sphingolipid metabolism is a complex process that involves a number of proteins and enzymes, and we are still in an early stage of our understanding. It has been suggested that sphingolipids serve distinct functions depending on their subcellular localizations, but it is technically difficult to address this issue. Our data provide direct evidence that subcellular localization is important for sphingolipid metabolism. The rapid turnover also suggests that lipid metabolism studies require techniques with high temporal resolution.

Mitochondria-specific activation of sphingosine does not induce calcium mobilization

Recently, Höglinger et al. reported that uncaging sphingosine from Sph-Cou causes an acute release of calcium from acidic stores via the two-pore channel 1 (Höglinger et al., 2015). To investigate whether subcellular localization of sphingosine is relevant for this signaling event, we tested the Sph-Cou and Mito-So probes in live Hela cells using a ratiometric calcium dye (Fluo-4) as readout. As shown here, global uncaging of sphingosine quickly induced calcium release as previously reported, whereas mitochondria specific uncaging failed to trigger any calcium mobilization in the saame time frame ( Figure 8, Figure 8—figure supplement 1). To verify that this is not due to a difference in total cellular amounts of sphingosine, we quantified the sphingosine levels generated from the two probes extracted from cells. Since the calcium curves were obtained from single-cell analysis which does not provide quantitative information of photo-released sphingosine, we incubated the two probes in culture dishes, extracted lipids, performed uncaging in the lipid suspension, and measured sphingosine levels by mass spectrometry (same protocol as in Figure 4—figure supplement 3). The amount of sphingosine found after uncaging was approximately two times higher for Mito-So than for Sph-Cou (Figure 8—figure supplement 2), showing that differences in the amount of probe taken up by the cells is not the explanation for the different physiological consequences. Our data thus provide direct evidence that the intracellular sphingoid base compartmentalization can be a deciding factor in the regulation of intracellular signal transduction.
Figure 8.

Calcium responses after photo-releasing sphingosine from caged precursors.

(A) Mean traces of normalized fluorescence intensity after uncaging of Mito-So, Sph-Cou, or blank. Hela cells were loaded with Fluo-4 AM (5 μM), together with Sph-Cou (5 μM) or Mito-So (5 μM) prior to UV illumination. Cells were irradiated for 4 s by a 405 nm laser at 37°C. Error bars represent SEM. n > 10.

Cells were incubated with DMSO, Sph-Cou or Mito-So (5 μM) for 15 min prior to lipid extraction. Extracted lipids were re-suspended in 200 μL water and illuminated for 10 min on ice. Samples were derivatized by AQC and measured by LC-MS/MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. ***p<0.001, student's t-test.

Figure 8—figure supplement 1.

Histogram distribution of maximal calcium responses compared to the baseline in each cell, with the threshold set at 20% increase (black vertical line).

Figure 8—figure supplement 2.

Comparison of cellular uptake between Sph-Cou and Mito-So.

Cells were incubated with DMSO, Sph-Cou or Mito-So (5 μM) for 15 min prior to lipid extraction. Extracted lipids were re-suspended in 200 μL water and illuminated for 10 min on ice. Samples were derivatized by AQC and measured by LC-MS/MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. ***p<0.001, student's t-test.

Calcium responses after photo-releasing sphingosine from caged precursors.

(A) Mean traces of normalized fluorescence intensity after uncaging of Mito-So, Sph-Cou, or blank. Hela cells were loaded with Fluo-4 AM (5 μM), together with Sph-Cou (5 μM) or Mito-So (5 μM) prior to UV illumination. Cells were irradiated for 4 s by a 405 nm laser at 37°C. Error bars represent SEM. n > 10.

Comparison of cellular uptake between Sph-Cou and Mito-So.

Cells were incubated with DMSO, Sph-Cou or Mito-So (5 μM) for 15 min prior to lipid extraction. Extracted lipids were re-suspended in 200 μL water and illuminated for 10 min on ice. Samples were derivatized by AQC and measured by LC-MS/MS. Values were normalized with respect to the amount of C17 internal standards and cell numbers. Data represents the average of three independent experiments. Error bars represent SEM. ***p<0.001, student's t-test.

Discussion

It is clear that glycerophospholipids and sphingolipids are unequally distributed among the subcellular structures of the cell, however, the transport of lipids is very rapid, with phosphatidylethanolamine being transported from its site of the synthesis to the plasma membrane in less than a couple of minutes (Sleight and Pagano, 1983). This rapid movement raises the question of the influence of localization on metabolism and signaling. To address this, we have developed a highly efficient photo-cleavable probe (TPP-Cou-OH) that was easily installed on the amino group of free sphingoid bases, and which can be potentially applied to mask other functional groups, allowing the caging of a wide variety of lipids and other bioactive molecules. Carrying a hydrophobic and positively charged triphenylphosphonium (TPP) cation, the caged probes accumulated in mitochondria, into which the entry is tightly regulated. As these probes are also fluorescent dyes, their subcellular localization could be conveniently visualized under fluorescence microscopy. With few exceptions (Nadler et al., 2015; Chalmers et al., 2012), most available caged molecules are randomly distributed, and thus spatiotemporal control has to rely on sophisticated microscopy at a single-cell level. In contrast, our caged probes can be used for single-cell microscopic analysis as well as biochemical experiments to follow metabolism. In the recent years, mass-spectrometry (MS)-based lipidomic approaches have emerged as powerful tools that provide comprehensive and quantitative analysis of cellular lipid profiles (da Silveira Dos Santos et al., 2014; Han, 2016). Combining this approach with our caged probes produced a robust system that enabled us to monitor the local sphingosine metabolism in living cells. We observed that, upon uncaging, some liberated sphingosine was rapidly converted into S1P. Suppressing sphingosine kinase activity, either by genetic ablation or chemical inhibitors, largely abolished S1P synthesis, confirming that phosphorylation was driven by sphingosine kinases. Importantly, uncaging sphingosine in purified mitochondria also generated a significant amount of S1P, providing strong evidence that mito-released sphingosine was phosphorylated inside mitochondria, consistent with previous studies that claimed SPHKs are detected in the mitochondria (Strub et al., 2011). It has been known that ceramide is pro-apoptotic, whereas S1P promotes cell growth and proliferation. But the functions of sphingosine, which can be metabolized into ceramide and S1P, are not well understood. Since mitochondria is major a hub of energy supply and has been highly associated with apoptosis, it is interesting to investigate the metabolism of mitochondrial sphingosine, and to compare this with the metabolism globally distributed sphingosine. Using the mitochondria-specific caged probe (Mito-So) and globally caged probe (Sph-Cou), we monitored the sphingosine level over time, from which we derived the half-lives of decay by fitting a one phase function. Our results indicate that mitochondria released sphingosine was quickly lost over time (t1/2 = 2.63 min, Figure 6C), whereas globally released sphingosine was slowly lost and did not come back to the basal level (t1/2 = 4.21 min, Figure 6E). Since ceramides are much more abundant lipids than sphingoid bases in cells ((Simanshu et al., 2013; Shaner et al., 2009; Canals et al., 2010), Figure 3—figure supplement 1), we prepared stable isotope labelled caged sphingosine so that the newly produced ceramides can be distinguished from the endogenous pool of ceramides by mass spectrometry. After releasing sphingosine at different subcellular localizations, we have found that sphingosine can be metabolized through distinct metabolic patterns, depending on where free sphingosine is supplied. Focusing on two most abundant ceramides in mammalian cells, our data show that both C16 and C24 ceramides were continuously generated after Mito-So uncaging. Nevertheless, after Sph-Cou uncaging, both lipids were produced and also quickly consumed after 5 to 10 min. Since ceramide synthases (CerS), which catalyze the conversion of sphingosine into ceramide, are mainly located in endoplasmic reticulum (ER), the lack of substrate accessibility to CerS may prevent immediate ceramide formation from liberated sphingosine in mitochondria. It is likely that the slow sphingosine exit from mitochondria resulted in the continuous increase of ceramides. On the other hand, globally uncaged sphingosine is easily accessible to CerS, which could explain the rapid ceramide production and degradation. We did not detect a preferential synthesis of ceramides with specific acyl chain length dependent upon the localized source of sphingosine. Interestingly, we detected less ceramides from globally released sphingosine. One possibility is that mitochondrial sphingosine is more efficiently, but less rapidly transferred to the ER, (Figure 8—figure supplement 2) the site of ceramide production. It is clearly shown from our data that sphingosine produced in the mitochondria can enter the sphingolipid biosynthetic pathway, demonstrating that there is a pathway to transfer sphingosine from the mitochondrial matrix to the ER. Overall, the data provided here provide direct evidence that sphingosine metabolism is different depending upon its subcellular localization. To provide further evidence that sphingosine localization is important for signaling processes, we investigated the impact of mitochondria-specific uncaging in lipid signaling studies. We demonstrated a role of compartmentalization in restricting sphingosine signaling for calcium release. Again, sphingosine produced in the mitochondria was clearly not equivalent to sphingosine produced elsewhere in the cell. This clearly shows that the mitochondrial sphingosine does not freely and rapidly diffuse in the cells because it would have produced a release of calcium. Why does it not produce a calcium release? Two factors might influence this. One, it could be that the exit from mitochondria is too slow to be seen in our time course. Second, it could be that the mitochondrial sphingosine is transported preferentially to the ER. This would be consistent with the increased efficiency of ceramide synthesis from mitochondrial sphingosine compared to global sphingosine. It is possible that externally added sphingosine is also targeted preferentially to the ER as it behaves similarly to mitochondrial sphingosine. One interesting question for the future is to determine where the sphingosine must be located to induce a calcium release from acidic stores. A similar approach as taken here that localizes caged-sphingosine to different intracellular locations could be used to address this question and determine if the sphingosine must be inside or outside of the lysosome. Furthermore, extending our concept of subcellular release of caged lipids to other compartments and other lipids should allow experimentation to understand the role of localization in lipid metabolism and signaling in general. Lipid messengers play active roles in essential cellular functions and their metabolism is tightly regulated through a complex lipid metabolic network. Although it is believed that sphingolipids could have different functions depending on their subcellular locations, it is difficult to acquire direct evidence because of technical challenges to spatiotemporally control bioactive lipids. Our approach offers a novel technique that permits the elucidation of the relevance of lipid localization in bioactive lipid metabolism and signaling. Combining this technique with mass spectrometry (MS)-based lipidomic approach we were able to monitor real-time metabolism of a key lipid regulator in mitochondria. More importantly, our combined results provide direct evidence that sphingosine has distinct metabolism and signaling patterns depending on subcellular localization. We envision that site-specific photochemical probes will become valuable tools in lipid signaling and metabolism studies.

