Qin Li1, Yanhong Feng1, Xu Chao1,2, Shuai Shi1, Man Liang1, Yumei Qiao1, Bin Wang3, Pin Wang2, Zhenning Zhu4. 1. Department of Gynaecology and Obstetrics, Second Affiliated Hospital, Shanxi University of Chinese Medicine, Xianyang 712000, China. 2. School of Basic Medicine, Shanxi University of Chinese Medicine, Xianyang 712046, China. 3. School of Pharmacy, Shanxi University of Chinese Medicine, Xianyang 712000, China. 4. Department of Gynaecology and Obstetrics, Second Affiliated Hospital, Shanxi University of Chinese Medicine, Xianyang 712000, China doczzn@qq.com.
Abstract
The long non-coding RNA (lncRNA) HOX transcript antisense RNA (HOTAIR) has been found to be overexpressed in many human malignancies and involved in tumor progression and metastasis. Although the downstream target through which HOTAIR modulates tumor metastasis is not well-known, evidence suggests that miR-23b might be involved in this event. In the present study, the expressions of HOTAIR and miR-23b were detected by real-time PCR in 33 paired cervical cancer tissue samples and cervical cell lines. The effects of HOTAIR on the expressions of miR-23b and mitogen-activated protein kinase 1 (MAPK1) were studied by overexpression and RNAi approaches. We found that HOTAIR expression was significantly increased in cervical cancer cells and tissues. In contrast, the expression of miR-23b was obviously decreased. We further demonstrated that HOTAIR knockdown promoted apoptosis and inhibited cell proliferation and invasion in vitro and in vivo Moreover, our data indicated that HOTAIR may competitively bind miR-23b and modulate the expression of MAPK1 indirectly in cervical cancer cells. Taken together, our study has identified a novel pathway through which HOTAIR exerts its oncogenic role, and provided a molecular basis for potential applications of HOTAIR in the prognosis and treatment of cervical cancer.
The long non-coding RNA (lncRNA) HOX transcript antisense RNA (HOTAIR) has been found to be overexpressed in many humanmalignancies and involved in tumor progression and metastasis. Although the downstream target through which HOTAIR modulates tumor metastasis is not well-known, evidence suggests that miR-23b might be involved in this event. In the present study, the expressions of HOTAIR and miR-23b were detected by real-time PCR in 33 paired cervical cancer tissue samples and cervical cell lines. The effects of HOTAIR on the expressions of miR-23b and mitogen-activated protein kinase 1 (MAPK1) were studied by overexpression and RNAi approaches. We found that HOTAIR expression was significantly increased in cervical cancer cells and tissues. In contrast, the expression of miR-23b was obviously decreased. We further demonstrated that HOTAIR knockdown promoted apoptosis and inhibited cell proliferation and invasion in vitro and in vivo Moreover, our data indicated that HOTAIR may competitively bind miR-23b and modulate the expression of MAPK1 indirectly in cervical cancer cells. Taken together, our study has identified a novel pathway through which HOTAIR exerts its oncogenic role, and provided a molecular basis for potential applications of HOTAIR in the prognosis and treatment of cervical cancer.
Cervical cancer is one of the most common gynecologic malignant tumors and the fourth most frequent cancer in women worldwide [1]. Most women diagnosed with cervical cancer are between 35 and 55 years of age, but its onset has a trend of attacking young adults in recent years [2]. Therefore, the early screening for cervical cancer is significant for its prevention and treatment.Circulating, long non-coding RNAs (lncRNAs) are newly recognized diagnostic and prognostic biomarkers for malignant tumors [3,4]. LncRNAs regulate gene expression at the level of chromatin modification, transcription, and post-transcriptional processing [5]. Hox transcript antisense intergenic RNA (HOTAIR) is one of the most well-studied lncRNAs which was first identified by Chang et al. (in 2007) [6]. Recently, HOTAIR has been identified as an oncogenic molecule in different cancers including colorectal cancer [7], hepatocellular carcinoma [8], and cervical cancer [9]. Meanwhile, HOTAIR knockdown inhibited the proliferation, migration, invasion, and induced apoptosis of tumor cells [7,9-11]. A recent study has revealed that increased expression of HOTAIR was associated with decreased survival times in cervical cancer [12]. These researches indicate that HOTAIR may be a useful target for treatment of cervical cancerpatients. However, little is known about the expression and the impact of HOTAIR in the development of cervical cancer.miRNAs are a conserved family of small non-coding RNA molecules that act as important regulators of gene expression at the post-transcriptional level [13]. They can bind to the 3′-UTR of target genes, resulting in the degradation or translational repression of target mRNAs [14,15]. MiRNAs are reported to be involved in diverse biological processes, such as cell proliferation, apoptosis, and death [16]. Some miRNAs have been identified to target tumor-related genes [17]. For example, miR-23b has been reported to play an important part in the initiation and progression of various cancers such as prostate cancer [18], endometrial cancer [19], gliomas [20], and cervical cancer [21]. A recent study has reported that miR-23b was a potential tumor suppressor in cervical cancer [21]. However, the precise molecular mechanism is not well explored about the inhibition effect of miR-23b on cervical cancer progression.Many studies have demonstrated that the mitogen-activated protein kinases (MAPKs) play important roles in regulating cancer cell invasion and metastasis [22]. MAPKs have been implicated in a wide array of physiological processes including cell growth, differentiation, and apoptosis [23]. Besides, it was reported that the up-regulation of miR-23b induced ATSC cell apoptosis via p38 MAPK phosphorylation [24], implying that miR-23b might exert its anticancer effect through inhibition of MAPKs signaling pathway.In the present study, we explored the impacts of HOTAIR in cervical cancer tissues, cell lines, and mouse models. The effects of HOTAIR on miR-23b and MAPK1 were specifically examined.
