Ying-Hua Song1, Cai-Qing Zhang1, Fang-Fang Chen1, Xiao-Yan Lin2. 1. Department of Respiratory Medicine, Shandong Qianfoshan Hospital, Shandong University, Jinan, Shandong 250014, China. 2. Department of Pathology, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, Shandong 250021, China.
Abstract
BACKGROUND: The E3 ubiquitin ligase neural precursor cell expressed developmentally downregulated 4-1 (NEDD4-1) negatively regulates phosphatase and tensin homolog deleted on chromosome 10 (PTEN) protein levels through polyubiquitination and proteolysis, but its significance in lung cancer is still unclear. This study investigated the expression and the role of NEDD4-1 in tumor development and chemosensitivity of lung adenocarcinoma (ADC). METHODS: We retrospectively investigated the expression and significance of NEDD4-1, PTEN, and p-Akt proteins in 135 paired ADC and adjacent noncancerous tissue specimens using immunohistochemistry. Furthermore, we evaluated the relationship between NEDD4-1 expression and clinicopathologic characteristics and prognosis. The effects of small interfering RNA against NEDD4-1 on proliferation and chemosensitivity were examined in A549 cells in vitro using 3- (4,5-dimethylthiazol-2-yl) -5-(3-carboxymethoxyphenyl) -2-(4-sulfophenyl)- 2H-tetrazolium method. The ability of migration and invasion of A549 cells was tested by transwell assay. Moreover, reverse-transcription quantitative polymerase chain reaction and Western blotting analyses were used to determine the expression of NEDD4-1, PTEN, phosphoinositide 3-kinase (PI3K)/Akt activity, and its downstream target proteins. RESULTS: NEDD4-1 protein was significantly upregulated in lung ADC tissues, whereas it was weak or negative in normal lung epithelial cells. The expression of NEDD4-1 in ADC (78.5%, 106/135) was significantly much higher than that in adjacent normal lung tissue (13.3%, 29/135, P < 0.01), and it was associated with lymph node metastasis, tumor-node-metastasis (TNM) stage, and chemotherapy resistance. PTEN expression was downregulated in lung ADC (60.7% vs. 100.0% in noncancerous specimens, P = 0.007), and was negatively correlated with lymph node metastasis, histological variants, clinical stage, chemoresistance. In addition, expression of p-Akt in ADC tissues (71.1% 96/135) was much higher than that in adjacent lung epithelial cells (6.7%, 9/135, P < 0.01). Kaplan-Meier and multivariate analysis demonstrated that expressions of NEDD4-1 and PTEN were both independent risk factors for survival in patients with lung ADC. NEDD4-1 knockdown in vivo decreased proliferation, migration, and invasion and improved chemosensitivity to cisplatin and paclitaxel in A549 cells. NEDD4-1 knockdown also significantly enhanced PTEN expression and inhibited p-Akt activity and downstream target proteins. CONCLUSIONS: NEDD4-1 upregulation may contribute to the progression of lung ADC. NEDD4-1 may regulate the proliferation, invasion, migration, and chemoresistance of lung ADC cells through the PI3K/Akt pathway, suggesting that it may be regarded as a therapeutic target for the treatment of lung ADC.
BACKGROUND: The E3 ubiquitin ligase neural precursor cell expressed developmentally downregulated 4-1 (NEDD4-1) negatively regulates phosphatase and tensin homolog deleted on chromosome 10 (PTEN) protein levels through polyubiquitination and proteolysis, but its significance in lung cancer is still unclear. This study investigated the expression and the role of NEDD4-1 in tumor development and chemosensitivity of lung adenocarcinoma (ADC). METHODS: We retrospectively investigated the expression and significance of NEDD4-1, PTEN, and p-Akt proteins in 135 paired ADC and adjacent noncancerous tissue specimens using immunohistochemistry. Furthermore, we evaluated the relationship between NEDD4-1 expression and clinicopathologic characteristics and prognosis. The effects of small interfering RNA against NEDD4-1 on proliferation and chemosensitivity were examined in A549 cells in vitro using 3- (4,5-dimethylthiazol-2-yl) -5-(3-carboxymethoxyphenyl) -2-(4-sulfophenyl)- 2H-tetrazolium method. The ability of migration and invasion of A549 cells was tested by transwell assay. Moreover, reverse-transcription quantitative polymerase chain reaction and Western blotting analyses were used to determine the expression of NEDD4-1, PTEN, phosphoinositide 3-kinase (PI3K)/Akt activity, and its downstream target proteins. RESULTS:NEDD4-1 protein was significantly upregulated in lung ADC tissues, whereas it was weak or negative in normal lung epithelial cells. The expression of NEDD4-1 in ADC (78.5%, 106/135) was significantly much higher than that in adjacent normal lung tissue (13.3%, 29/135, P < 0.01), and it was associated with lymph node metastasis, tumor-node-metastasis (TNM) stage, and chemotherapy resistance. PTEN expression was downregulated in lung ADC (60.7% vs. 100.0% in noncancerous specimens, P = 0.007), and was negatively correlated with lymph node metastasis, histological variants, clinical stage, chemoresistance. In addition, expression of p-Akt in ADC tissues (71.1% 96/135) was much higher than that in adjacent lung epithelial cells (6.7%, 9/135, P < 0.01). Kaplan-Meier and multivariate analysis demonstrated that expressions of NEDD4-1 and PTEN were both independent risk factors for survival in patients with lung ADC. NEDD4-1 knockdown in vivo decreased proliferation, migration, and invasion and improved chemosensitivity to cisplatin and paclitaxel in A549 cells. NEDD4-1 knockdown also significantly enhanced PTEN expression and inhibited p-Akt activity and downstream target proteins. CONCLUSIONS:NEDD4-1 upregulation may contribute to the progression of lung ADC. NEDD4-1 may regulate the proliferation, invasion, migration, and chemoresistance of lung ADC cells through the PI3K/Akt pathway, suggesting that it may be regarded as a therapeutic target for the treatment of lung ADC.