Materials and methods

Chemicals and reagents

Unless otherwise stated, chemicals and reagents were purchased from commercial sources (Sigma-Aldrich, Acros, Alfa-Aesar) and were used without purification. Sphingosine was purchased from Echelon Bioscience. Sphingosine-d7 was purchased from Avanti Polar Lipids. MitoTracker Orange CMTMRos was a gift from Jean Gruenberg lab (Department of Biochemistry, University of Geneva) originally purchased from Thermo Fisher Scientific. Fluo-4 AM was purchased from Thermo Fisher Scientific. Sph-Cou was synthesized according to previously described protocols (Höglinger et al., 2015). Deuterated solvents were obtained from Cambridge Isotope Laboratories, Inc. The plasmid pX330 was deposited to Addgene (plasmid #42230) by Feng Zhang (Broad Institute).

Cell culture

All cells were cultured at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen) with 4.5 g/L glucose, supplemented with 10% fetal calf serum (FCS, Hyclone) and 1% Pen/Strep (Gibco). Cell numbers were quantified by Countess II Automated Cell Counter (Invitrogen) following manufacturer’s protocol. For fluorescence microscopy experiments, cells were cultured in 35 mm glass bottom MatTek dishes to reach 80% confluency. In the subcellular localization experiments, cells were incubated with 5 μM Mito-So or Mito-Sa, together with 50 MitoTracker Orange in 1 mL imaging buffer (20 mM HEPES, 115 mM NaCl, 1.2 mM MgCl2, 1.2 mM K2HPO4, 1.8 mM CaCl2 and 0.2% glucose, pH 7.40) for 15 min at 37°C before replacing with new imaging buffer. In the calcium mobilization experiments, cells were incubated with blank, 5 μM Mito-So, or Sph-Cou, respectively, in the presence of 5 μM Fluo-4 AM in 1 mL imaging buffer for 15 min at 37 before replacing with new imaging buffer.

Isolation and purification of mitochondria

Mouse livers were dissected, rinsed with ice-cold MB buffer (Mannitol 210 mM, Sucrose 70 mM, HEPES 10 mM, EDTA 1 mM, pH 7.5) and homogenized in 10 ml of MB buffer by twenty passages in a glass homogenizer. The resultant homogenate (liver homogenate) was centrifuged at 1500 g for 5 min at 4°C to remove nuclei and unbroken cells. The supernatant was further centrifuged twice at 6000 g for 10 min to provide a mitochondria-enriched pellet.

Ethics statement

Mice were euthanized by CO2 inhalation. All experimental procedures were performed according to guidelines provided by the Animal Welfare Act and Animal welfare ordinance, the Rectors’ Conference of the Swiss Universities (CRUS) policy and the Swiss Academy of Medical Sciences/Swiss Academy of Sciences’ Ethical Principles and Guidelines for Experiments on Animals, and were approved by the Geneva Cantonal Veterinary Authority (authorization number: 28038/GE86/16).

Uncaging assays

Experiments were performed using a 1000 Watt Arc Lamp Source (#66924, NewPort) equipped with a dichromic mirror (350–450 nm, #66226). For live-cell uncaging, cells were seeded and cultured in 60 mm dishes until full confluency. The dishes were loaded with caged probes in 2 mL imaging buffer for 15 min at 37°C. After replacing with new imaging buffer, cells were placed on ice under the lamp at a distance of 20 cm, and irradiated 120 s at 1000 Watt. Cells were either placed back in a 37°C incubator, and/or immediately processed for lipid extraction. For the uncaging experiments in purified mitochondria, mitochondria in MB buffer was re-suspended in KCl buffer (125 mM KCl, 0.5 mM EGTA, 4 mM MgCl2, 5 mM K2HPO4, 10 mM HEPES, pH 7.4) containing 5 mM ATP. Mito-So was added and the suspension was incubated at 37°C for 10 min, irradiated on ice for 2 min, re-incubated at 37°C for 15 min, centrifuged at 14,000 rpm for 5 min prior to lipid extraction.