Materials and methods
Patients
Tumor tissues and corresponding non-cancerous tissues were obtained from 33 patients with cervical cancer (diagnosed from January 2015 to December 2016 at the Department of Gynaecology and Obstetrics, Second Affiliated Hospital, Shanxi University of Chinese Medicine). Additionally, the eligibility of patients required all the following criteria: mentally competent patients with early stage of cervical cancer and without any metastasis, no other active malignancy than cervical cancer, no indication of active infectious disease such as HIV and hepatitis B, and no medical condition that may interfere with the study objectives. The written informed consents were signed by all participants. The present study was approved by the Ethics Committee of Shanxi University of Chinese Medicine.
Cell culture
End1/E6E7, SiHa, HeLa, C4-1, Caski cells (ATCC, Rockville, MD) were grown in DMEM complemented with 10% FBS (vol/vol; Life Technologies, Grand Island, U.S.A.). All cells were cultured at 37°C in a 5% CO2 incubator.
Quantitative real-time PCR
Total RNA was extracted from cells or tissues using TRIzol reagent (Invitrogen, Carlsbad, U.S.A.) according to the manufacturer’s instructions. Equal amounts of RNA were reverse transcribed to cDNA with SuperScript Reverse Transcriptase Kit (Thermo Fisher Scientific, Waltham, U.S.A.). Then, the total cDNA was amplified and analyzed by SYBR Green PCR Master Mix (Thermo Fisher Scientific, Waltham, U.S.A.) in a Fast Real-time PCR 7500 System (Applied Biosystems, Foster City, U.S.A.). The following primers were used: HOTAIR (forward: 5′-CAGTGGGGAACTCTGACTCG-3′; reverse: 5′-GTGCCTGGTGCTCTCTTACC-3′); miR-23b (forward: 5′-ATCACATTGCCAGGGATTACC-3′; reverse: 5′- CACATTGCCAGGGATTACC-3′), GAPDH (forward: 5′-GGCCTTCCGTGTTCCTAC-3′; reverse: 5′-TGTCATCATATCTGGCAGGTT-3′). The original cycle of the threshold (Ct) values were adjusted to GAPDH. Data were converted and presented as the fold changes related to control.
RNAi and overexpression
For HOTAIR knockdown, HeLa cells were transfected with 50 nM of siRNAs targetting HOTAIR (GAACGGGAGUACAGAGAGAUU) and siGFP (CUACAACAGCCACAACGUCdTdT) were used as scrambled control [25]. Full length of HOTAIR, miR-23b mimic, miRNA mimic control, 2′-O-methyl (2′-O-Me)-modified miR-23b inhibitor, and miRNA inhibitor control were chemically synthesized by Shanghai GenePharma Company (Shanghai, China).
Cell viability analysis
HeLa cells were cultured on a 96-well plate and transfected with HOTAIR-siRNA for various times. Cell viability was then measured by the CCK-8 kit (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s instructions.
Flow cytometry analysis of apoptosis
HeLa cells were transfected with HOTAIR-siRNA for 24 h. After washing with ice-cold PBS, the cells were resuspended in Annexin V binding buffer and incubated with FITC-conjugated Annexin V antibody (Cell Signaling Technology, Danvers, U.S.A.) and propidium iodide (1:100 dilutions) for 15 min at room temperature. The cells were then analyzed with a Beckman Counter.