Lung cancer is the leading cause of malignancy mortality all over the world, and its incidence has been increasing rapidly in recent years.[1] Non-small cell lung cancer (NSCLC) accounts for 85% of all the pulmonary malignancies, and lung adenocarcinoma (ADC) accounts for 60% of NSCLC, which means ADC is the most common histologic type.[2] Available treatment strategies for ADC include conventional surgery, radiotherapy, immunotherapy, chemotherapy, and combinations of these therapies.[3] Recently, targeted therapies such as epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) have been identified as effective therapeutic strategies capable of improving clinical outcomes in patients with ADC. However, the prognosis of lung ADC is still poor, even in patients with Stage I tumor whose 5-year survival rate is also less than 30%. Especially in patients with advanced ADC, which is often resistant to conventional chemotherapies or TKIs.[4] Because most of the patients are diagnosed in the advanced stage, chemoresistance becomes the most obstacle to clinical therapy to lung ADC patients. Thus, it is essential to discover new biomarkers for predicting prognosis and chemosensitivity to determine new therapeutic targets for the treatment and drug-resistant reversal of lung ADC.At present, loss of phosphatase and tensin homolog deleted on chromosome 10 (PTEN) protein and activation of phosphoinositide 3-kinase (PI3K)/Akt signaling pathway are important mechanisms for promoting tumor cell malignant transformation and tolerance to chemotherapy in lung ADC. The PI3K/Akt pathway is one of the most important intracellular signaling pathways, which can be activated by various growth factors, and phospho-Akt (p-Akt) phosphorylation can activate many downstream target genes such as BAD, mTOR, NF-kB, GSK3 beta, and MDM2 so as to promote cell survival, proliferation, and malignant transformation. Tumor suppressor gene PTEN can dephosphorylate the second messenger phosphatidylinositol-3-phosphate (PIP3) to PIP2, antagonizing the activity of PI3K/Akt signal pathway. Loss of PTEN and activation of Akt have been certificated in many humanmalignant tumors. Several studies have indicated that loss rate of PTEN is about 30–50%, which is the most common early molecular events of lung ADC. Despite gene mutation and deletion, the post-translational modification is another important inactivation mechanism of PTEN. Ubiquitin modification process is the main post-translational regulation way of PTEN degradation in proteasome system, which maybe an important mechanism of loss expression of PTEN.The E3 ubiquitin ligase neural precursor cell expressed developmentally down-regulated 4-1 (NEDD4-1) negatively regulates PTEN protein stability through polyubiquitination.[5] This regulation may activate the PI3K/Akt pathway, which functions in the regulation of proliferation and survival of cells. Negative regulation of PTEN by NEDD4-1-mediated polyubiquitination is reportedly involved in biologic and pathologic processes including axon branching, T-cell activation, keloid formation, and insulin-mediated glucose metabolism.[6] Retrospective clinical studies have found that NEDD4-1 overexpression plays a proto-oncogenic role in cancer development in humanmalignant tumors such as bladder, breast, colon, and prostate cancers.[78] Several studies have also indicated that loss of PTEN confers a chemoresistance and multidrug resistance (MDR) phenotype in vitro,[9] suggesting that NEDD4-1 may be a mechanism of chemoresistance in lung cancer. However, few studies have investigated the expression and clinical significance of NEDD4-1 in lung ADC.In this study, we assessed the clinical significance of NEDD4-1 and its role in chemoresistance in lung ADC. We performed immunohistochemical analysis of 135 samples obtained from a consecutive series of patients with lung ADC to evaluate the relationship between NEDD4-1 expression and clinicopathologic features, chemosensitivity, and prognosis. Furthermore, we explored the in vitro effects of small-interfering RNA (siRNA)-mediated NEDD4-1 knockdown on cell proliferation, migration and invasion, drug sensitivity, and PI3K/Akt pathway in the humanA549 cell line.
METHODS
Ethical approval
This study was approved by the Research Ethics Committee of Shandong Medical University. Informed consent was obtained from all participants of this study.
