| Literature DB >> 29255452 |
Pia I Scherer1, Andrew D Millard2, Andreas Miller3, Renate Schoen3, Uta Raeder1, Juergen Geist1, Katrin Zwirglmaier1.
Abstract
Bacterioplankton plays an essential role in aquatic ecosystems, and cyanobacteria are an influential part of the microbiome in many water bodies. In freshwaters used for recreational activities or drinking water, toxic cyanobacteria cause concerns due to the risk of intoxication with cyanotoxins, such as microcystins. In this study, we aimed to unmask relationships between toxicity, cyanobacterial community composition, and environmental factors. At the same time, we assessed the correlation of a genetic marker with microcystin concentration and aimed to identify the main microcystin producer. We used Illumina MiSeq sequencing to study the bacterioplankton in two recreational lakes in South Germany. We quantified a microcystin biosynthesis gene (mcyB) using qPCR and linked this information with microcystin concentration to assess toxicity. Microcystin biosynthesis gene (mcyE)-clone libraries were used to determine the origin of microcystin biosynthesis genes. Bloom toxicity did not alter the bacterial community composition, which was highly dynamic at the lowest taxonomic level for some phyla such as Cyanobacteria. At the OTU level, we found distinctly different degrees of temporal variation between major bacteria phyla. Cyanobacteria and Bacteroidetes showed drastic temporal changes in their community compositions, while the composition of Actinobacteria remained rather stable in both lakes. The bacterial community composition of Alpha- and Beta-proteobacteria remained stable over time in Lake Klostersee, but it showed temporal variations in Lake Bergknappweiher. The presence of potential microcystin degraders and potential algicidal bacteria amongst prevalent Bacteroidetes and Alphaproteobacteria implied a role of those co-occurring heterotrophic bacteria in cyanobacterial bloom dynamics. Comparison of both lakes studied revealed a large shared microbiome, which was shaped toward the lake specific community composition by environmental factors. Microcystin variants detected were microcystin-LR, -RR, and -YR. The maximum microcystin concentrations measured was 6.7 μg/L, a value still acceptable for recreational waters but not drinking water. Microcystin concentration correlated positively with total phosphorus and mcyB copy number. We identified low abundant Microcystis sp. as the only microcystin producer in both lakes. Therefore, risk assessment efforts need to take into account the fact that non-dominant species may cause toxicity of the blooms observed.Entities:
Keywords: Microcystis; bacterioplankton; cyanobacteria; harmful algal bloom; high-throughput sequencing; mcyB; mcyE; microcystin
Year: 2017 PMID: 29255452 PMCID: PMC5722842 DOI: 10.3389/fmicb.2017.02387
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Information about primers and probes used in this study.
| Target gene | Primer name | Sequence 5′ to 3′ | Use | Approximately product size (bp) | Source |
|---|---|---|---|---|---|
| GAAATTTGTGTAGAAGGTGC | clone library | 809 | |||
| AATTCTAAAGCCCAAAGACG | |||||
| 30F | CCTACCGAGCGCTTGGG | qPCR | 102 | ||
| 108R | GAAAATCCCCTAAAGATTCCTGAGT | ||||
| CACCAAAGAAACACCCGAATC TGAGAGG | |||||
| 611F | CTAGAGTAGTCACTCACGTC | qPCR | 148 | ||
| 737R | GGTTCTTGATAGTTAGATTGAGC | ||||
| 16S-rRNA | Bakt_341F | Illumina amplicon PCR | 498 | Modified from | |
| Bakt_805R |