Western blot
Total proteins from cells were prepared with standard protocol. Western blot was performed essentially as before [26]. The primary antibodies were all purchased from Santa Cruz Biotechnology (CA, U.S.A.) and the second antibodies were purchased from Beyotime Biotechnology (Shanghai, China). The dilution ratio of antibodies was shown as follows: GAPDH (1:1000), Ki67 (1:500), PCNA (1:200), cleaved caspase-3 (1:200), cleaved caspase-9 (1:200), matrix metalloproteinase (MMP) 9 (MMP-9) (1:100), vascular endothelial growth factor (VEGF) (1:500), MAPK1 (1:500), mouse and rabbit second antibodies (1:5000).
Cell migration and invasion analyses
HeLa cells transfected with HOTAIR siRNA or scramble were cultured in a 24-well chamber. The confluent cell monolayer was stroked with a pipette tip. Cells were washed to remove detached and damaged cells and then cultured for 24 h. The cell migrations were monitored microscopically and the migration distance was measured from five preset positions for each treatment condition by the ImageJ software.The invasion capacity of HeLa cells was examined using Transwell invasion assay. Briefly, cells were seeded in the upper chamber in serum-free medium, 20% FBS was added to the medium in the lower chamber. After incubating for 24 h, non-invading cells were removed from the top well with a cotton swab, while the bottom cells were fixed in 95% ethanol, stained with Hematoxylin. The cell numbers were determined by counting of the penetrating cells under a microscope at 200× magnification on ten random fields in each well.
Bioinformatics dataset
Prediction of the interaction between miR-23b and HOTAIR or MAPK1 was performed using DIANA TOOLS (http://diana.imis.athena-innovation.gr/DianaTools) as previously described [27].
Luciferase reporter assays
The 3′-UTR of HOTAIR and MAPK1 containing miR-23b-binding sites were PCR amplified and inserted into pGL3 luciferase reporter plasmid. Besides, mutant constructs containing mutations within the binding sites were generated using the TaKaRa MutanBEST Kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions. HeLa cells were co-transfected with miR-23b mimics/inhibitor and wild-type or mutant luciferase reporter plasmid by Lipofectamine 2000 regent (Invitrogen, Carlsbad, U.S.A.). After 24 h transfection, the luciferase activities were measured with a dual luciferase reporter assay system (Promega, Madison, U.S.A.) according to the manufacturer’s instructions. Renilla luciferase intensity was normalized to firefly luciferase intensity.
Animal work and experimental protocols
Female athymic BALB/c mice (nu/nu, 20–25 g body weight) were purchased from the Animal Center of Xi’an Jiaotong University School of Medicine (Xi’an, China). Mice were housed under controled conditions (25 ± 2°C, 70% humidity, and 12-h light/dark periods) and fed on regular sterile chow diet and water ad libitum. The experimental protocol was in accordance with the guidelines of Institutional Animal Care and Use Committee (IACUC) of Shanxi University of Chinese Medicine. All mice were randomly divided into two groups. One group was subcutaneously inoculated in the back with 5 × 106 HeLa cells which have been transfected with HOTAIR siRNA, and another group was treated with scrambled HeLa cells. Animals were monitored for signs of tumor growth. Tumor volumes were calculated at 6–30 days after injection according to the formula: [length (mm) × width (mm) × width (mm) × 0.52] [28]. Upon termination, tumors were harvested, and the mRNA and protein levels were analyzed by qPCR and Western blot.
Immunohistochemistry
Tumor sections were prepared essentially as before [29]. The sections were incubated with VEGF antibody (Cell Signaling Technology, Danvers, U.S.A.) overnight at 4°C, followed by incubation with fluorophore-conjugated secondary antibody (Invitrogen, Carlsbad, U.S.A.) for 1 h. Sections were visualized with a fluorescent microscope.
Statistical analysis
All results were presented as mean ± S.D. The statistical significance of the studies was analyzed using Student’s t test. The difference was considered statistically significant at P<0.05.
Results
HOTAIR is highly expressed in cervical cancer cells
To understand the biological significance of lncRNA HOTAIR in cervical cancer, the mRNA levels of HOTAIR were examined in cervical cancer tissues and corresponding non-cancerous tissues from 33 patients. The results showed that the expressions of HOTAIR in cervical cancer tissues were significantly higher than in normal tissues (Figure 1A). The expressions of HOTAIR were subsequently measured in End1/E6E7 cells and four cervical cancer cell lines (SiHa, HeLa, Caski, and C4-1). As shown in Figure 1B, the mRNA expression levels of HOTAIR were significantly elevated in cervical cancer cells compared with End1/E6E7 cells. These results indicate that HOTAIR has a high expression in cervical cancer cells.