Clinical specimens
We examined 135 paired paraffin-embedded specimens and adjacent tissues obtained from a series of patients who underwent complete pulmonary lobectomy at the Department of Thoracic Surgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, China, between January 2008 and December 2009. Major patient demographic and clinical characteristics, including tumor size, histologic type and lymph node metastasis, are summarized in Table 1. Tumors were staged according to the seventh edition of the American Joint Committee on Cancer tumor-node-metastasis (TNM) staging system.[10] A pathological diagnosis and histological type was confirmed according to the fourth edition of the WHO classification of tumors of the lung, pleura, thymus, and heart by two separate pathologists.[11] No patients received neoadjuvant chemotherapy or radiochemotherapy before operation. All patients received platinum-based chemotherapy. Curative efficacy was evaluated according to the WHO curative effect evaluation standards for solid tumors after two cycles of treatment. Chemotherapeutic effects were divided into stable disease and progressive disease (PD). All patients in this study had complete follow-up data for >5 years.
Table 1
Correlation between NEDD4-1 and PTEN expression and clinicopathologic factors in 135 consecutive patients with lung adenocarcinoma (=135), (%)
Correlation between NEDD4-1 and PTEN expression and clinicopathologic factors in 135 consecutive patients with lung adenocarcinoma (=135), (%)ALK: Anaplastic lymphoma kinase; EGFR: Epithelial growth factor receptor; NEDD4-1: Neural precursor cell expressed, developmentally down-regulated 4; PTEN: Phosphatase and tensin homolog deleted on chromosome 10; p-Akt: Phosphorylated-Akt.
Immunohistochemistry and evaluation
Immunohistochemical staining was performed using an EnVision™ Detection Kit (Dako, Santa Clara, CA, USA). Briefly, tissue blocks were cut into sections 4 μm thick, deparaffinized, and rehydrated. The tissue sections were placed in boiling sodium citrate buffer (10 mmol/L sodium citrate, 0.05% Tween-20, pH 6.0) for 15 min for antigen retrieval. Next, the slides were blocked with 3% H2O2-methanol followed by 10% normal goat serum for 10 min. After washing with phosphate-buffered saline (PBS), the tissues were incubated with the following primary antibodies overnight at 4°C: anti-NEDD4-1 (1:300; Upstate Biotechnology, NY, USA), anti-PTEN/MMAC1 (1:200; Maxim Biotechnology, Fuzhou, China), and anti-phosphorylated (p)-Akt (1:400; Santa Cruz Biotechnology, Dallas, USA). Then, the slides were incubated for 30 min with a horseradish peroxidase (HRP)-labeled polymer conjugated to a secondary antibody. In addition, nuclei were counterstained with hematoxylin and stained with 3,3’-diaminobenzidine (DAB). Negative controls were prepared by substituting PBS for the primary antibody. Positive slides provided by the companies were used as positive controls. Cytoplasmic staining was scored as NEDD4-1-positive or p-Akt staining, and nuclear staining was scored as PTEN-positive staining. We evaluated the staining results using a dual semi-quantitative scale that combined staining intensity and the percentage of positive cells. Staining intensity was scored as follows: 0, negative; 1, weak; 2, moderate; or 3, strong. The percentage of positive cells was scored as follows: 0, negative or ≤5%; 1, 6–25%; 2, 26–50%; 3, 51–75%; or 4, >75%. The final staining score was calculated by adding the scores for the percentage of positive cells and staining intensity and ranged from 0 to 7. A total score <4 indicated low expression and a score ≥4 indicated high expression. Two pathologists assessed the sections, and we used the average of their scores in the final analyses.
Cell lines and small-interfering RNA transient transfection
The human lung ADC A549 cell line was maintained in Roswell Park Memorial Institute (RPMI) 1640 medium containing 10% fetal bovine serum (FBS) and 100 U/ml penicillin and streptomycin sulfate (Life Technologies, Carlsbad, CA, USA). The cells were cultured in a humidified incubator with 5% CO2 at 37°C. A siRNA against NEDD4-1 (siNEDD4-1) and a negative control (NC) siRNA were designed and purchased from RiboBio Co., Ltd. (Guangzhou, China). The sequences of the siRNAs targeting humanNEDD4-1 at nucleotide 556 were as follows: sense, 5’-CACCGCAGAACAGGC TGAGGAATTATTCAAGAGATAATTCCTCAGCCTGT TCTGCTTTTG-3’; antisense, 5’-GATCCAAAAAAG CAGAACAGGCTGAGGAATTATCTCTTG AATAATTCCTCAGCCTGTTCTGC-3’. The 1 × 105 A549 cells were seeded in 12-well plates and incubated for 12 h before transfection. Then, the A549 cells were transfected with 100 nmol/L of siNEDD4-1 or the NC siRNA in 4 μl of Lipofectamine 3000 Transfection Reagent (Invitrogen Inc., USA). The cells were harvested after 48 h and subjected to next experiment.
Total RNA was obtained from the cells using an RNA Isolation Kit (Takara Bio Inc., Otsu, Japan). According to the manufacturer's protocol, RNA samples were reverse-transcribed to cDNA with random primers in a 20 μl final reaction volume. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to detect NEDD4-1 mRNA levels. RT-qPCR was performed using SYBR® Green Real-Time PCR Master Mix (Toyobo Co., Ltd., Osaka, Japan) in a final reaction volume of 25 μl using an iCycler iQ™ Real-Time PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The primers used were as follows: NEDD4-1 forward, 5’-GGTGGAGGTGTTCGGGCT-3’, reverse: 5’-GCAAGGCCTATTCCGGCTA-3’. The amplification data were calculated using the ΔΔCq method, which was also used to calculate the relative mRNA expression. The relative target gene expression was calculated using the formula for 2−ΔΔCq, where ΔΔCq = target Cq − control Cq, and ΔΔCq = ΔCq target − ΔCq calibrator. The PCR products (10 μl) were separated by electrophoresis on a 2% agarose gel containing ethidium bromide and visualized using ultraviolet (UV) light to identify the specificity.