Lipid extraction and quantification

Lipids were extracted following previously described protocols with minor modifications (Guan et al., 2009; Loizides-Mangold et al., 2012; da Silveira Dos Santos et al., 2014). Briefly, cells were washed with cold PBS and scraped off in 500 μl cold PBS on ice. The suspension was transferred to a 1.5 ml Eppendorf tube in which it was spin down at 2500 rpm for 5 min at 4. After taking off the PBS, samples were stored at −20°C or directly used for further extraction. For sphingoid base analysis, samples were re-suspended in 150 uL extraction buffer (ethanol, water, diethyl ether, pyridine, and 4.2 N ammonium hydroxide (15:15:5:1:0.018, v/v)). A mixture of internal standards (0.04 nmol of C17 sphingosine, 0.04 nmol of C17 sphinganine, 0.4 nmol of C17 sphingosine-1-phosphate, 0.4 nmol of C17 sphinganine-1-phosphate) was added. The samples were vigorously vortexed using a Cell Disruptor Homogenizer(Disruptor Genie, Scientific Industries) for 10 min at 4°C and incubated on ice for 20 min. Cell debris were pelleted by centrifugation at 14,000 rpm for 2 min at 4°C, and the supernatant was collected. The extraction was repeated once more without ice incubation. The supernatants were combined and dried under vacuum in a CentriVap (Labconco, Kansas City, MO). The samples were re-suspended in a mixture of solvents composed of 70 μl of borate buffer (200 mM boric acid pH 8.8, 10 mM tris(2-carboxyethyl)-phosphine, 10 mM ascorbic acid and 33.7 μM 15N13C-valine), and 10 μl of formic acid solution (0.1% aqueous solution), derivatized by reacting with 20 μl 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC) solution (2.85 mg/ml in acetonitrile) for 15 min at 55°C. After overnight incubation at 24°C, samples were analyzed by LC-MS/MS in an Accela HPLC system (ThermoFisher Scientific, Waltham, USA) coupled to a TSQ Vantage (ThermoFisher Scientific, Waltham, USA). MRM-MS was used to identify and quantify sphingoid bases. The amounts of sphingolipids were normalized with respect to the amount of C17 internal standards and cell numbers. For ceramide and phospholipid analysis, samples were prepared following the MTBE protocol (Matyash et al., 2008). Briefly, cells were re-suspended in 100 μL of water and transferred into a 2 ml Eppendorf tube. 360 μl of MeOH and a mixture of internal standards (0.4 nmol of DLPC, 1 nmol of PE31:1, 1 nmol of PI31:1, 3.3 nmol of PS31:1, 2.500 nmol of C12 sphingomyelin, 0.5 nmol of C17 ceramide and 0.1 nmol of C8 glucosylceramide) was added. Samples were vortexed, following the addition of 1.2 ml of MTBE. The samples were vigorously vortexed at maximum speed for 10 min at 4°C and incubated for 1 hr at room temperature on a shaker. Phase separation was induced by addition of 200 μL MS-grade water and incubation for 10 min. Samples were centrifuged at 1000 g for 10 min. The upper phase was transferred into a 13 mm glass tube and the lower phase was re-extracted with 400 μl of a MTBE/MeOH/H2O mixture (10:3:1.5, v/v). The extraction was repeated one more time. The combined upper phase was separated into three equal aliquots before drying under nitrogen flow. One aliquot was treated by alkaline hydrolysis to enrich for sphingolipids, one was used for glycerophospholipid analysis and the third was kept as a backup. To deacylate glycerophospholipids, the sample was re-suspended in 1 ml freshly prepared monomethylamine reagent (methylamine/H2O/n-butanol/methanol at 5:3:1:4 (v/v)) and incubated at 53 for 1 hr in a water bath before dried by nitrogen flow. The excess salts were removed by extracting samples in 300 μL water-saturated n-butanol solution and 150 μL MS-grade water (Clarke and Dawson, 1981). The organic phase was collected, and the extraction was repeated with 300 μL water-saturated n-butanol. The combined organic phase was dried by nitrogen flow. Identification and quantification of phospholipid and sphingolipid molecular species were performed using multiple reaction monitoring with a TSQ Vantage Triple Stage Quadrupole Mass Spectrometer (Thermo Scientific) equipped with a robotic nanoflow ion source, Nanomate HD (Advion Biosciences). Each individual ion dissociation pathway was optimized with regard to collision energy. Lipid concentrations were calculated with respect to the corresponding internal standards and were presented as percentage of all lipid signals(Guan et al., 2013).

Live-cell imaging

Subcellular localization experiments were performed on a Leica SP8 confocal microscope using a 63 x oil immersion objective. A 405 nm and 532 nm laser were used with appropriate filter settings during image acquisition. Photoactivation experiments were performed using a Nikon A1r microscope with 63 x oil immersion objective at 37 with 5% CO2. A 100 mW 402 nm laser was used for photo-releasing sphingosine, and a 488 nm laser was used for recording the time-lapse images. Specifically, uncaging was performed within a circle in 3.0 μm diameter. Cells were irradiated for 4 s (2.2 μs/pixel) at 100% laser power in the region of interest (mitochondria in the case of Mito-So uncaging). Raw imaging data were analyzed by measuring the mean intensity of laser-illuminated cells.

Image analysis

The fluorescence images were analyzed by Fiji software (Schindelin et al., 2012). The fluorescence staining images were presented in their original form. Time-lapse images were extracted by measuring the mean intensities of photo-stimulated individual cells during the acquisition. The single-cell traces were normalized to baseline of each cell before exporting to GraphPad Prism.

Statistical analysis

Data represent at least the average of three independent experiments. Error bars represent standard error of the mean (SEM) as indicated. Statistical significance was calculated based on two-tailed unpaired student's t-test.

Generation of mutant cells

Mutant cells were generated by the CRISPR/Cas9 system from Streptococcus pyogenes (Ran et al., 2013), using the HPRT co-targeting strategy (Liao et al., 2015) as previously described (Harayama and Riezman, 2017). Target sequences (listed below) were selected based on high specificity and efficacy scores predicted by the CRISPOR algorithm (Haeussler et al., 2016), and the corresponding pairs of oligo DNA were synthesized (Microsynth AG, Balgach, St. Gallen, Switzerland). Plasmids were constructed by assembling annealed oligo DNA pairs and plasmids in single tube reactions using FastDigest Bpi I (Thermo Fisher Scientific) and quick ligase (New England Biolabs, Ipswich, MA, USA) in quick ligase buffer. Three cycles of restriction at 37 and ligation at 25 were repeated (5 min for each step), followed by Bpi I restriction for one hour to remove empty vectors. pX330 plasmids (Ran et al., 2013) were used for assembly, except for HPRT guide RNA, for which pUC-U6-sg plasmid (Harayama and Riezman, 2017) was used. Plasmids were transformed into chemical competent STBL3 bacterial cells (Thermo Fisher Scientific, Waltham, MA, USA), sequence-verified by Sanger sequencing (Fasteris SA, Plan-les-Ouates, Geneva, Switzerland), and purified using GenElute Plasmid Miniprep kit (Sigma-Aldrich, St. Louis, MO, USA) followed by endotoxin removal by isothermal Triton X-114 extraction (Ma et al., 2012). Plasmids (98 ng total of plasmids for target(s) and 2 ng plasmid for HPRT) were reverse transfected into HeLa MZ cells using Lipofectamine 3000 (Thermo Fisher Scientific) in a 96 well plate, cell culture areas were scaled up before reaching over confluency, and selected with 6 μg/mL 6-thioguanine (Sigma-Aldrich) 5 days post-transfection. After one week of selection, the resistance against 6-thioguanine caused by the mutations in the co-targeted HPRT gene led to enrichment for mutations in the target genes (Liao et al., 2015). To evaluate mutation rates, individual loci were analyzed by PCR direct sequencing (using primers listed below) followed by TIDE (tracking indels by deconvolution) analysis (Brinkman et al., 2014). PCR reactions were peformed using ExTaq polymerase (TAKARA Clonthech, Otsu, Shiga, Japan). • Guide RNA sequences for genome editing SPHK1: CTGGTGCTGCTGAACCCGCG SPHK2: TGAGTGGGATGGCATCGTCA HPRT: GTAGCCCTCTGTGTGCTCAA • Primers for genome DNA analysis SPHK1: TATCCCTCACGAGGCCAGAA, TAGAGGAGCACTGACGGGAA SPHK2: AACCACGTGCTTCCCATGAT, GGGGTTGGGGAAAGAGACAG

Chemical synthesis

1H and 13C-NMR spectra were recorded on a Bruker AMX-400 MHz or 500 MHz spectrometer. Chemical shifts are given in ppm () using the NMR solvent as internal references and J values are reported in Hz. Splitting patterns are designated as follows: s, singlet; d, doublet; t, triplet; q, quartet; m, multiplet; b, broad. 13C-NMR spectra were broadband hydrogen decoupled. LC-MS spectra were recorded using a Thermo Electron Corporation HPLC with a Thermo Scientific Finnigan Surveyor MSQ Spectrometer System. High-resolution mass spectra were recorded on a QSTAR Pulsar (QqTOF) mass spectrometer. Flash chromatography purification was carried out using silica gel 40–63 μm (200–400 mesh) from SiliCycle in solvent systems as described. Thin layer chromatography (TLC) was performed on aluminum-backed, pre-coated silica gel plates (Merck TLC silica gel 60 F254). Spots were detected by a UV lamp under 254 nm or 365 nm wavelength. Reverse phase HPLC purification was performed using an Agilent Technologies 1260 infinity HPLC equipped with a ZORBAX 300 SB-C18 column (9.4 × 250 mm). UV-Vis spectra were recorded using a JASCO V-650 spectrophotometer equipped with a stirrer and a temperature. Fluorescence measurements were performed with a FluoroMax-4 spectrofluorometer (Horiba Scientific) equipped with a stirrer and a temperature controller. (3-Aminopropyl)triphenylphosphonium bromide, compound 1 and subsequently methylated product were synthesized according to previously published procedures (Kaur et al., 2015; Hagen et al., 2005), respectively.

