| Literature DB >> 29263683 |
Ágnes Sonnevend1, Nour Yahfoufi1,2, Akela Ghazawi1, Wafaa Jamal3, Vincent Rotimi3, Tibor Pál1.
Abstract
Carbapenem-resistant Enterobacteriaceae encountered in countries of the Arabian Peninsula usually produce OXA-48-like and New Delhi metallo-beta-lactamases (NDM) carbapenemases. However, a temporary increase in VIM-4-producing, clonally unrelated Enterobacteriaceae strains was described earlier in a Kuwaiti hospital. We investigated the genetic support of blaVIM-4 in six Klebsiella pneumoniae strains, one Escherichia coli, and one Enterobacter cloacae strain and compared it to that of VIM-4-producing isolates from other countries of the region. Five K. pneumoniae strains and the E. coli strain from Kuwait carried an ~165 kb IncA/C-type plasmid indistinguishable by restriction fragment length polymorphism. The complete sequence of one of them (pKKp4-VIM) was established. pKKp4-VIM exhibited extensive similarities to episomes pKP-Gr642 carrying blaVIM-19 encountered in Greece and to the partially sequenced pCC416 harboring blaVIM-4 detected in Italy. In other countries of the region, the only similar plasmid was the one detected in the isolate from the UAE. In all Kuwaiti strains, irrespective of the species and their VIM plasmids, the blaVIM-4 gene was located within the same integron structure (In416), different from those of other countries of the region. Our data show that the spread of this IncA/C plasmid and particularly that of the In416 integron caused a considerable, albeit temporary, increase in the rate of mostly clonally unrelated VIM-producing Enterobacteriaceae strains of multiple species. Monitoring of such events is of high importance as the interference with the spread of mobile genetic elements may represent a formidable challenge to infection control.Entities:
Keywords: Enterobacteriaceae; Middle East; VIM carbapenemase; horizontal gene transfer; multidrug resistance
Year: 2017 PMID: 29263683 PMCID: PMC5724420 DOI: 10.2147/IDR.S149321
Source DB: PubMed Journal: Infect Drug Resist ISSN: 1178-6973 Impact factor: 4.003
Characteristics of VIM-producing Enterobacteriaceae isolated in countries of the Arabian Peninsula
|
|
Notes: Features boxed by thick lines are identical.
As determined by PBRT.
As detected by hybridization.
Abbreviations: PCR, polymerase chain reaction; PFGE, pulsed field gel electrophoresis; Inc, incompatibility; Col, colistin; Ak, amikacin; Fos, fosfomycin; Tet, tetracycline; Tig, tigecycline; NT, non typable; Gn, gentamicin; Chl, chloramphenicol; Azt, aztreonam; PBRT, PCR-based replicon typing; MLST, multi-locus sequence typing; ND, not detected.
Figure 1Restriction fragment length polymorphism of conjugative IncA/C plasmids of the Kuwaiti isolates.
Notes: (A) Digestion with HincII. (B) Digestion with EcoRI. (C) Digestion with HindIII. Lanes 1 and 8, lambda phage DNA digested with HindIII; Lane 2, pKKp1-VIM; Lane 3, pKKp2-VIM; Lane 4, pKKp4-VIM; Lane 5, pKKp6-VIM; Lane 6, pKEc7-VIM and Lane 7, pKKp8-VIM.
Figure 2Structure of pKKp4-VIM.
Notes: (A) Comparison of the complete pKKp4-VIM to pKP-Gr642. (B) Comparison of RI-1 of pKKp4-VIM and pKP-Gr642. (C) Comparison of the three blaVIM-4-bearing integron variants. (D) Comparison of RI-3 of pKKp4-VIM to RI-3 of pKP-Gr642. Gray areas represent ≥95% similarity.