Western blotting analysis
Frozen tissue (100 mg) was collected from each sample and homogenized for 10 min in tissue protein lysis buffer containing 20 mmol/L Tris-HCl, 1 mmol/L ethylenediaminetetraacetic acid, 50 mmol/L NaCl, 50 mmol/L NaF, 1 mmol/L Na3 VO4, 1% Triton X-100, 1 mmol/L phenylmethanesulfonyl fluoride, and phosphatase inhibitor using a homogenizer, chilled on ice for 30 min, and centrifuged at 10,000 g for 5 min at 4°C. The resulting supernatant was collected and stored at −70°C. Proteins (60 μg/lane) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Following transfer to polyvinylidene fluoride blotting membranes, the blots were incubated in blocking buffer for 2 h at room temperature, followed by incubation with the anti-NEDD4-1 (Upstate Biotechnology, Inc.), anti-PTEN/MMAC1 (Maxim Biotechnology), and anti-p-Akt (Santa Cruz Biotechnology, Inc.,) primary antibodies. The blots were then incubated with an HRP-conjugated secondary antibody. The blots were treated with enhanced chemiluminescence reagents and exposed to film. Images were obtained using a transmission scanner, with β-actin protein as the internal control, and relative quantitative analysis was conducted based on the photodensity ratio of protein:β-actin. All experiments were performed in triplicate and one representative experiment is shown.
Cell viability and chemosensitivity assay
We performed 3-(4,5-dimethylthiazol-2-yl) -5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl) -2H-tetrazolium (MTS) assays to detect the proliferation rate and chemosensitivity to paclitaxel and cisplatin of A549 cells. Briefly, the cells were seeded in 96-well culture plates at a density of 5 × 103 cells/well and cultured for 24, 48, 72, or 96 h. Cisplatin (5, 10, 25, 50, or 100 μmol/L) or paclitaxel (25, 50, 100, 200, or 400 nmol/L) in medium was then added to the cells for another 24 h. After washing with PBS, 80 μl of serum-free medium and 20 μl of MTS solution were added to each well, and the cell plates were incubated at 37°C for 1 h. A microplate reader (Bio-Rad Laboratories, Inc.,) was used to measure the absorbance at 490 nm. The survival rates of the cells were calculated as follows: cell viability = (A490 [anticancer drug +]/A 490 [anticancer drug−]) × 100%. Growth inhibition (%) = 100 − cell survival rate (%). A dose-response curve was plotted, and the half-maximal inhibitory concentrations (IC50) were calculated from at least three independent experiments.
Invasion and migration assay
Cancer cell invasion/migration assays were performed using a 24-well transwell insert with 8 μm pores (Corning Inc., Corning, NY, USA) with/without Matrigel® matrix (BD Biosciences, San Jose, CA, USA). Forty-eight hours after transfection with siNEDD4-1 or the NC siRNA, 1 × 104 cells were resuspended in 200 μl of serum-free medium and seeded into the upper chambers. The lower chambers were filled with 600 μl of RPMI 1640 medium with 10% FBS. After incubation at 37°C for 24 h, cells on the upper surface were gently removed by wiping using a cotton-tipped swab, whereas migrated or invaded cells were attached to the bottom of the membrane. The cells that invaded the membrane to the bottom chamber were fixed in 4% paraformaldehyde for 10 min and then stained with 1% crystal violet for 15 min at room temperature. The number of invading or migrating cells was determined by counting five random fields for each insert and calculated as the mean number of cells per field.
Statistical analysis
All statistical analyses were performed using SPSS Statistics 19.0 (IBM Corp., Armonk, NY, USA) and Prism 5 (GraphPad Software, Inc., San Diego, CA, USA). The Student's t-test was used to analyze differences between the groups. The Chi-squared and Fisher's exact tests were used to analyze the relationship between NEDD4-1 or PTEN expression and clinicopathologic parameters. The Kaplan-Meier method and log-rank test were used to plot survival curves and compute differences between curves. A Cox proportional-hazards model was constructed for the univariate and multivariate analyses of the prognostic value of NEDD4-1 expression. Data represent the means ± standard deviation (SD) of three independent experiments. Statistical significance was defined as P < 0.05.