7-[(tert-butoxycarbonylmethyl)-methylamino]-4-methylcoumarin (2)

To a suspension of sodium hydride (132 mg, 60% in mineral oil, 3.3 mmol, 1.1 equiv.) in 2 ml dry DMF at 0, a solution of 7-(tert-butoxycarbonylmethyl)−4-methylcoumarin (870 mg, 3.0 mmol) (Hagen et al., 2005) in 8 ml DMF was added via a syringe under inert atmosphere, followed by the addition of methyl iodide (600 μL, 9.7 mmol). The reaction mixture was stirred at 0 for 1.5 hr. The reaction mixture was quenched by 0.1 N HCl solution (40 mL) and extracted with EtOAc (40 mL). The organic phase was washed twice with brine, dried over Na2SO4, and concentrated under reduced pressure. The crude product was purified by flash chromatography (SiO2, EtOAc/cyclohexane = 1/5) to give compound 2 (800 mg, Yield: 88%) as a yellow solid. Rf = 0.40 (EtOAc/cHex = 1/4). 1H NMR (400 MHz, CDCl3) = 7.41 (d, J = 8.9 Hz, 1H), 6.59 (dd, J = 8.9, 2.6 Hz, 1H), 6.51 (d, J = 2.6 Hz, 1H), 6.00 (d, J = 1.1 Hz, 1H), 4.01 (s, 2H), 3.12 (s, 3H), 2.35 (d, J = 1.1 Hz, 3H), 1.44 (s, 9H). 13C NMR (101 MHz, CDCl3) = 169.09, 162.14, 155.71, 152.96, 152.01, 125.59, 110.72, 110.10, 109.04, 98.98, 82.45, 55.10, 39.99, 28.22, 18.62 ppm. HR-ESI-MS (pos.) C17H21NO4, [M + H]+ calculated: 304.1543, [M + H]+ found: 304.1532.

7-[(tert-butoxycarbonylmethyl)-methylamino]−4-(hydroxymethyl)coumarin (3)

To a solution of compound 2 (303 mg, 1.0 mmol) in xylene (15 mL), selenium dioxide (220 mg, 2.0 mmol) was added. After stirring at 145 for 20 hr under nitrogen atmosphere, the reaction mixture was filtered and concentrated in vacuo. The crude product was re-dissolved in 20 mL methanol, followed by addition of sodium borohydride (95 mg, 2.5 mmol). The reaction was stirred at room temperature for 1 hr before quenching with EtOAc (20 mL) and water (20 mL). The organic phase was washed twice with brine, dried over Na2SO4, and concentrated under reduced pressure. The crude product was purified by flash chromatography (SiO2, EtOAc/cyclohexane = 1/2) to give compound 4 (183 mg, Yield: 58%) as a light yellow solid. 1H NMR (400 MHz, CDCl3) = 7.26 (d, J = 9.0 Hz, 1H, overlapped with solvent peak), 6.52 (dd, J = 9.0, 2.6 Hz, 1H), 6.45 (d, J = 2.6 Hz, 1H), 6.29 (s, 1H), 4.75 (s, 2H), 3.99 (s, 2H), 3.09 (s, 3H), 1.43 (s, 9H) ppm. 13C NMR (101 MHz, CDCl3) = 169.19, 162.56, 155.51, 155.13, 151.80, 124.21, 108.96, 107.70, 106.35, 98.67, 82.47, 60.63, 54.83, 39.72, 28.08 ppm. HR-ESI-MS (pos.) C17H21NO5, [M + H]+ calculated: 320.1493, [M + H]+ found: 320.1484.

7- [(carboxymethyl)-methylamino]−4-(hydroxymethyl)coumarin (5)

Compound 3 (65 mg, 0.20 mmol) was slowly added to a mixture of TFA/CH2Cl2/H2O (75/25/1) at 0, and the reaction was stirred at room temperature for 3 hr. Small amount of toluene was added to the crude mixture, and the solvents were evaporated under reduced pressure. The crude mixture was lyophilized to give a yellow solid. The product was direct used for next step without further purification. 1H NMR (400 MHz, Methanol-d5) = 7.46 (d, J = 9.0 Hz, 1H), 6.71 (dd, J = 9.0, 2.6 Hz, 1H), 6.56 (d, J = 2.6 Hz, 1H), 6.27 (t, J = 1.31 Hz, 1H), 4.79 (d, J = 1.5 Hz, 2H), 4.23 (s, 2H), 3.14 (s, 3H). 13C NMR (101 MHz, Methanol-d4) = 173.56, 164.79, 158.59, 156.79, 153.80, 125.64, 110.56, 108.65, 106.01, 99.24, 60.79, 54.30, 39.71 ppm. ESI-MS (pos.) C13H13NO5, [M + H]+ calculated: 264.09, [M + H]+ found: 264.13.

TPP-Cou-OH (4)

To a solution of compound 5 obtained from the last step and (3-Aminopropyl)triphenylphospho-nium bromide (80 mg, 0.20 mmol) in 10 ml of dry DCM, DIPEA (87 μL, 0.50 mmol) and HBTU (80 mg, 0.21 mmol) were added. The reaction mixture was stirred at room temperature for overnight under nitrogen atmosphere. The solvents were evaporated under reduced pressure. The crude product was purified by flash chromatography (SiO2, 10% DCM in MeOH) to give 4 (33 mg, Yield: 25% over two steps) as a yellow solid. 1H NMR (500 MHz, CDCl3) = 8.83 (s, 1H), 7.78 (m, 3H), 7.58–7.67 (m, 12H), 7.00 (d, 1H, J = 9.0 Hz), 6.60 (d, 1H, J = 9.0 Hz), 6.39 (d, 1H, J = 2.0 Hz), 6.07 (s, 1H), 4.50 (s, 2H), 4.09 (s, 2H), 3.50 (m, 2H), 3.32 (m, 2H), 3.13 (s, 3H), 1.89 (m, 2H) ppm. 13C NMR (126 MHz, CDCl3, DEPT) = 135,25, 135.23, 133.23, 133.15, 130.56, 130.47, 123.84, 109.22, 105.72, 98.32, 60.00, 56.00, 39.95, 39.00, 38.86, 22.35, 22.33, 20.40, 19.98 ppm. HR-ESI-MS (pos.) C34H34N2O4P, [M]+ calculated: 565.2251, [M]+ found: 565.2255.

Mito-So

To a solution of TPP-Cou-OH (4) (26 mg, 0.04 nmol) in 4 mL of dry DMF, Bis-(4-nitrophenyl)carbonate (12 mg, 0.04 mmol) and DIPEA (20 μL, 0.11 mmol) was added. The reaction mixture was stirred at room temperature in dark. After 3 hr, sphingosine (12 mg, 0.04 mmol) in 1 mL of DMF was added and the reaction was stirred at 60 for 3 hr in dark. The crude product was directly purified by flash chromatography (SiO2, MeOH/DCM = 1/10) to afford Mito-So (15 mg, Yield: 39%) as a yellow solid. The product was further purified by reverse phase HPLC. Semi-preparative HPLC runs were carried out with a gradient from 5% to 95% acetonitrile/water system (0.1% TFA) for 20 min and a flow of 1 mL/min, monitored by a PDA detector at 254 nm and 360 nm. The fraction was collected and lyophilized to afford 4.85 mg of the product.1H NMR (500 MHz, DMSO-d6) = 8.15 (t, 1H, J = 5.9 Hz), 7.90 (m, 3H), 7.74–7.78 (m, 12H), 7.42 (d, 1H, J = 9.0 Hz), 7.15 (d, 1H, J = 9.0 Hz), 7.66 (dd, 1H, J = 9.0, 2.5 Hz), 6.53 (d, 1H, J = 2.5 Hz), 6.06 (s, 1H), 5.55 (m, 1H), 5.43 (m, 1H), 4.05 (s, 2H), 3.91 (t, 1H, J = 7.0 Hz), 3.51–3.47 (m, 7H, overlapped with water peak), 3.26 (q, 2H, J = 6.3 Hz), 3.08 (s, 3H), 1.94 (q, 2H, J = 6.8 Hz), 1.67 (m, 2H), 1.17–1.26 (m, 22H), 0.85 (t, 3H, J = 6.9 Hz) ppm. 13C NMR (126 MHz, DMSO-d6, DEPT) = 135.47, 135.44, 134.01, 133.93, 131.69, 131.60, 130.78, 130.68, 125.26, 109.58, 105.54, 98.20, 71.85, 70.25, 61.01, 58.31, 55.49, 39.18, 39.02, 29.55, 29.53, 29.51, 29.49, 29.45, 29.23, 29.18, 29.03, 22.73, 22.57, 18.97, 18.56, 14.44 ppm. HR-ESI-MS (pos.) C53H69N3O7P, [M]+ calculated: 890.4868, [M]+ found: 890.4860.