Figure 1
HOTAIR is highly expressed in cervical cancer cells
(A) The mRNA levels of HOTAIR in 33 cervical cancer tissues and adjacent normal tissues were assayed by quantitative real-time PCR (qRT-PCR). (B) The mRNA levels of HOTAIR in End1/E6E7, SiHa, HeLa, Caski, and C4-1 cells were assayed by qRT-PCR. All the experiments were repeated at least three times. GAPDH was used as loading control. **P<0.01 compared with normal cells or tissues.
HOTAIR is highly expressed in cervical cancer cells
(A) The mRNA levels of HOTAIR in 33 cervical cancer tissues and adjacent normal tissues were assayed by quantitative real-time PCR (qRT-PCR). (B) The mRNA levels of HOTAIR in End1/E6E7, SiHa, HeLa, Caski, and C4-1 cells were assayed by qRT-PCR. All the experiments were repeated at least three times. GAPDH was used as loading control. **P<0.01 compared with normal cells or tissues.
HOTAIR knockdown increases apoptosis in cervical cancer cells
Based on the above observations, we next investigated the role of HOTAIR in cervical cancer cell proliferation. A siRNA for HOTAIR knockdown was designed and transfected into HeLa cells. According to the quantitative real-time PCR (qRT-PCR), the relative mRNA level of HOTAIR was decreased significantly after the transfection of HOTAIR-siRNA (Figure 2A). This revealed that the HOTAIR-siRNA used in the present study successfully knocked down HOTAIR in HeLa cells. To determine the role of HOTAIR in cervical cancer cell growth, siHOTAIR transfected cells were used in the CCK-8 assay. As shown in Figure 2B, siRNA-mediated knockdown of HOTAIR decreased cell proliferation by 50% at 96 h post-transfection in HeLa cells. In addition, HOTAIR knockdown significantly increased the percentage of Annexin V-positive apoptotic cells (Figure 2C,D). We also tested the expression of apoptosis- and proliferation-associated proteins in HOTAIR-siRNA treated HeLa cells by Western blot analysis. The data revealed that the expression levels of Ki67 and PCNA were evidently decreased when compared with the control group (Figure 2E). By contrast, the protein levels of cleaved caspase-3 and caspase-9 were significantly up-regulated (Figure 2F). Taken together, HOTAIR knockdown inhibits cell proliferation and promotes cell apoptosis in cervical cancer.
Figure 2
HOTAIR knockdown increases apoptosis in cervical cancer cells
(A) HeLa cells were transfected with HOTAIR siRNA or scramble for 24 h, the mRNA levels of HOTAIR were measured by qRT-PCR. (B) HeLa cells were transfected with HOTAIR siRNA or scramble for 24, 48, 72, and 96 h, the cell viability was assayed by CCK-8 kit. (C) The cell apoptosis was analyzed by Annexin V flow cytometry. (D) Apoptotic cell quantitation for three independent experiments. (E) Protein levels of Ki67 and PCNA were assayed by Western blot. (F) Protein levels of cleaved caspase-3 and cleaved caspase-9 were assayed by Western blot. All the experiments were repeated at least three times and the representative data were shown. GAPDH was used as loading control; *P<0.05, **P<0.01 compared with scramble.
HOTAIR knockdown increases apoptosis in cervical cancer cells
(A) HeLa cells were transfected with HOTAIR siRNA or scramble for 24 h, the mRNA levels of HOTAIR were measured by qRT-PCR. (B) HeLa cells were transfected with HOTAIR siRNA or scramble for 24, 48, 72, and 96 h, the cell viability was assayed by CCK-8 kit. (C) The cell apoptosis was analyzed by Annexin V flow cytometry. (D) Apoptotic cell quantitation for three independent experiments. (E) Protein levels of Ki67 and PCNA were assayed by Western blot. (F) Protein levels of cleaved caspase-3 and cleaved caspase-9 were assayed by Western blot. All the experiments were repeated at least three times and the representative data were shown. GAPDH was used as loading control; *P<0.05, **P<0.01 compared with scramble.