RESULTS
Neural precursor cell expressed, developmentally downregulated 4 is overexpressed in lung adenocarcinoma tissue
We summarized the pathologic characteristics of lung ADC tumors in Table 1. Positive immunohistochemical staining signal for NEDD4-1 was yellow and brown granules in the cytoplasm. It was strongly and diffuse positive in lung ADC tissues, but this staining was weak or negative in normal lung epithelium cells [Figure 1]. The expression of NEDD4-1 in ADC (78.5%, 106/135) was significantly much higher than that in adjacent normal lung tissue (13.3%, 29/135, χ2 = 30.38, P < 0.01). Positive immunocytochemical staining for PTEN was evident as yellow and brown granules in the nucleus. PTEN was expressed in 60.7% (82/135) tumor specimens and 100.0% (135/135) noncancerous specimens (P = 0.007). The expression of p-Akt in ADC was 71.1% (96/135), which was much higher than that in adjacent lung epithelial cells (6.7%, 9/135, P < 0.01). Tumor tissue overexpressing NEDD4-1 always exhibited the loss of expression of PTEN and upregulation of p-Akt. There was a significant negative correlation between NEDD4-1 and PTEN expression (r = −0.632, P = 0.010) and positive correlation between NEDD4-1 and p-Akt (r = 0.679, P = 0.050; Figure 2).
Figure 1
Expression of NEDD4-1 protein in lung ADC cells. (a) NEDD4-1 expression in ADC and adjacent normal lung tissues (immunohistochemistry; original magnification ×100). (b) Strong NEDD4-1 expression in ADC tissue (immunohistochemistry, original magnification ×400). (c) NEDD4-1 expression in ADC and adjacent normal lung tissues (immunohistochemistry; original magnification ×200). (d) Weak NEDD4-1 expression in adjacent normal lung tissue (immunohistochemistry; original magnification ×400). NEDD4-1: Neural precursor cell expressed, developmentally downregulated 4; ADC: Adenocarcinoma.
Figure 2
Expression of NEDD4-1 and PTEN protein and p-Akt in lung ADC tissue (immunohistochemistry; original magnification, ×400). (a) NEDD4-1 is strongly positive in acinar ADC. (b) PTEN is weakly positive in acinar ADC. (c) P-Akt is strongly positive in acinar ADC. (d) NEDD4-1 is strongly overexpressed in papillary ADC tumor tissue. (e) PTEN is moderately positive in papillary ADC tumor tissue. (f) P-Akt is strongly overexpressed in papillary ADC tumor tissue. (g) NEDD4-1 is strongly overexpressed in solid ADC tumors. (h) PTEN is weakly positive in solid ADC tumors. (i) P-Akt is strongly overexpressed in solid ADC tumors. NEDD4-1: Neural precursor cell expressed, developmentally downregulated 4; PTEN: Phosphatase and tensin homolog deleted on chromosome 10; p-Akt: Phosphorylated-Akt; ADC: Adenocarcinoma.
Expression of NEDD4-1 protein in lung ADC cells. (a) NEDD4-1 expression in ADC and adjacent normal lung tissues (immunohistochemistry; original magnification ×100). (b) Strong NEDD4-1 expression in ADC tissue (immunohistochemistry, original magnification ×400). (c) NEDD4-1 expression in ADC and adjacent normal lung tissues (immunohistochemistry; original magnification ×200). (d) Weak NEDD4-1 expression in adjacent normal lung tissue (immunohistochemistry; original magnification ×400). NEDD4-1: Neural precursor cell expressed, developmentally downregulated 4; ADC: Adenocarcinoma.Expression of NEDD4-1 and PTEN protein and p-Akt in lung ADC tissue (immunohistochemistry; original magnification, ×400). (a) NEDD4-1 is strongly positive in acinar ADC. (b) PTEN is weakly positive in acinar ADC. (c) P-Akt is strongly positive in acinar ADC. (d) NEDD4-1 is strongly overexpressed in papillary ADC tumor tissue. (e) PTEN is moderately positive in papillary ADC tumor tissue. (f) P-Akt is strongly overexpressed in papillary ADC tumor tissue. (g) NEDD4-1 is strongly overexpressed in solid ADC tumors. (h) PTEN is weakly positive in solid ADC tumors. (i) P-Akt is strongly overexpressed in solid ADC tumors. NEDD4-1: Neural precursor cell expressed, developmentally downregulated 4; PTEN: Phosphatase and tensin homolog deleted on chromosome 10; p-Akt: Phosphorylated-Akt; ADC: Adenocarcinoma.
Relationship between neural precursor cell expressed, developmentally downregulated 4 expression and clinicopathologic characteristics of lung adenocarcinoma
The relationship between NEDD4-1 protein expression and patients’ clinicopathologic features was shown in Table 1. NEDD4-1 expression was correlated with lymph node metastasis, clinical stage, and chemosensitivity (P = 0.020, 0.001, and 0.001, respectively), but was not correlated with other clinicopathologic features. The frequencies of lymph node metastasis and II/III TNM stage were significantly higher in the high-NEDD4-1 expression group than the low-NEDD4-1 expression group (lymph node metastasis: 32.1% vs. 10.3%, P = 0.020; II/III TNM stage: 54.7% vs. 13.8%, P = 0.001). Of the 135 patients, 66 exhibited a stable disease, but 42 exhibited PD after chemotherapy. The frequency of PD after conventional chemotherapy was significantly higher in the high-NEDD4-1 group than the low-NEDD4-1 group (37.7% vs. 6.9%; P = 0.001).PTEN expression was negatively correlated with lymph node metastasis, histological type, clinical stage, and chemosensitivity (P = 0.030, 0.010, 0.019, and 0.001, respectively) and was also correlated with EGFR status (P = 0.026), but had no relationship with other clinicopathologic parameters. PTEN expression in the EGFR mutation group was lower than that in the wild-type EGFR group (67.2% vs. 54.4%; P = 0.026). P-Akt was correlated with clinical stage and chemotherapy response (P = 0.010 and 0.035, respectively) but without association with other characteristics.