Mito-Sa

Mito-Sa was synthesized following the same procedures as of Mito-So and 19 mg of Mito-Sa was obtained (Yield: 50%). Semi-preparative HPLC was used to further purify the product to afford 4 mg of Mito-Sa. 1H NMR (500 MHz, DMSO-d6) = 8.12 (t, 1H, J = 5.8 Hz), 7.89 (m, 3H), 7.73–7.77 (m, 12H), 7.42 (d, 1H, J = 9.0 Hz), 7.19 (d, 1H, J = 9.0 Hz), 6.65 (dd, 1H, J = 9.0, 2.5 Hz), 6.52 (d, 1H, J = 2.5 Hz), 6.05 (s, 1H), 5.14–5.23 (m, 2H), 4.04 (s, 2H), 3.46–3.63 (m, 7H, overlapped with water peak), 3.25 (q, 2H, J = 6.40 Hz), 3.07 (s, 3H), 1.67 (m, 2H), 1.43 (m, 2H), 1.17–1.28 (m, 25H), 0.84 (t, 3H, J = 7.0 Hz) ppm. 13C NMR (126 MHz, DMSO-d6, DEPT) = 134.92, 134.90, 133.47, 133.39, 130.24, 130.14, 124.79, 109.06, 104.98, 97.66, 69.87, 60.67, 60.53, 57.73, 54.97, 38.63, 38.48, 33.31, 31.22, 29.09, 29.04, 28.99, 28.94, 28.63, 25.10, 22.19, 22.03, 18.44, 18.02, 13.90 ppm. HR-ESI-MS (pos.) C53H71N3O7P, [M]+ calculated: 892.5024, [M]+ found: 892.5021. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. [Editors’ note: a previous version of this study was rejected after peer review, but the authors submitted for reconsideration. The first decision letter after peer review is shown below.] Thank you for submitting your work entitled "Mitochondria-specific photoactivation to monitor local sphingosine metabolism and function" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by Suzanne Pfeffer as the Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous. The decision was reached after consultation between the reviewers. Unfortunately, based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife. The reviewers felt that the study had for the most part, been carried out with great care and rigor. However, they felt that significant additional work would be needed to show that the uncaged sphingosine phosphorylation actually takes place in mitochondria. Given their additional concerns, it was not possible to come to a more favorable disposition. Nevertheless, we hope you will find the comments constructive in revising the story for another journal. Reviewer #1: This paper describes the synthesis and use of a novel, mitochondria targeted and caged derivative of sphingosine as a new approach intended for the investigation of compartment-specific sphingosine metabolism in the mitochondria. However, as implemented here, this approach does lacks confirmation that phosphorylation of sphingosine to sphingosine-1-phosphate (S1P) by sphingosine kinase 1 (SphK1) occurs in the mitochondria. Based on the finding that SphK1 is required and that SphK2 is known to be localized to the mitochondria, it is likely that sphingosine that is very rapidly released by uncaging in the mitochondria is rapidly transferred out of the mitochondria into other cellular compartments that contain sphingosine kinase enzyme activity as well as other sphingolipid metabolic enzymes. There are several major concerns, including evidence that levels of S1P are actually increased in the mitochondria, that mitochondrial functions are affected, and lack of evidence that SphK1 is present in mitochondria. Several groups have reported that S1P has various physiological functions in the mitochondria. Although it is shown here that un-caging of mitochondrial targeted sphingosine is rapidly converted to S1P in cells, a reaction the authors consider takes place in the mitochondria, evidence is lacking to show that S1P generated in the mitochondria has a function in there. It is also important to substantiate that the increase in cellular S1P actually takes place in the mitochondria. It has previously been shown that SphK2 is the main sphingosine kinase isoenzyme present in mitochondria. There is no published evidence to date that shows that SphK1 is also in mitochondria. It is necessary to determine whether SphK1 is a mitochondrial resident protein or not. If not, it is difficult to understand how conversion of sphingosine to S1P occurs in the mitochondria. Subsection “Uncaged sphingosine and sphinganine are rapidly phosphorylated”, fourth paragraph: It is misleading to state that SphK1 and SphK2 carry out redundant functions. This was not shown by Mizugishi et al., 2005. Both SphK1 and SphK2 produce S1P, but their presence in different cellular locations suggests that they have compartment specific functions. Although several reports have shown that circulating S1P levels are increased in SphK1 knockout mice, S1P is produced by a compensatory increase in SphK2. This does not indicate that SphK1 and SphK2 have redundant functions but may have some compensatory functions. Subsection “Metabolism of locally uncaged sphingosine”, first paragraph: This sentence is incorrect. "local lipid metabolism" was not monitored at all in this study. Total cellular levels of some sphingolipid metabolites, not local levels, were measured at various times. This was probably at some time after UV uncaging, although this was not stated in the figure legend. It is important to note that whole cell turnover of sphingosine and S1P is a complex process that involves synthesis, metabolism, and degradation. This approach does not reveal anything about rate of conversion of sphingosine to S1P or sphingosine kinase activity since the synthesis and degradation takes place in several subcellular compartments. Therefore, the half-life data in Figure 5 cannot be interpreted as showing that SphK1 is more important than SphK2. Figure 5: The figure title is not correct – only total cellular levels of sphingosine and S1P were measured, not mitochondrial levels. The figure legend does not explain if time (min) is after loading and then uncaging. Why are the S1P levels at 0 min in the SphK1/SphK2 double knockout cells only about 10% of those in the wild type cells? There should be no S1P in cells without SphK1 and SphK2 as S1P can only be produced by SphKs. Expression levels of SphKs should be determined and if present, cells should be characterized as partial deletions, not knockouts. The data on ceramides in panels C and F are meaningless as presented. They are expressed as mol% of total measured cellular lipids, not just sphingolipids, that make up around 99%. These cannot be compared with sphingosine and S1P levels expressed as pmol/million cells. Moreover, expected changes in ceramide levels produced from uncaged sphingosine would be infinitesimal on this mol% basis. All lipid quantitation data should be expressed in molar units per cell, or mg protein, etc. Discussion, third paragraph: As noted by the authors, examination of flux from mitochondria-localized sphingosine into ceramide requires the use of mito-caged, isotope labeled sphingosine. The data in this paper do not address this flux at all and the interpretation and discussion should be revised to clearly indicate this drawback of this study. Furthermore, the statement in the last paragraph of the Discussion should be deleted since this study did not "prove" anything about the importance of subcellular localization in lipid signaling and metabolism or even about sphingosine/S1P signaling and metabolism. Subsection “Lipid extraction and quantification”, first paragraph: It is not clear why this "non-traditional" method was used for extraction of lipids as the references cited either do not contain any relevant methods or involve the determination of sphingoid bases (reference to dos Santos et al. is missing). Internal standards were used, but there is no data on recovery or linearity of assays that should be provided. Furthermore, the 2008 method cited in the second paragraph of the aforementioned subsection for extraction of ceramides has not been validated for ceramides or sphingoid bases by the original authors or by the present authors. Moreover, it is not proper to present quantitative data as percentage of all lipid signals. This does not minimize technical variance, it covers them up and hides changes in minor but important lipids. Reviewer #2: This manuscript from the Riezman lab characterized a novel mitochondrial targeted caged sphingosine. The authors show that the probe is organelle-specific and that efficiently released sphingosine which was then metabolized into S1P. The authors also show that mito-caged Sphingosine did not induce intracellular calcium levels. The work is well done the manuscript is written in a clear and lucid manner. Overall, the impact of the work is limited. The key issue is that the findings are incremental and largely negative or confirmatory. The authors did not show what is the function of mito-targeted sphingosine. In my opinion, this is needed to complete the story. Overall, the work does add to the literature by describing a unique tool – but I feel that this is of interest to a specialized audience and at this point, the work is not of general interest to the larger community. 1) Figure 3 – conversion (phosphorylation) rate of mito-targeted sphingosine is around 25% whereas sphinganine is ~3%. The authors do not discuss this. Is this due to increased metabolism of the latter lipid to Ceramide species? 2) The concept that sphk isoenzymes are localized in the mitochondria is not fully supported by data – other than the few citations that the authors mention (i.e. Strub et al., 2011). The primary data regarding this issue is not unequivocal. The authors data can also be explained by diffusion of released sphingosine and metabolism in other compartments. Just because of two types of caged sphingosines show different effects on calcium, the authors cannot say for sure that diffusion does not occur post-uncaging. 3) Even though the authors address the very low sphingosine levels in their control KD cells (Figure 4), the cells have 10-fold less basal levels of this lipid. This raises the question of why this is. Is this due to increased sphingosine kinase expression or ceramics synthase expression? Or is de novo sphingolipid synthesis pathway suppressed? This could have an effect on cellular response to sphingolipid mediators so should be addressed. 4) In Figure 5, the authors only showed total ceramide levels. Upon uncaging and release of sphingosine, only certain ceramide species are likely altered. Thus, the authors should show individual ceramide species which would allow them to make more definitive statements about ceramide synthase steps. Reviewer #3: In this manuscript, Feng et al. develop a method to release sphingosine specifically in the mitochondria and follow its fate by mass spectrometry. Their data suggest that sphingosine kinases are active within mitochondria, and that the mitochondrial pool of S1P has distinct functions from other subcellular pools. The tool developed is innovative and useful, the results underscore the importance of subcellular control of sphingolipid distribution, and the paper is very clearly written. My comments come with the caveat that I am not a specialist in lipid chemistry. My only two concerns which might require new experiments are: 1) Figure 2F. This is the figure that demonstrates that Mito-So is imported by functional mitochondria, a key point, but all the stains are diffuse. The authors don't provide detail on which MitoTracker they use for the stain (this should be added to the Materials and methods), but presumably they use one that stains functional mitochondria, which is why upon the addition of CCCP both the Mito-So and MitoTracker stains lose definition. It would be nice to add a stain of total mitochondria to show that the cells aren't just dead and sticky. Figure 4B. Could the authors please discuss why they find little reduction in basal S1P in Sphk1/2 KO cells compared controls? Is the signal dominated by S1P from the FBS in the cell culture medium, are they at the limit of detection of their assay, or is something else going on? [Editors’ note: the author responses to the first round of peer review follow.] Reviewer #1: This paper describes the synthesis and use of a novel, mitochondria targeted and caged derivative of sphingosine as a new approach intended for the investigation of compartment-specific sphingosine metabolism in the mitochondria. However, as implemented here, this approach does lacks confirmation that phosphorylation of sphingosine to sphingosine-1-phosphate (S1P) by sphingosine kinase 1 (SphK1) occurs in the mitochondria. Based on the finding that SphK1 is required and that SphK2 is known to be localized to the mitochondria, it is likely that sphingosine that is very rapidly released by uncaging in the mitochondria is rapidly transferred out of the mitochondria into other cellular compartments that contain sphingosine kinase enzyme activity as well as other sphingolipid metabolic enzymes. There are several major concerns, including evidence that levels of S1P are actually increased in the mitochondria, that mitochondrial functions are affected, and lack of evidence that SphK1 is present in mitochondria. Even though we do not find this explanation likely, we accept this criticism and see the need to provide further evidence for S1P formation in mitochondria. To confirm that the phosphorylation of photoreleased sphingosine can occur inside mitochondria, we performed the uncaging assay using purified mitochondria from mouse liver, and observed a significant increase in S1P after uncaging. Together with control experiments showing that if S1P had been formed outside the mitochondria it would not be detected in our assay, our results provide clear evidence that sphingosine can be phosphorylated inside mitochondria. In addition, our studies on metabolism and signalling do not support a model that the mitochondrial sphingosine can easily diffuse