HOTAIR knockdown suppresses migration and invasion of cervical cancer cells
To investigate the effect of HOTAIR on cell migration, siHOTAIR-transfected HeLa cells were used in wound healing assay. As shown in Figure 3A,B, the cell migration levels were significantly reduced after knockdown of HOTAIR. To further explore the role of HOTAIR on cell invasion, the cell matrigel transwell assay was carried out. The capacity of cell invasion was obviously decreased in HeLa cells after HOTAIR suppression (Figure 3C,D). Since VEGF and MMP-9 play an important role in tumor progression by promoting migration and invasion [30-33], the effect of HOTAIR knockdown on the expression levels of these proteins was determined in HeLa cells. As anticipated, the expressions of VEGF and MMP-9 were significantly decreased after transfection with siHOTAIR (Figure 3E–G). Taken together, these findings indicate that HOTAIR knockdown may inhibit cervical cancer cell migration and invasion through the down-regulation of VEGF and MMP-9 expression.
Figure 3
HOTAIR knockdown suppresses migration and invasion of cervical cancer cells
(A) Cell migration assay. HeLa cells were transfected with HOTAIR siRNA or scramble and the cell monolayers were wounded by scraping with a pipette tip. The cell migrations were monitored at 0 and 24 h. (B) Cell migration distances were measured by ImageJ software. (C) Matrigel invasion assay. (D) Quantitation of (C). (E) HeLa cells were transfected with HOTAIR siRNA or scramble for 24 h, the protein levels of MMP-9 and VEGF were assayed by Western blot. (F,G) Quantitation of (E). All the experiments were repeated at least three times and representative results were shown. GAPDH was used as loading control; **P<0.01, ***P<0.001 compared with scramble.
HOTAIR knockdown suppresses migration and invasion of cervical cancer cells
(A) Cell migration assay. HeLa cells were transfected with HOTAIR siRNA or scramble and the cell monolayers were wounded by scraping with a pipette tip. The cell migrations were monitored at 0 and 24 h. (B) Cell migration distances were measured by ImageJ software. (C) Matrigel invasion assay. (D) Quantitation of (C). (E) HeLa cells were transfected with HOTAIR siRNA or scramble for 24 h, the protein levels of MMP-9 and VEGF were assayed by Western blot. (F,G) Quantitation of (E). All the experiments were repeated at least three times and representative results were shown. GAPDH was used as loading control; **P<0.01, ***P<0.001 compared with scramble.
The expression of miR-23b is decreased in cervical cancer cells
Since miR-23b was a potential tumor suppressor in cervical cancer [21], we next investigated the expression of miR-23b in cervical cancer tissues and corresponding non-cancerous tissues from 33 patients. The result showed that the expression of miR-23b in cervical cancer tissues was significantly lower than in normal tissues (Figure 4A). As before, we subsequently compared the expression of miR-23b in End1/E6E7 cells and cervical cancer cell lines including SiHa, HeLa, Caski, and C4-1. As shown in Figure 4B, The mRNA expression levels of miR-23b were significantly decreased in cervical cancer cells compared with End1/E6E7 cells. Collectively, these results indicate that the expression of miR-23b is markedly decreased in cervical cancer cells.
Figure 4
The expression of miR-23b is decreased in cervical cancer cells
(A) The mRNA levels of miR-23b in 33 prostate cancer tissues and adjacent normal tissues were assayed by qRT-PCR. (B) The mRNA levels of miR-23b in End1/E6E7, SiHa, HeLa, Caski, and C4-1 cells were assayed by qRT-PCR. All the experiments were repeated at least three times. **P<0.01 compared with normal cells or tissues.
The expression of miR-23b is decreased in cervical cancer cells
(A) The mRNA levels of miR-23b in 33 prostate cancer tissues and adjacent normal tissues were assayed by qRT-PCR. (B) The mRNA levels of miR-23b in End1/E6E7, SiHa, HeLa, Caski, and C4-1 cells were assayed by qRT-PCR. All the experiments were repeated at least three times. **P<0.01 compared with normal cells or tissues.
HOTAIR down-regulates miR-23b expression
To determine the relationship between HOTAIR and miR-23b, bioinformatics analysis was performed. The result showed that miR-23b and HOTAIR had a 22-bp matched sequence (Figure 5A), indicating that they may have a target-specific selectivity. Then, overexpression of HOTAIR and miR-23b were carried out. The results showed that HOTAIR overexpression in HeLa cells significantly decreased the expression of miR-23b. Cells transfected with miR-23b mimic alone displayed remarkable elevation of miR-23b. However, the increscent effect was partially inhibited when co-transfected with lncRNA-HOTAIR and miR-23b mimic (Figure 5B). Then the HOTAIR siRNA and miR-23b-specific inhibitor were used to knockdown or inhibit their expressions. As shown in Figure 5C, the expression level of miR-23b was significantly increased after HOTAIR knockdown. Conversely, miR-23b inhibitor almost fully suppressed the expression of miR-23b, but the suppressing effect was partially inhibited when adding HOTAIR siRNA. To further determine the bonding effect between HOTAIR and miR-23b, a luciferase reporter containing exact or mutant miR-23b-binding sites were established and transfected into HeLa cells. The results showed that miR-23b mimic significantly decreased the luciferase activity of wild-type HOTAIR reporter plasmid. However, the inhibitory effect of miR-23b mimic was abolished in mutant HOTAIR reporter plasmid (Figure 5D). A significant inverse correlation between HOTAIR and miR-23b was found in HeLa cells (Figure 5E, R2 = –0.884), indicating that abnormal HOTAIR expression might also lead to miR-23b dysregulation due to their interactions. Taken together, HOTAIR may down-regulate miR-23b expression.