Neural precursor cell expressed, developmentally downregulated 4 overexpression is predictive of poor prognosis
According to the last follow-up data obtained from all patients, 25 (18.5%) had disease-free survival, 26 (19.3%) survived with tumors, and 84 (62.2%) died of tumor recurrence or distant metastasis. The median overall survival was 35.0 months, and the mean overall survival was 37.8 ± 1.4 months (95% CI: 35.1–40.7 months). Survival curves analysis using Kaplan-Meier method and log-rank test showed that the overall 5-year survival of patients with high-NEDD4-1 expression was much worse than that of patients with low-NEDD4-1 expression (34.6 ± 1.6 months vs. 47.1 ± 2.8 months, P = 0.001). In contrast, patients with high PTEN expression showed a longer survival time, compared with patients with low PTEN expression (42.6 ± 1.7 months vs. 29.9 ± 2.0 months, P = 0.001). In a multivariate Cox regression analysis, TNM stage (P = 0.023, risk ratio[RR] =1.385, 95% CI: 0.521–2.621), chemotherapeutic efficacy (P = 0.043, RR = 1.280, 95% CI: 0.709–2.044), NEDD4-1 (P = 0.023, RR = 2.002, 95% CI: 1.002–4.896), and PTEN (P = 0.031, RR = 1.899, 95% CI: 0.877–3.926) showed a significant association with overall survival [Figure 3a and 3b].
Figure 3
Kaplan-Meier curves with log-rank test for patients with low versus high-NEDD4-1 and PTEN expression in ADC tumors. (a) OS curves of patients with lung ADC according to NEDD4-1 immunostaining. (b) OS curves of patients with lung ADC according to PTEN immunostaining. P values were obtained using the log-rank test (P < 0.05). NEDD4-1: Neural precursor cell expressed, developmentally downregulated 4; PTEN: Phosphatase and tensin homolog deleted on chromosome 10; ADC: Adenocarcinoma; OS: Overall survival.
Kaplan-Meier curves with log-rank test for patients with low versus high-NEDD4-1 and PTEN expression in ADC tumors. (a) OS curves of patients with lung ADC according to NEDD4-1 immunostaining. (b) OS curves of patients with lung ADC according to PTEN immunostaining. P values were obtained using the log-rank test (P < 0.05). NEDD4-1: Neural precursor cell expressed, developmentally downregulated 4; PTEN: Phosphatase and tensin homolog deleted on chromosome 10; ADC: Adenocarcinoma; OS: Overall survival.
To evaluate the effects of NEDD4-1 on A549 cells, we inhibited endogenous NEDD4-1 expression by transfecting siNEDD4-1. As shown in Figure 4, after siNEDD4-1 transfection, NEDD4-1 mRNA and protein expression were effectively reduced [Figure 4a and 4e]. Moreover, MTS assay demonstrated that NEDD4-1 knockdown suppressed cell proliferation compared with the NC siRNA in A549 cells in a concentration- and time-dependent manner [Figure 4b, P < 0.05]. A plot of cell growth showed cell viability was significantly decreased by 43.0 ± 5.0% in A549 cells transfected with siNEDD4-1 at 48 h [Figure 4b, all P < 0.01]. A549 cells were transfected with siNEDD4-1 to investigate its role in cell migration and invasion using transwell assay. After NEDD4-1 knockdown, A549 cells displayed significantly decreased migration and invasion compared with that of cells transfected with the NC siRNA [Figure 4c and 4d; P < 0.05].
Figure 4
Knockdown of NEDD4-1 suppresses cell proliferation. (a) siNEDD4-1 transfection significantly reduced NEDD4-1 mRNA expression in A549 cells. (b) siNEDD4-1 transfection significantly suppressed the proliferation rate of A549 cells. The invasion (c) and migration (d) abilities of A549 cells transfected with siNEDD4-1 were decreased in comparison with those of the negative control. (e) Western blotting showed that siNEDD4-1 transfection decreased expression of NEDD4-1. *P < 0.05, †P < 0.01. NC: Negative control; NEDD4-1: Neural precursor cell expressed, developmentally down-regulated 4; siNEDD4-1: Small-interfering RNA for NEDD4-1.
Knockdown of NEDD4-1 suppresses cell proliferation. (a) siNEDD4-1 transfection significantly reduced NEDD4-1 mRNA expression in A549 cells. (b) siNEDD4-1 transfection significantly suppressed the proliferation rate of A549 cells. The invasion (c) and migration (d) abilities of A549 cells transfected with siNEDD4-1 were decreased in comparison with those of the negative control. (e) Western blotting showed that siNEDD4-1 transfection decreased expression of NEDD4-1. *P < 0.05, †P < 0.01. NC: Negative control; NEDD4-1: Neural precursor cell expressed, developmentally down-regulated 4; siNEDD4-1: Small-interfering RNA for NEDD4-1.