in the cell. The new data in Figure 7 clearly show that sphingosine generates a different metabolic pattern depending on the location of the subcellular source. More importantly, we did not detect any calcium spike after photoreleasing mitochondrial sphingosine, in contrast to the calcium spikes after globally uncaging sphingosine. Taken together, our data show that sphingosine metabolism and signalling are highly dependent on its the subcellular localization, which is really the main point of the study.It is technically very difficult to quantify the movement of lipids intracellularly, but our data show, for the first time, that sphingosine or S1P can exit mitochondria and provide a framework to study the kinetics of this process. Several groups have reported that S1P has various physiological functions in the mitochondria. Although it is shown here that un-caging of mitochondrial targeted sphingosine is rapidly converted to S1P in cells, a reaction the authors consider takes place in the mitochondria, evidence is lacking to show that S1P generated in the mitochondria has a function in there. It is also important to substantiate that the increase in cellular S1P actually takes place in the mitochondria. To investigate in this issue, we performed an uncaging assay in purified mitochondria from mouse liver, and observed a significant increase in S1P after uncaging. It has previously been shown that SphK2 is the main sphingosine kinase isoenzyme present in mitochondria. There is no published evidence to date that shows that SphK1 is also in mitochondria. It is necessary to determine whether SphK1 is a mitochondrial resident protein or not. If not, it is difficult to understand how conversion of sphingosine to S1P occurs in the mitochondria. We can understand the reviewer’s point here, but this is not the intended focus of our manuscript. Our goal was not to determine the subcellular localization of sphingosine kinases. Our new data showing S1P formation in mitochondria shows that there must be sphingosine kinase activity in the organelle. This is enough for us. We chose not to localize the sphingosine kinases for two reasons, one, we feel that it distracts from the main point of the manuscript, two, it is quite possible that the localization of the two sphingosine kinases depends on the cell type. Therefore, without a physiological readout of S1P function in the mitochondria, in our opinion, the localization experiments have little added value. To make our point that S1P formation is enzymatic, we have only included the double knockout of both kinases to show this and have removed the single mutants from the new version of the manuscript. Subsection “Uncaged sphingosine and sphinganine are rapidly phosphorylated”, fourth paragraph: It is misleading to state that SphK1 and SphK2 carry out redundant functions. This was not shown by Mizugishi et al., 2005. Both SphK1 and SphK2 produce S1P, but their presence in different cellular locations suggests that they have compartment specific functions. Although several reports have shown that circulating S1P levels are increased in SphK1 knockout mice, S1P is produced by a compensatory increase in SphK2. This does not indicate that SphK1 and SphK2 have redundant functions but may have some compensatory functions. This was really not the point of the manuscript and now with the single mutants removed this comment is no longer relevant. Our meaning of redundant in this case was they both phosphorylate sphingosine and as far as we know their substrate specificity is the same. Subsection “Metabolism of locally uncaged sphingosine”, first paragraph: This sentence is incorrect. "local lipid metabolism" was not monitored at all in this study. Total cellular levels of some sphingolipid metabolites, not local levels, were measured at various times. This was probably at some time after UV uncaging, although this was not stated in the figure legend. It is important to note that whole cell turnover of sphingosine and S1P is a complex process that involves synthesis, metabolism, and degradation. This approach does not reveal anything about rate of conversion of sphingosine to S1P or sphingosine kinase activity since the synthesis and degradation takes place in several subcellular compartments. Therefore, the half-life data in Figure 5 cannot be interpreted as showing that SphK1 is more important than SphK2. We use “Metabolism of locally uncaged sphingosine” as the title of a subsection. Since we performed uncaging in a specific subcellular location (mitochondria), and that most of the detected sphingosine comes after uncaging, it is correct to state it in this way. While sphingolipid homeostasis is a very complex process, our data demonstrate a role of subcellular localization in sphingolipid metabolism. We did not suggest that SphK1 is more important than SphK2. Some of the sphingosine phosphorylation may take place inside the mitochondria and some outside. In fact, this could be expected. We would like to point out that there are no data showing an export of sphingosine or sphingosine 1P from mitochondria, but this is clearly now the case with in our study. Figure 5: The figure title is not correct – only total cellular levels of sphingosine and S1P were measured, not mitochondrial levels. The figure legend does not explain if time (min) is after loading and then uncaging. Why are the S1P levels at 0 min in the SphK1/SphK2 double knockout cells only about 10% of those in the wild type cells? There should be no S1P in cells without SphK1 and SphK2 as S1P can only be produced by SphKs. Expression levels of SphKs should be determined and if present, cells should be characterized as partial deletions, not knockouts. The data on ceramides in panels C and F are meaningless as presented. They are expressed as mol% of total measured cellular lipids, not just sphingolipids, that make up around 99%. These cannot be compared with sphingosine and S1P levels expressed as pmol/million cells. Moreover, expected changes in ceramide levels produced from uncaged sphingosine would be infinitesimal on this mol% basis. All lipid quantitation data should be expressed in molar units per cell, or mg protein, etc. In the new manuscript, we now changed the title of Figure 6 to “Real-time metabolism of mito-caged sphingosine and globally-caged sphingosine in living cells”. To help readers to understand the experiments, we added Figure 6B to illustrate the design of the experiments, which also clarifies the point about the timing of the experiment. The S1P level in SphK dKO cells reflects the technical limit of the detection. Nevertheless, we have decided to remove the data on S1P and ceramides in this figure because the derivation of the half-life of S1P encompasses two events, generation of S1P from sphingosine as well as S1P metabolism and because we have introduced a new experiment that clearly shows the flux from localized sphingosine into ceramide using heavy-isotope labelled sphingosine. For information, the knockout efficiency of the kinases in the dKO cells is close to complete (> 95% ) as demonstrated in Figure 4—figure supplement 1. Our comments on the use of mole% are below. Discussion, third paragraph: As noted by the authors, examination of flux from mitochondria-localized sphingosine into ceramide requires the use of mito-caged, isotope labeled sphingosine. The data in this paper do not address this flux at all and the interpretation and discussion should be revised to clearly indicate this drawback of this study. Furthermore, the statement in the last paragraph of the Discussion should be deleted since this study did not "prove" anything about the importance of subcellular localization in lipid signaling and metabolism or even about sphingosine/S1P signaling and metabolism. We have added in an experiment examining the flux using heavy-isotope labelled sphingosine, so this comment is no longer relevant. We clearly show that mitochondrial sphingosine can find its way into ceramide and sphingomyelin. Subsection “Lipid extraction and quantification”, first paragraph: It is not clear why this "non-traditional" method was used for extraction of lipids as the references cited either do not contain any relevant methods or involve the determination of sphingoid bases (reference to dos Santos et al. is missing). Internal standards were used, but there is no data on recovery or linearity of assays that should be provided. Furthermore, the 2008 method cited in the second paragraph of the aforementioned subsection for extraction of ceramides has not been validated for ceramides or sphingoid bases by the original authors or by the present authors. Moreover, it is not proper to present quantitative data as percentage of all lipid signals. This does not minimize technical variance, it covers them up and hides changes in minor but important lipids. Our extraction method for sphingoide bases has been used and published before (Höglinger et al., 2015; Guri et al., 2017 (just published, referenced in the new version of the manuscript). There is a good description of the method in the STAR methods of the latter article. It is an excellent method for sphingoid bases and amino acids. We are preparing a manuscript for an analytical chemistry journal on the standard curves etc., but the description is a manuscript in itself and would be much too long. The extraction methods for other lipids including ceramides and sphingolipids is commonly used (Matyash et al., 2008). We simply do not agree about the use of percentage of all lipid signals. This does not cover up technical variance, but provides a method for normalization. The method reaches limitations when one has strong variations in a major lipid that then makes other lipid species appear to vary in the opposite direction, but this is not the case here. Sphingoid bases are minor lipids, as mentioned above and are always reported in either relative or in pmoles related to number of cells, not mol%. Reviewer #2: […] Overall, the impact of the work is limited. The key issue is that the findings are incremental and largely negative or confirmatory. The authors did not show what is the function of mito-targeted sphingosine. In my opinion, this is needed to complete the story. Overall, the work does add to the literature by describing a unique tool – but I feel that this is of interest to a specialized audience and at this point, the work is not of general interest to the larger community. We have increased the importance of the findings by adding in experiments on the flux of mitochondrially released sphingosine and proving that phosphorylation can take place in mitochondria. This shows, for the first time, that sphingosine can be exported outside of the mitochondria. The only way this was possible was with the novel and unique tool that we have created and we believe that this, as a first in kind tool, is of great interest. We feel that this approach will be the one that will permit us and other to answer important questions on the role of lipid localization on metabolism and signalling. This manuscript clearly gives an example of this. 1) Figure 3 – conversion (phosphorylation) rate of mito-targeted sphingosine is around 25% whereas sphinganine is ~3%. The authors do not discuss this. Is this due to increased metabolism of the latter lipid to Ceramide species? We now added a sentence in the manuscript. It is possible that sphingosine is better recognized by sphingosine kinases as a substrate, and/or that Mito-Sa is more efficiently accumulated in the cells. Most of the sphingoid base phosphates in cells are sphingosine 1P, so we prefer the latter. This is logical because sphinganine is probably mainly used for biosynthesis and sphingosine is derived from degradation, a process that is more often linked to S1P action. 2) The concept that sphk isoenzymes are localized in the mitochondria is not fully supported by data – other than the few citations that the authors mention (i.e. Strub et al., 2011). The primary data regarding this issue is not unequivocal. The authors data can also be explained by diffusion of released sphingosine and metabolism in other compartments. Just because of two types of caged sphingosines show different effects on calcium, the authors cannot say for sure that diffusion does not occur post-uncaging. To further support the phosphorylation in mitochondria we performed controlled experiments with isolated mitochondria and showed that they can phosphorylation caged Mito-sphingosine. 3) Even though the authors address the very low sphingosine levels in their control KD cells ( de novo sphingolipid synthesis pathway suppressed? This could have an effect on cellular response to sphingolipid mediators so should be addressed. We detected 4.2 times more sphingosine signals in the SphK dKO cells, probably because the S1P pathway is blocked leading to its accumulation. For the genetic experiments we used the HeLa MZ (from Marino Zerial) cells to generate the SphK KO cells because they are more efficiently modified than other HeLa lines that we have tried. The different basal levels of sphingosine are most likely due to the intrinsic difference between cell lines. 4) In Figure 5, the authors only showed total ceramide levels. Upon uncaging and release of sphingosine, only certain ceramide species are likely altered. Thus, the authors should show individual ceramide species which would allow them to make more definitive statements about ceramide synthase steps. We now showed the major ceramide levels in Figure 7—figure supplement 1.
Figure 7—figure supplement 1.