Figure 5
HOTAIR down-regulates miR-23b expression
(A) Bioinformatics analysis of HOTAIR and miR-23b. (B) HeLa cells were transfected with lncRNA-HOTAIR and/or miR-23b mimic for 24 h, the levels of miR-23b were measured by qRT-PCR. (C) HeLa cells were transfected with HOTAIR-siRNA and/or miR-23b inhibitor for 24 h, the levels of miR-23b were measured by qRT-PCR. (D) HeLa cells were transfected with wild-type (LncRNAHOTAIRWT) or mutant LncRNAHOTAIR (LncRNAHOTAIRMUT) plasmid and co-transfected with miR-23b mimic for 24 h. Cell lysates were assayed for luciferase activity. (E) Correlation analysis between miR-23b and HOTAIR in HeLa cells. R2 = –0.884; P<0.0001. All the experiments were repeated at least three times. *P<0.05, **P<0.01.
HOTAIR down-regulates miR-23b expression
(A) Bioinformatics analysis of HOTAIR and miR-23b. (B) HeLa cells were transfected with lncRNA-HOTAIR and/or miR-23b mimic for 24 h, the levels of miR-23b were measured by qRT-PCR. (C) HeLa cells were transfected with HOTAIR-siRNA and/or miR-23b inhibitor for 24 h, the levels of miR-23b were measured by qRT-PCR. (D) HeLa cells were transfected with wild-type (LncRNAHOTAIRWT) or mutant LncRNAHOTAIR (LncRNAHOTAIRMUT) plasmid and co-transfected with miR-23b mimic for 24 h. Cell lysates were assayed for luciferase activity. (E) Correlation analysis between miR-23b and HOTAIR in HeLa cells. R2 = –0.884; P<0.0001. All the experiments were repeated at least three times. *P<0.05, **P<0.01.
MAPK1 expression is up-regulated by HOTAIR
Many studies have reported that the MAPKs play regulatory roles in cancer progression [22], and our bioinformatics analysis indicated that miR-23b and MAPK1 had a targetted correlation (Figure 6A). To determine the bonding effect between MAPK1 and miR-23b, the 3′-UTR of MAPK1 containing exact or mutant miR-23b-binding sites were inserted into pGL-3 reporter plasmid and transfected into HeLa cells. The results showed that miR-23b inhibitor significantly increased the luciferase activity of wild-type plasmid, whereas miR-23b mimic notably decreased it. However, the effect of inhibitor or mimic was abolished in mutant plasmid (Figure 6B,C). Based on this, we further investigated whether inhibition of HOTAIR and/or miR-23b affect MAPK1 expression. As shown in Figure 6D, HOTAIR knockdown significantly decreased the expression of MAPK1 and the inhibition of miR-23b displayed an exactly opposite effect. In addition, HOTAIR siRNA combined with miR-23b inhibitor notably weakened the effect of miR-23b inhibitor alone. Western blot analysis verified these results (Figure 6E,F). Accordingly, HOTAIR knockdown significantly reduced miR-23b inhibition induced cell proliferation (Figure 6G), migration (Figure 6H,I), and invasion (Figure 6J,K). Collectively, these results remind us that HOTAIR may contribute to cell proliferation and metastasis of cervical cancer via targetting miR-23b/MAPK1 axis.
Figure 6
MAPK1 expression is up-regulated by HOTAIR
(A) Bioinformatics analysis of miR-23b and MAPK1. (B,C) HeLa cells were transfected with wild-type or mutant MAPK1 reporter plasmid and co-transfected with miR-23b inhibitor (B) or miR-23b mimic (C) for 24 h. Cell lysates were assayed for luciferase activity. (D,E) HeLa cells were transfected with HOTAIR siRNA and/or miR-23b inhibitor for 24 h, the levels of MAPK1 were measured by qRT-PCR (D) and Western blot (E). (F) Quantitation of Figure 3E. (G) Cell viability assay. (H,I) Cell migration assay. (J,K) Matrigel invasion assay. All the experiments were repeated at least three times. GAPDH was used as loading control; **P<0.01, ***P<0.001.