In this study, NEDD4-1 knockdown improved the sensitivity to paclitaxel and cisplatin in a concentration-dependent manner in A549 cells. The IC50 values of cisplatin and paclitaxel in A549 cells were 21.3 ± 2.7 μmol/L and 484.2 ± 22.5 nmol/L, respectively. However, after siNEDD4-1 transfection, the IC50 values of cisplatin and paclitaxel were reduced to 8.5 ± 1.9 μmol/L and 239.6 ± 26.4 nmol/L, respectively (P = 0.002 and 0.001). Western blotting showed that, following inhibition of NEDD4-1 by siRNA transfection, PTEN protein was enhanced in A549 cells (P < 0.05; Figure 5a and 5b). To verify the relationship between NEDD4-1 expression and PI3K/Akt signaling, we monitored the expression of key biomarkers of PI3K/Akt activity after NEDD4-1 was silenced. Western blotting analysis revealed that NEDD4-1 knockdown significantly decreased the level of p-Akt (P < 0.05; Figure 5c), but the total Akt was not decreased. In addition, we also detect the expression changes of several downstream proteins of PI3K/Akt pathway. Specifically, NEDD4-1 knockdown significantly decreased the level of NF-kB, p-mTOR, and increased the level of BAD.
Figure 5
Knockdown of NEDD4-1 improved cell sensitivity to paclitaxel and cisplatin in a concentration-dependent manner. The half-maximal inhibitory concentrations in A549 cells of cisplatin (a) and paclitaxel (b) were reduced from 21.3 ± 2.7 μmol/L and 500 ± 20.0 nmol/L, to 9.5 ± 1.8 μmol/L and 220.5 ± 19.1 nmol/L, respectively (P = 0.002 and 0.001, respectively). (c) siNEDD4-1 reduced the expression of phosphorylated-Akt, mTOR, nuclear factor-κB and enhanced the expression of PTEN and BAD. *P < 0.05, †P < 0.01. NC: Negative control; NEDD4-1: Neural precursor cell expressed, developmentally downregulated 4; siNEDD4-1: Small-interfering RNA for NEDD4-1.
Knockdown of NEDD4-1 improved cell sensitivity to paclitaxel and cisplatin in a concentration-dependent manner. The half-maximal inhibitory concentrations in A549 cells of cisplatin (a) and paclitaxel (b) were reduced from 21.3 ± 2.7 μmol/L and 500 ± 20.0 nmol/L, to 9.5 ± 1.8 μmol/L and 220.5 ± 19.1 nmol/L, respectively (P = 0.002 and 0.001, respectively). (c) siNEDD4-1 reduced the expression of phosphorylated-Akt, mTOR, nuclear factor-κB and enhanced the expression of PTEN and BAD. *P < 0.05, †P < 0.01. NC: Negative control; NEDD4-1: Neural precursor cell expressed, developmentally downregulated 4; siNEDD4-1: Small-interfering RNA for NEDD4-1.
DISCUSSION
E3 ubiquitin ligase NEDD4-1 plays a proto-oncogenic role in tumors through regulating the tumor suppressor PTEN expression by ubiquitination and causing its proteasomal degradation and/or nuclear translocation.[512] Recent studies have found that monoubiquitination of PTEN by NEDD4-1 promotes nuclear accumulation, and polyubiquitination of PTEN inducing its degradation in the cytoplasm, but the concrete mechanism is still unclear. Upregulation expression of NEDD4-1 is a characteristic finding in malignant tumors including breast, colon, bladder, and gastric cancer by immunohistochemical staining. However, limited data are available on NEDD4-1 expression in lung cancer specimens.[13] In this study, we evaluated the expression and clinical significance of NEDD4-1 in lung ADC, as well as PTEN and p-Akt using immunohistochemistry in a cohort of 135 clinical ADC samples. We also examined the relationships between expressions of NEDD4-1, PTEN, and p-Akt and patients’ clinicopathologic features and prognoses.In our study, NEDD4-1 overexpression was evident in ADC specimens compared with normal adjacent tissues. Using immunohistochemistry, several researchers have assessed that NEDD4-1 was upregulated in malignant tumors than in normal tissues including breast, colon, and bladder cancers.[7814] In contrast, in our study, PTEN staining was absent in 63 (39.3%) patients, but all the adjacent lung tissues showed PTEN expression, which is consistent with the previous findings.[1516] We also investigated the relationship between the clinicopathologic features of patients with ADC and NEDD4-1 expression, and found that high-NEDD4-1 expression was significantly associated with lymph node metastasis, TNM Stage II/III, and chemoresistance but was not correlated with other clinicopathologic features. The correlation between tumor stage/lymph node metastasis and NEDD4-1 expression suggests that its overexpression may occur in tumors with a more malignant biologic behavior and maybe predictor of poor prognosis. These results are consistent with those studies on breast and bladder tumors.[8] Furthermore, the frequency of PD after conventional chemotherapy was significantly higher in the high-NEDD4-1 group than in the low-NEDD4-1 group, which suggests that NEDD4-1 upregulation is closely related to chemoresistance.As shown in this study, loss of PTEN expression and overexpression of p-Akt were both positively correlated with lymph node metastasis, clinical stage, and chemosensitivity; in addition, PTEN also related to EGFR status and histological variants. Shin et al.