Primers used in sequencing the molecular structures carrying the blaVIM gene
| Primer name | 5′-3′ sequence | Annealing to AJ704863 | Size of products (bp) | Comment |
|---|---|---|---|---|
| AS_ClassIint_L | TGT CGT TTT CAG AAG ACG GCT GC | 5250 | 434 | For amplification and sequencing the 5′ end of class I integron |
| AS_ClassIint_R | CAA ACG TGC CGT AGA ACA AG | 5683C | ||
| AS_intI1_L | GGG AGG ACT TTC CGC AAC CG | 5363 | 1084 | For amplification and sequencing the |
| AS_VIM_R | CGT TAC CAC CGC TGC GTT CG | 6446C | ||
| AS_VIM_GS_S1 | GCC TTG ATG TTA CCC GAG AG | 5937C | NA | |
| AS-VIM4GS-f | GAT GCG TGG AGA CCG AAA CC | 6228 | 1295 | For amplification and sequencing the |
| AS-VIM4GS-r | TGC CTA ACG CCT GAG TTG AG | 7522C | ||
| AS_VIM_L | AAT CGC TCA GTC GCC GAG TA | 7412 | 3750 | For amplification and sequencing the |
| AS_ISPa21_R | CTA TAA GAC ACG AGG TGT CTG | 11161C | ||
| AS_ISPa21_L | CAC CAC AAC CGC AAG AAA TA | 10034 | NA | |
| AS_ISPa21_seq | CGC GCA TCG ATT GTT CGT AG | 10549 | NA | |
| AS_smr_f | GCT GGA CTC TTT GAG ATT GG | 9507 | NA | |
| AS_dhfrI_R | ACC CTT TTG CCA GAT TTG GT | 8597C | NA | |
| AS_aacA7_R | GAG CAA CCT CCG TGA ATC CA | 7955C | NA | |
| AS_VIMdn_LS1 | TTC GTT CAA GCC GAA CTT GC | 8010 | NA | |
| AS_VIMdn_LS2 | AAT AGA CAT CGA GCC GGA AG | 8477 | NA | |
| AS_VIMdn_LS3 | ACA TAG CGT TGC CTT GGT AG | 9030 | NA | |
| AS_orf5_R | TTA GAT TTC GAG TTC TAG GCG TTC TG | NA | 3647 bp (if class I integron classical 3′ end is present) | Primer AS_orf5_R anneals to the 3′ end of the class I integron; the two primers amplify the 3′ region of class I integron if present |
| AS_smr_f | GCT GGA CTC TTT GAG ATT GG | 9507 | ||
| AS_ISPa21_R | CTA TAA GAC ACG AGG TGT CTG | 11161C | NA | Sequencing the amplicon produced by the PCR above |
| AS_ISPa21_L | CAC CAC AAC CGC AAG AAA TA | 10034 | NA | |
| AS_ISPa21_seq | CGC GCA TCG ATT GTT CGT AG | 10549 | NA | |
| AS_sul1_R1 | TTG CCG ATC GCG TGA AGT TC | 13000C | NA | Sequencing the amplicon produced by the PCR using primer AS_orf5_R and AS_smr_f |
| AS_sul1_R2 | CACAACCTGGTCGATATCAC | 13311C | NA | |
| AS_orf5_L | ATGGACAGCGAGGAGC | 13249 | NA | |
| AS_qacED1_L | GCG AAG TAA TCG CAA CAT CC | 11978 | NA | |
| AS_VIMdn_LS4 | GAT CAG ATG CAC CGT GTT TC | 12501 | NA |
Abbreviations: NA, not applicable; PCR, polymerase chain reaction.