Total lipid profiles after releasing sphingosine in different subcellular compartments.

Values were normalized with respect to the amount of internal standards and were plotted as percentage of all lipid signals. Data represent the average of three independent experiments. Error bars represent SEM.

Reviewer #3: […] My comments come with the caveat that I am not a specialist in lipid chemistry. My only two concerns which might require new experiments are: 1) Figure 2F. This is the figure that demonstrates that Mito-So is imported by functional mitochondria, a key point, but all the stains are diffuse. The authors don't provide detail on which MitoTracker they use for the stain (this should be added to the Materials and methods), but presumably they use one that stains functional mitochondria, which is why upon the addition of CCCP both the Mito-So and MitoTracker stains lose definition. It would be nice to add a stain of total mitochondria to show that the cells aren't just dead and sticky. We used the MitoTracker Orange CMTMRox in our studies. We now added the details in the Materials and methods section. CCCP is commonly used chemical that disrupt the mitochondria potential but does not have acute cell toxicity, and thus we did not provide the images of mitochondria staining. The effects of CCCP on mitochondrial structures have been published by others previously and the mitochondrial staining never looks diffuse like we see with our probe under the influence of CCCP. Figure 4B. Could the authors please discuss why they find little reduction in basal S1P in Sphk1/2 KO cells compared controls? Is the signal dominated by S1P from the FBS in the cell culture medium, are they at the limit of detection of their assay, or is something else going on? S1P level in mammalian cells is very low. The small S1P signal in SphK dKO cells reflects the technical boundary of our detection. It is unlikely that the S1P signal comes from the cell culture medium because of the extensive washing steps prior to lipid extraction and also because S1P is very soluble in aqueous buffer. There might be alternative pathways for S1P production. For instance, one could imagine a deacylation of ceramide 1P. So it would not be entirely unreasonable to still find some S1P in the double KO.
  53 in total

Review 1.  Targeting lipophilic cations to mitochondria.