MAPK1 expression is up-regulated by HOTAIR
(A) Bioinformatics analysis of miR-23b and MAPK1. (B,C) HeLa cells were transfected with wild-type or mutant MAPK1 reporter plasmid and co-transfected with miR-23b inhibitor (B) or miR-23b mimic (C) for 24 h. Cell lysates were assayed for luciferase activity. (D,E) HeLa cells were transfected with HOTAIR siRNA and/or miR-23b inhibitor for 24 h, the levels of MAPK1 were measured by qRT-PCR (D) and Western blot (E). (F) Quantitation of Figure 3E. (G) Cell viability assay. (H,I) Cell migration assay. (J,K) Matrigel invasion assay. All the experiments were repeated at least three times. GAPDH was used as loading control; **P<0.01, ***P<0.001.
HOTAIR knockdown decreases tumor growth and metastasis via miR-23b/MAPK1
We next assessed the role of HOTAIR on tumor progression in a mouse model of cervical cancer. As shown in Figure 7A,B, the tumor volume in HOTAIR knockdown mouse model was markedly smaller than in scrambled model at 24–30 days after injection. In addition, the mRNA levels of HOTAIR, miR-23b, and MAPK1 in tumor tissues were detected by qRT-PCR. The results showed that the tissues from HOTAIR knockdown mouse model exhibited higher miR-23b expression and lower MAPK1 expression compared with scrambled model (Figure 7C–E). The results of Western blot analysis were consistent with qRT-PCR (Figure 7F). Furthermore, immunohistochemistry staining showed that the VEGF expression level in HOTAIR knockdown mouse model was significantly decreased (Figure 7G), indicating that HOTAIR knockdown may inhibit cervical cancer cell migration and invasion through the down-regulation of VEGF in cervical cancer model. These results indicate that HOTAIR modulates tumor growth and migration via miR-23b/MAPK1 signaling pathway.
Figure 7
HOTAIR knockdown decreases tumor growth and metastasis via miR-23b/MAPK1
(A) Female mice were injected intraperitoneally with HOTAIR knockdown or scrambled HeLa cells, the tumor size were measured by ruler at day 30. (B) Calculation of tumor volume at 6, 12, 18, 24, 30 days after injection. (C–E) The mRNA level of HOTAIR (C), miR-23b (D), and MAPK1 (E) in tumor tissues at day 30 were detected by qRT-PCR. (F) Western blot analysis of MAPK1 in tumor tissues. (G) Immunohistochemistry analysis of VEGF in tumor tissues. The VEGF proteins were colored brown. All the experiments were repeated at least three times. GAPDH was used as loading control; **P<0.01, ***P<0.001 compared with control tissues.
HOTAIR knockdown decreases tumor growth and metastasis via miR-23b/MAPK1
(A) Female mice were injected intraperitoneally with HOTAIR knockdown or scrambled HeLa cells, the tumor size were measured by ruler at day 30. (B) Calculation of tumor volume at 6, 12, 18, 24, 30 days after injection. (C–E) The mRNA level of HOTAIR (C), miR-23b (D), and MAPK1 (E) in tumor tissues at day 30 were detected by qRT-PCR. (F) Western blot analysis of MAPK1 in tumor tissues. (G) Immunohistochemistry analysis of VEGF in tumor tissues. The VEGF proteins were colored brown. All the experiments were repeated at least three times. GAPDH was used as loading control; **P<0.01, ***P<0.001 compared with control tissues.