MIC values of antibiotics against VIM-producing strains and their derivatives
| Strain | Type | Ceftazidime | Cefotaxime | Azt | Ertapenem | Imipenem | Meropenem | Ciprofloxacin | Gn | Ak | Co-trimoxazole | Tet | Chl | Col | Tig | Fos |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| KKp1 | W | >128 | >128 | >128 | >64 | 128 | 128 | 2 | 256 | 32 | >256/4864 | >256 | >256 | <0.5 | 2 | 64 |
| J53RAZ(pKKp1-VIM) | TC | >128 | 128 | 128 | 16 | 8 | 2 | <0.125 | 32 | 8 | 128/2432 | 32 | 256 | <0.5 | 0.25 | 0.5 |
| KKp2 | W | >128 | >128 | >128 | >64 | 128 | 128 | 2 | 256 | 32 | >256/4864 | >256 | >256 | <0.5 | 2 | 64 |
| J53RAZ(pKKp2-VIM) | TC | 128 | 128 | 128 | 4 | 2 | 2 | <0.125 | 32 | 8 | 128/2432 | 32 | 256 | <0.5 | 0.25 | 0.5 |
| KEcl3 | W | >128 | >128 | >128 | >64 | 64 | 32 | 2 | >256 | 16 | >256/4864 | 4 | 16 | 4 | 0.5 | 32 |
| KKp4 | W | 128 | 128 | 32 | 64 | 16 | 16 | 0.5 | 64 | 16 | >256/4864 | >256 | 256 | <0.5 | 8 | 16 |
| J53RAZ(pKKp4-VIM) | TC | 64 | 32 | 32 | 4 | 1 | <0.25 | <0.125 | 16 | 4 | 128/2432 | 32 | 16 | <0.5 | 0.25 | 2 |
| KKp6 | W | 128 | >128 | >128 | 64 | 16 | 8 | 16 | 128 | 8 | >256/4864 | >256 | >256 | <0.5 | 8 | 4 |
| J53RAZ(pKKp6-VIM) | TC | 128 | 64 | 64 | 4 | 2 | 1 | <0.125 | 16 | 8 | 128/2432 | 64 | 128 | <0.5 | 0.25 | 2 |
| KEc7 | W | >128 | >128 | 64 | 64 | 8 | 8 | >64 | 64 | 16 | >256/4864 | 128 | 256 | <0.5 | 0.5 | 0.5 |
| J53RAZ(pKEc7-VIM) | TC | 64 | 64 | 64 | 16 | 2 | 0.5 | <0.125 | 16 | 8 | 256/4864 | 128 | 256 | <0.5 | 0.25 | 1 |
| KKp8 | W | >128 | >128 | >128 | 64 | 16 | 8 | >64 | 128 | 16 | >256/4864 | >256 | >256 | <0.5 | 0.5 | 16 |
| J53RAZ(pKKp8-VIM) | TC | 64 | 64 | 32 | 4 | 2 | <0.25 | <0.125 | 16 | 8 | 128/2432 | 64 | 128 | <0.5 | 0.25 | 2 |
| KW11 | W | >128 | >128 | >128 | >64 | >128 | 128 | >64 | 256 | 32 | >256/4864 | >256 | 16 | 64 | 2 | 128 |
| SA4/2 | W | 64 | >128 | 1 | 64 | 64 | 16 | 1 | 2 | 32 | >256/4864 | 4 | 8 | <0.5 | 1 | 4 |
| J53RAZ(pSA4/2-VIM) | TC | 32 | 64 | 0.5 | 32 | 4 | 2 | 0.25 | 1 | 8 | <0.5/9.5 | 2 | 8 | <0.5 | <0.125 | 1 |
| OM63 | W | 128 | >128 | >128 | 32 | 4 | 4 | 64 | 2 | 16 | >256/4864 | >256 | 8 | <0.5 | 0.5 | 32 |
| DH5α(pOM63-VIM) | TF | 16 | 32 | <0.25 | 2 | 0.5 | <0.25 | <0.125 | 1 | 8 | <0.5/9.5 | <0.5 | 1 | <0.5 | <0.125 | <0.25 |
| OM69 | W | 128 | >128 | 128 | 64 | 64 | 4 | 32 | 2 | 16 | >256/4864 | 256 | 8 | <0.5 | 0.5 | 32 |
| DH5α(pOM69-VIM) | TF | 16 | 32 | <0.25 | 2 | 0.5 | <0.25 | <0.125 | 1 | 8 | <0.5/9.5 | <0.5 | 1 | <0.5 | <0.125 | <0.25 |
| ABC104 | W | >128 | >128 | >128 | >64 | 32 | 4 | 32 | 64 | 8 | >256/4864 | >256 | 128 | <0.5 | 8 | 64 |
| J53RAZ | R | <0.25 | <0.25 | <0.25 | <0.125 | <0.25 | <0.25 | <0.125 | 1 | <0.5 | <0.5/9.5 | <0.5 | 8 | <0.5 | <0.125 | 0.5 |
| DH5α | R | <0.25 | <0.25 | <0.25 | <0.125 | <0.25 | <0.25 | <0.125 | 1 | 1 | <0.5/9.5 | <0.5 | 1 | <0.5 | <0.125 | <0.25 |
Abbreviations: MIC, minimal inhibitory concentration; Azt, aztreonam; Gn, gentamicin; Ak, amikacin; Tet, tetracycline; Chl, chloramphenicol; Col, colistin; Tig, tigecycline; Fos, fosfomycin; W, wild; TC, transconjugant; TF, transformant; R, recipient.