Authors:  Michael P Murphy
Journal:  Biochim Biophys Acta       Date:  2008-04-08

2.  Removing endotoxin from plasmid samples by Triton X-114 isothermal extraction.

Authors:  Rui Ma; Jun Zhao; Hui-Cong Du; Shuang Tian; Li-Wen Li
Journal:  Anal Biochem       Date:  2012-02-25       Impact factor: 3.365

3.  Glycosylphosphatidylinositol anchors regulate glycosphingolipid levels.

Authors:  Ursula Loizides-Mangold; Fabrice P A David; Victor J Nesatyy; Taroh Kinoshita; Howard Riezman
Journal:  J Lipid Res       Date:  2012-05-24       Impact factor: 5.922

4.  Lipid Cooperativity as a General Membrane-Recruitment Principle for PH Domains.

Authors:  Ivana Vonkova; Antoine-Emmanuel Saliba; Samy Deghou; Kanchan Anand; Stefano Ceschia; Tobias Doerks; Augustinus Galih; Karl G Kugler; Kenji Maeda; Vladimir Rybin; Vera van Noort; Jan Ellenberg; Peer Bork; Anne-Claude Gavin
Journal:  Cell Rep       Date:  2015-08-20       Impact factor: 9.423

5.  A rapidly reversible chemical dimerizer system to study lipid signaling in living cells.

Authors:  Suihan Feng; Vibor Laketa; Frank Stein; Anna Rutkowska; Aidan MacNamara; Sofia Depner; Ursula Klingmüller; Julio Saez-Rodriguez; Carsten Schultz
Journal:  Angew Chem Int Ed Engl       Date:  2014-05-19       Impact factor: 15.336

6.  mTORC2 Promotes Tumorigenesis via Lipid Synthesis.

Authors:  Yakir Guri; Marco Colombi; Eva Dazert; Sravanth K Hindupur; Jason Roszik; Suzette Moes; Paul Jenoe; Markus H Heim; Isabelle Riezman; Howard Riezman; Michael N Hall
Journal:  Cancer Cell       Date:  2017-12-11       Impact factor: 31.743

7.  Alkaline O leads to N-transacylation. A new method for the quantitative deacylation of phospholipids.

Authors:  N G Clarke; R M Dawson
Journal:  Biochem J       Date:  1981-04-01       Impact factor: 3.857

8.  Bifunctional Sphingosine for Cell-Based Analysis of Protein-Sphingolipid Interactions.

Authors:  Per Haberkant; Frank Stein; Doris Höglinger; Mathias J Gerl; Britta Brügger; Paul P Van Veldhoven; Jeroen Krijgsveld; Anne-Claude Gavin; Carsten Schultz
Journal:  ACS Chem Biol       Date:  2015-11-25       Impact factor: 5.100

9.  Photoswitchable diacylglycerols enable optical control of protein kinase C.

Authors:  James Allen Frank; Dmytro A Yushchenko; David J Hodson; Noa Lipstein; Jatin Nagpal; Guy A Rutter; Jeong-Seop Rhee; Alexander Gottschalk; Nils Brose; Carsten Schultz; Dirk Trauner
Journal:  Nat Chem Biol       Date:  2016-07-25       Impact factor: 15.040

10.  Non-vesicular trafficking by a ceramide-1-phosphate transfer protein regulates eicosanoids.

Authors:  Dhirendra K Simanshu; Ravi Kanth Kamlekar; Dayanjan S Wijesinghe; Xianqiong Zou; Xiuhong Zhai; Shrawan K Mishra; Julian G Molotkovsky; Lucy Malinina; Edward H Hinchcliffe; Charles E Chalfant; Rhoderick E Brown; Dinshaw J Patel
Journal:  Nature       Date:  2013-07-17       Impact factor: 49.962

View more
  12 in total

1.  Visible-to-NIR-Light Activated Release: From Small Molecules to Nanomaterials.

Authors:  Roy Weinstain; Tomáš Slanina; Dnyaneshwar Kand; Petr Klán
Journal:  Chem Rev       Date:  2020-10-30       Impact factor: 60.622

2.  Optical manipulation of sphingolipid biosynthesis using photoswitchable ceramides.

Authors:  Matthijs Kol; Ben Williams; Henry Toombs-Ruane; Henri G Franquelim; Sergei Korneev; Christian Schroeer; Petra Schwille; Dirk Trauner; Joost Cm Holthuis; James A Frank
Journal:  Elife       Date:  2019-02-05       Impact factor: 8.140

Review 3.  Lipids: chemical tools for their synthesis, modification, and analysis.

Authors:  Judith Flores; Brittany M White; Roberto J Brea; Jeremy M Baskin; Neal K Devaraj
Journal:  Chem Soc Rev       Date:  2020-07-21       Impact factor: 54.564

4.  Photocleavable Fluorescent Membrane Tension Probes: Fast Release with Spatiotemporal Control in Inner Leaflets of Plasma Membrane, Nuclear Envelope, and Secretory Pathway.

Authors:  Javier López-Andarias; Krikor Eblighatian; Quentin T L Pasquer; Lea Assies; Naomi Sakai; Sascha Hoogendoorn; Stefan Matile
Journal:  Angew Chem Int Ed Engl       Date:  2021-11-23       Impact factor: 16.823

5.  A Coumarin Triflate Reagent Enables One-Step Synthesis of Photo-Caged Lipid Metabolites for Studying Cell Signaling.

Authors:  Nicolai Wagner; Milena Schuhmacher; Annett Lohmann; André Nadler
Journal:  Chemistry       Date:  2019-11-04       Impact factor: 5.236

Review 6.  Caged lipids for subcellular manipulation.

Authors:  Scotland Farley; Aurélien Laguerre; Carsten Schultz
Journal:  Curr Opin Chem Biol       Date:  2021-06-10       Impact factor: 8.822

7.  Sphingosine kinase 1-associated autophagy differs between neurons and astrocytes.

Authors:  Jose F Moruno-Manchon; Ndidi-Ese Uzor; Chandrashekar R Ambati; Vivekananda Shetty; Nagireddy Putluri; Chinnaswamy Jagannath; Louise D McCullough; Andrey S Tsvetkov
Journal:  Cell Death Dis       Date:  2018-05-01       Impact factor: 8.469

8.  Live-cell lipid biochemistry reveals a role of diacylglycerol side-chain composition for cellular lipid dynamics and protein affinities.

Authors:  Milena Schuhmacher; Andreas T Grasskamp; Pavel Barahtjan; Nicolai Wagner; Benoit Lombardot; Jan S Schuhmacher; Pia Sala; Annett Lohmann; Ian Henry; Andrej Shevchenko; Ünal Coskun; Alexander M Walter; André Nadler
Journal:  Proc Natl Acad Sci U S A       Date:  2020-03-25       Impact factor: 11.205

9.  Optical Control of Phosphatidic Acid Signaling.

Authors:  Reika Tei; Johannes Morstein; Andrej Shemet; Dirk Trauner; Jeremy M Baskin
Journal:  ACS Cent Sci       Date:  2021-07-14       Impact factor: 14.553

10.  HaloFlippers: A General Tool for the Fluorescence Imaging of Precisely Localized Membrane Tension Changes in Living Cells.

Authors:  Karolína Straková; Javier López-Andarias; Noemi Jiménez-Rojo; Joseph E Chambers; Stefan J Marciniak; Howard Riezman; Naomi Sakai; Stefan Matile
Journal:  ACS Cent Sci       Date:  2020-07-20       Impact factor: 14.553

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.