[17] examined PTEN expression and p-Akt in lung ADC and found that both of them were significantly associated with tumor stage, metastasis, and prognosis, which is consistent with our results. Other studies have shown that aberrations in downstream pathways (Akt mutations and loss of PTEN) are one mechanism of resistance to EGFR-TKIs.[18] Kaplan-Meier and Cox regression analyses showed that NEDD4-1 and PTEN expression was associated with poor prognosis in ADC and both were independent prognostic factors. Many studies have confirmed that NEDD4-1 is an independent risk factor for poor prognosis in humancancers including gastric and breast cancers.[814] Our results suggest that there was a significant negative correlation between NEDD4-1 and PTEN and positive correlation between NEDD4-1 and p-Akt. Therefore, NEDD4-1 maybe closely related to tumor cell behavior and prognosis in patients with lung ADC through downregulating PTEN expression and activating PI3K/Akt signaling. However, some studies report contradictory results. In contrast, study of Amodio et al.[7] did not show that the expression of NEDD4-1 and PTEN was associated with clinicopathological factors, and no correlation was found between tumor size, lymph node involvement, and staging. This discrepancy may be attributable to differences in the study populations, the region, and time of follow-up.To evaluate NEDD4-1 role in lung ADC cells, we identified that silencing of NEDD4-1 by siRNA in A549 cells in vitro. MTS assay demonstrated that NEDD4-1 knockdown suppressed cell viability, and transwell assay displayed decreased migration and invasion compared with the NC siRNA in A549 cells. However, NEDD4-1 and its potential mechanisms of action in A549 cells are poorly understood. A recent study reported that the biologic functions of NEDD4-1 in inducing invasion, migration, and metastasis of cancer cells are achieved by its inhibition of GTP-Rap2a[19] and active ras genes.[20]Recently, much attention has been focused on the involvement of PTEN–PI3K/Akt signaling in chemoresistance and MDR. Numerous studies have shown that loss of PTEN and upregulation of the p-Akt is considered related to MDR in some cancer cell lines.[22] Once overactivated, Akt phosphorylates multiple downstream effectors such as members of the caspase family, cell cycle proteins, and nuclear factor-κB, which collectively contribute to promoting cell proliferation, malignancy, invasion, and metastasis.[22] In a study involving 618 patients with advanced ADC treated with platinum-based agents, PTEN polymorphisms were shown to contribute to survival and chemotherapy efficacy.[23] Despite being a regulator of PTEN and an oncogene, the role of NEDD4-1 in the chemosensitivity of lung ADC cells has not been described. NEDD4-1 was shown to induce chemosensitization through ubiquitination of SAG/RBX2.[2425] In this study, Western blotting analysis revealed that NEDD4-1 knockdown significantly increased PTEN expression and decreased the level of p-Akt and improved sensitivity to paclitaxel and cisplatin in a concentration-dependent manner. Furthermore, NEDD4-1 knockdown significantly decreased the level of NF-kB and mTOR and increased the level of BAD, which are the downstream of PI3K/Akt pathway. The genes are key molecular of cell growth, invasion, and apoptosis and may contribute and explain the effects of NEDD4-1 in lung cancer cells. These findings suggest that NEDD4-1 may function in the chemoresistance of A549 cells through regulating the PTEN–PI3K/Akt pathway and downstream target proteins, but the mechanism needs further confirmation with more experiments. Inhibition of NEDD4-1 may provide a new molecular target for the treatment of lung ADC.In conclusion, our results demonstrate that NEDD4-1 expression is overexpression in lung ADC and also associated with chemosensitivity and prognosis. NEDD4-1 plays a key role in disease progression that promotes cell proliferation, migration, and invasion through the inhibition of PTEN expression. NEDD4-1 may be regarded as a potential prognostic biomarker and therapeutic target for the treatment of lung ADC. The mechanism of NEDD4-1 in tumorigenesis and tumor progression warrants further investigation in more detailed studies.
Financial support and sponsorship
This work was supported by a grant from the National Natural Science Foundation of China (No. 81402185).
Authors: William D Travis; Elisabeth Brambilla; Allen P Burke; Alexander Marx; Andrew G Nicholson Journal: J Thorac Oncol Date: 2015-09 Impact factor: 15.609
Authors: Cristina Pérez-Ramírez; Marisa Cañadas-Garre; Miguel Ángel Molina; Ana I Robles; María José Faus-Dáder; Miguel Ángel Calleja-Hernández Journal: Mutat Res Rev Mutat Res Date: 2016-11-23 Impact factor: 5.657
Authors: O S Breathnach; B Freidlin; B Conley; M R Green; D H Johnson; D R Gandara; M O'Connell; F A Shepherd; B E Johnson Journal: J Clin Oncol Date: 2001-03-15 Impact factor: 44.544
Authors: D A Fennell; Y Summers; J Cadranel; T Benepal; D C Christoph; R Lal; M Das; F Maxwell; C Visseren-Grul; D Ferry Journal: Cancer Treat Rev Date: 2016-02-04 Impact factor: 12.111
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5