Discussion
Accumulating evidence suggest that lncRNAs could be diagnostic and prognostic biomarkers for malignant tumors [34-36]. HOTAIR used in this study has been proven to make a critical effect on the most biological process of cancer and would be a potential new target in tumor treatment [37]. Up to now, HOTAIR had been found overexpressed in many humanmalignancies and acted as a negative prognostic predictor. In the present study, we found overexpression of HOTAIR in cervical cancer tissues and cells lines. In addition, HOTAIR knockdown notably decreased cellular proliferation, migration and invasion, and accelerated cell apoptosis. These findings are consistent with many previous studies [9,12,38].The altered expression of miR-23b has been found to be associated with many types of cancer. In breast cancer, the overexpression of miR-23b is correlated with cell proliferation and metastasis, and has been recognized as an oncogene [39]. In contrast, the expression of miR-23b in breast cancer increases the formation of focal adhesions and cell–cell junctions, thereby indicating a metastatic suppressor role for this miRNA [40]. Furthermore, the expression of miR-23b has been found to be decreased in castration-resistant prostate cancer tissue, while its overexpression suppresses migration and invasion [41,42]. Our study confirmed that miR-23b was significantly down-regulated in cervical cancer cell lines or tissues from cervical cancerpatients compared with normal paired samples. Bioinformatics analysis for the interaction with miR-23b showed a potential binding domain within HOTAIR transcript, and correlation analysis also revealed a strong negative correlation between HOTAIR and miR-23b expression. Furthermore, the potential negative regulation of HOTAIR on miR-23b expression via their interactions was verified in vitro by mutation studies.A recent study reported that HOTAIR promoted tumor aggressiveness in cervical cancers through the up-regulation of VEGF and MMP-9 and epithelial-to-mesenchymal transition (EMT)-related genes [9], but the precise target between HOTAIR and migration-related genes was not well explored. MMPs, a family of zinc-binding proteases, are crucial elements in the degradation of extracellular matrix (ECM) [29]. Amongst MMPs, expressions of MMP-2 and MMP-9 are high in various malignant tumors and are closely related to tumor migration [43]. Previous studies have demonstrated that the expression of MMP-9 was mainly mediated by the MAPK pathway in various cell lines [44,45]. Several studies indicated that suppression of MAPKs had the potential to prevent invasion and metastasis in various cancers [22,44]. In addition, some miRNAs are involved in the regulation of MAPKs, such as miR-23b [24]. In our study, we first found a potential binding domain between miR-23b and MAPK1. HOTAIR knockdown, which caused miR-23b up-regulation, significantly inhibited the expression of MAPK1. On the contrary, the inhibition of miR-23b notably increased MAPK1 expression. Accordingly, cell proliferation and invasion was consistent with the change of MAPK1. Furthermore, in vivo study also showed that HOTAIR knockdown could increase miR-23b expression, decrease MAPK1 expression, and subsequently inhibit tumor cell growth and invasion.Although numerous studies have demonstrated that HOTAIR acts as an oncogene in various cancers, especially in cervical cancer, the exact mechanism is not well documented. Xing et al. [46] found that HOTAIR modulated c-KIT expression by competitively binding miR193a in acute myeloid leukemia cells. Another study demonstrated that HOTAIR competitively bound miR-331-3p regulating HER2 expression in gastric cancer [26]. Similarly, HOTAIR modulated human leukocyte antigen-G by competitively binding miR-148a in cervical cancer cells [47]. All this indicated that miRNAs may play an important role in the tumor-promoting effect of HOTAIR. In our study, we demonstrated that HORAIR down-regulated miR-23b expression and subsequently promoted tumor growth and invasion by MAPK1 up-regulation.In summary, we found that HOTAIR expression was significantly increased in cervical cancer cells and tissues. In contrast, the expression of miR-23b was obviously decreased. Our subsequent in vitro and in vivo studies demonstrated that HOTAIR knockdown promoted apoptosis and inhibited cell proliferation and invasion. More importantly, our data indicated that HOTAIR may competitively bind miR-23b and modulate the expression of MAPK1 indirectly in cervical cancer cells. Understanding the precise molecular mechanism is vital for exploring new potential strategies for early diagnosis and therapy. Our experimental data also suggested that targetting the HOTAIR-miR-23b-MAPK1 axis may represent a novel therapeutic application in cervical cancer.
Authors: Shalanda A Bynum; Heather M Brandt; Patricia A Sharpe; Michelle S Williams; Jelani C Kerr Journal: J Health Care Poor Underserved Date: 2011-05
Authors: Lianjin Jin; Oliver Wessely; Eric G Marcusson; Cristina Ivan; George A Calin; Suresh K Alahari Journal: Cancer Res Date: 2013-01-21 Impact factor: 12.701
Authors: Hee Jung Kim; Dae Woo Lee; Ga Won Yim; Eun Ji Nam; Sunghoon Kim; Sang Wun Kim; Young Tae Kim Journal: Int J Oncol Date: 2014-11-17 Impact factor: 5.650
Authors: Madalina Gabriela Barbu; Carmen Elena Condrat; Dana Claudia Thompson; Oana Larisa Bugnar; Dragos Cretoiu; Oana Daniela Toader; Nicolae Suciu; Silviu Cristian Voinea Journal: Front Cell Dev Biol Date: 2020-03-10